Global Diversity, Host Associations, and New Insights into Aigialaceae, Astrosphaeriellaceae, and Pseudoastrosphaeriellaceae

Abstract

During a survey of plant litter-associated microfungi in Guangdong and Jiangxi Provinces, China, several specimens that have carbonaceous ascomata were collected. Morphological characteristics combined with multi-gene (LSU, SSU, and tef1-α) phylogeny revealed that they belong to the Aigialaceae, Astrosphaeriellaceae, and Pseudoastrosphaeriellaceae families. Phylogenetic analyses were conducted using Maximum Likelihood (ML) and Bayesian Inference (BI) approaches. Caryospora pruni and Pseudoastrosphaeriella zingiberacearum are introduced as new species, and Astrosphaeriella bambusae, C. quercus, Fissuroma caryotae, and Neoastrosphaeriella aquatica are introduced as new host records. In addition, Caryospora minima is synonymized under C. aquatica based on close morphological and phylogenetic relationships. All the newly introduced species fit well with their respective generic concepts and can be distinguished from closely related species in their morphology and DNA molecular data. The new host records also provide similar morphological characteristics to their respective type species, and multi-gene phylogeny analyses also offer evidence for their placements. In addition, we compiled the geographical distribution and host associations of species in Aigialaceae, Astrosphaeriellaceae, and Pseudoastrosphaeriellaceae. This provides a database for future studies to understand the ecological interactions and geographical variations.

1. Introduction

Global fungal diversity is a critical aspect of global biodiversity, and realistic estimations have been controversial for decades (Figure 1). Mycologists have used various estimation criteria to achieve the realistic fungal diversity over time [1,2,3,4,5,6,7,8]. For instance, based on the plant-to-fungi ratio of 1:6, Hawksworth [1] estimated that there are approximately 1.5 million species. This assessment was revised by Hammond [2] and Rossman [3] and assessed to have 1 million species. Subsequently, the number of fungal species worldwide fluctuated significantly with varying numbers, such as 1.5 million [9], 9.9 million [10], 0.5 million [4], >1.5 million [11], 0.5–9.9 million [12], 3.5–5.1 million [13], 0.72 million [14], 5.1 million [5], and 1.5–3 million [15]. In 2017, Hawksworth and Lücking adjusted the fungal diversity figure to 2.2–3.8 million species, considering plant-to-fungi ratios, hidden cryptic species, high-throughput data, unexplored habitats, and the ongoing discovery of novel taxa. This was further expanded to 11.7–13.2 million [7] and to 6.3 million species [16,17] with the consideration of high-throughput sequencing (HTS)-powered metabarcoding approaches.

This dramatic increase in estimated diversity is attributed to advancements in DNA sequencing technologies and the comprehensive studies that collectively assess fungal diversity across various ecosystems. However, despite this vast diversity of fungal communities, only about 150,000 species have been formally described, highlighting a considerable gap in our understanding of fungal life forms and their ecological roles [18]. The discrepancy between estimated and described species numbers emphasizes the need for extensive investigations into fungal diversity, especially within unexplored niches and biodiversity hotspots, substrates, and regions.

Figure 1. Estimations of the global number of fungal species [19,20,21,22,23,24,25,26,27,28,29,30,31,32,33].

Figure 1. Estimations of the global number of fungal species [19,20,21,22,23,24,25,26,27,28,29,30,31,32,33].

China is recognized as a global hotspot for fungal diversity, particularly due to the vast geographical and ecological variety (e.g., forests, grasslands, lakes, mangroves, mountains, rivers, and seas), which contributes to a rich array of fungal species [34,35,36]. In particular, the highly variable climate and luxuriant vegetation in China make favorable settings for the growth and reproduction of fungal species [37,38]. Over the past three decades, mycologists in China have significantly contributed to the inclusive range of fungal discoveries [34,38,39,40,41,42,43,44,45]. Initially, fungal taxonomy studies in China were mainly based on morphological characteristics coupled with hand-drawn illustrations with descriptions and taxonomic keys [46,47,48,49]. However, this has undergone a revolutionary shift from traditional morphology-based identification to molecular-based techniques with the rapid evolution of DNA sequencing technology [45,50,51,52]. In addition, current HTS platforms generate millions of barcode reads within hours, enabling researchers to resolve cryptic species, detect rare or dark taxa in complex substrates, and reconstruct phylogenies [53,54,55]. As a result, China has emerged as a key contributor to global fungal research, with an increasing number of studies and novel discoveries. Currently, China accounts for almost 7% of recorded fungal species, occupying the second-highest position worldwide [38].

Therefore, our research group at the College of Life Science and Oceanography in Shenzhen University has been conducting investigations into the microfungal diversity of plant litter substrates (e.g., dead wood, leaves, branches, seeds, twigs, and fruits) in China. Mainly, we are focusing on their geographical distribution, host associations, morphological characteristics, and phylogenetic affinities [56,57]. As a result, we collected six plant litter specimens bearing carbonaceous ascomata from Arenga undulatifolia, Citrus maxima, Hedychium coronarium, Metroxylon sagu, Phoenix paludosa, and Prunus persica. They apparently belong to the families Aigialaceae, Astrosphaeriellaceae, and Pseudoastrosphaeriellaceae based on ascomata characteristics (e.g., carbonaceous, conical to hemispherical shape) and the previous literature [58,59,60]. The objectives of this study are (1) to identify the isolated taxa using both morphology and phylogenetic approaches and (2) to provide an updated checklist (host occurrence and global distribution) of the species in Aigialaceae, Astrosphaeriellaceae, and Pseudoastrosphaeriellaceae. In particular, this study offers a database for future studies to understand the worldwide distribution and host connections of those families.

2. Materials and Methods

2.1. Samples Collection, Microscopic Observations, and Fungal Isolation

Decaying plant litter samples (dead stems and pericarp of fruit) were collected from Guangdong and Jiangxi Provinces during 2024–2025. Collected specimens were taken back to the laboratory in sealed envelopes for morphology examination. All the specimens were incubated in a plastic box with a wet tissue paper (two days). Initially, the macro-morphological characteristics were checked using a stereomicroscope (AXIOSKOP 2 PLUS Series, Göttingen, Germany), and mainly surface characteristics of ascomata, such as color, shape, and position of the host surface (e.g., immersed, semi-immersed, and erumpent or superficial), were recorded. Ascomata were manually sectioned using a razor blade and mounted in water on a slide to observe their microscopic features (e.g., shape, the arrangement of peridium cells). Microscopic slides were prepared using the needle of an aseptic syringe and distilled water. Micro-morphological characteristics were examined using a Nikon ECLIPSE Ni-U compound microscope (Nikon Corporation, Tokyo, Japan), equipped with a Canon Axiocam 506 color digital camera (Hanover, Germany). Indian ink was used to determine the presence of the mucilaginous sheath of ascospores. Lactoglycerol and nail polish were used to prepare the permanent slides for future studies. Measurements were obtained using NIS-Elements version 5.10 imaging software when capturing photographs. Photo plates were prepared using Adobe Photoshop CS6 Extended version 10.0 software (Adobe Systems, San Jose, CA, USA).

Single ascospore isolation was conducted, and germinated spores were processed by following the methods described in Senanayake et al. [61]. Pure cultures were grown in potato dextrose agar (PDA) medium at room temperature (24–28 °C). Culture characteristics, such as color, density, shape, elevation, surface, edge, consistency, and margin, were observed after three weeks. Type specimens were deposited at room temperature (24–28 °C) in the Herbarium of Fungi, Shenzhen University, Shenzhen, China. Living cultures were deposited in the Culture Collection of Microbial Shenzhen University (MBSZU), Shenzhen University, Shenzhen, China. The new taxa were registered in Index Fungorum numbers (https://www.indexfungorum.org/names/Names.asp, accessed on 20 September 2025).

2.2. DNA Extraction, PCR Amplification, and Sequencing

The scraped fungal mycelia (grown on PDA for 4 weeks at 24–28 °C) were used for the DNA extraction (for Astrosphaeriella bambusae, Caryospora pruni, and Pseudoastrosphaeriella zingiberacearum). Initially, axenic mycelium (50–100 mg) was crushed to a fine powder using glass beads (acid-washed, 212–300 µm, Norcross, GA 30071, USA). The extraction process was conducted using a DNA extraction kit (E.Z.N.A. Tissue DNA Kit, D3396-02, Omega Biotek, Inc., Norcross, GA 30071, USA) following the manufacturer’s protocol with various chemical solutions such as BL Buffer, HBC Buffer, DNA Wash Buffer, Elution Buffer, and OB Protease Solution. Some fungal species did not germinate (Caryospora quercus, Fissuroma caryotae, and Neoastrosphaeriella aquatica species), and thus, their DNA extraction was performed using fruiting bodies. The E.Z.N.A. Forensic DNA Kit-D3591-01 (Omega Biotek, Inc., Norcross, GA 30071, USA) was used for their DNA extraction. Polymerase chain reactions (PCR) were conducted to amplify regions of the small nuclear ribosomal subunit rDNA (SSU), large nuclear ribosomal subunit rDNA (LSU), and translation elongation factor 1-alpha gene (tef1-α) genes, using the primer pairs as mentioned in Table 1. The total volume of the PCR reaction was 25 µL containing 12.5 µL 2X PCR MasterMix (TIANGEN Co., Beijing, China), 9.5 µL double-distilled water, 1 µL genomic DNA, and 1 µL of each forward and reverse primer (stock of 10 pM). Thermal cycle programs for LSU, SSU, and tef1-α genes were followed as mentioned in Tennakoon et al. [56]. PCR products were detected by NanoDrop One (Thermo Fisher Scientific, Waltham, MA, USA) and 1% agarose gels, and then sequenced by Beijing Liuhe BGI Genomics Co., Ltd., Beijing, China, using the same primers used for PCR amplification. The generated sequences were deposited in GenBank, and accession numbers were obtained (Table 2).

Table 1. Forward and reverse primer information of LSU, SSU, and tef1-α gene regions.

Locus	Primers	Reference
LSU	Forward: LR0R GTACCCGCTGAACTTAAGC	[62]
	Reverse: LR5 ATCCTGAGGGAAACTTC
SSU	Forward: NS1 GTAGTCATATGCTTGTCTC	[63]
	Reverse: NS4 CTTCCGTCAATTCCTTTAAG
tef1-α	Forward: EF1-983F GCYCCYGGHCAYCGTGAYTTYAT	[64]
	Reverse: EF1-2218R ATGACACCRACRGCRACRGTYTG

Table 1. Forward and reverse primer information of LSU, SSU, and tef1-α gene regions.

Locus	Primers	Reference
LSU	Forward: LR0R GTACCCGCTGAACTTAAGC	[62]
	Reverse: LR5 ATCCTGAGGGAAACTTC
SSU	Forward: NS1 GTAGTCATATGCTTGTCTC	[63]
	Reverse: NS4 CTTCCGTCAATTCCTTTAAG
tef1-α	Forward: EF1-983F GCYCCYGGHCAYCGTGAYTTYAT	[64]
	Reverse: EF1-2218R ATGACACCRACRGCRACRGTYTG

2.3. Phylogenetic Analyses

Based on the corresponding Sanger sequencing chromatograms, sequences were initially checked with BioEdit v 7.0.5.3 [65]. Ambiguous regions from the ends of raw sequencing fragments were manually trimmed and assembled into consensus sequences using SeqMan Pro Version 7.1.0 (DNASTAR, Inc., Madison, WI, USA). Consensus sequences were used for BLAST searches in GenBank (https://blast.ncbi.nlm.nih.gov/Blast.cgi). The BLAST search results and sequences from the latest publications were used to obtain sequence data for the phylogenetic analyses [59,60,66]. Individual gene regions were aligned using MAFFT v.7 (http://mafft.cbrc.jp/alignment/server/, accessed on 1 September 2025) and trimmed to remove ambiguous bases using TrimAl 1.2 [67,68]. Aligned sequences were combined using BioEdit v.7.2.5 [65].

Two phylogenetic analyses were conducted, such as Maximum Likelihood (ML) and Bayesian Inference (BI). Maximum Likelihood analysis was performed via the online portal CIPRES Science Gateway v. 3.3 [69], with RAxML-HPC v.8 on XSEDE (8.2.12) tool, using default settings but following the adjustments: the GTRGAMMA nucleotide substitution model and 1000 rapid bootstrap replicates. Bayesian inference analysis was performed using MrBayes 3.2.1 [70]. Six simultaneous Markov chains were run for 3,000,000 generations, with trees sampled every 100th generation (GTR + I + G substitution model), until it was stopped when the standard deviation of split frequencies between the two simultaneous runs dropped below 0.01. The first 20% of generated trees were discarded as burn-in, and the rest (80%) were used to calculate the posterior probability. The evolutionary model of nucleotide substitution for both ML and BI analyses was selected independently for each locus using MrModeltest 2.3 [71]. Phylogenetic trees were visualized with FigTree v.1.4.0 [72]. Trees were edited using Microsoft PowerPoint (Microsoft, 2010) and Adobe Illustrator^® CS6 v.26.0 (Adobe Systems, San Jose, CA, USA). The newly generated sequences were submitted to GenBank (https://ncbi.nlm.nih.gov, accessed on 10 September 2025). The final alignment was submitted to TreeBASE, submission ID:32279 (http://www.treebase.org/, accessed on 10 September 2025).

2.4. Geographical Distribution and Host Associations

In this study, we gathered and documented the geographical distribution and host occurrence data of 165 species from the families Aigialaceae, Astrosphaeriellaceae, and Pseudoastrosphaeriellaceae. The data contained 29 species in Aigialaceae, which are included within five genera (Aigialus, Fissuroma, Neoastrosphaeriella, Posidoniomyces, and Rimora); 126 species in Astrosphaeriellaceae, which are included within 10 genera (Aquatospora, Astrosphaeriella, Astrosphaeriellopsis, Caryospora, Javaria, Mycopepon, Pithomyces, Pteridiospora, Quercicola, and Xenoastrosphaeriella); and 10 species in Pseudoastrosphaeriellaceae, which are included within three genera (Carinispora, Pseudoastrosphaeriella, and Pseudoastrosphaeriellopsis). The required data were sourced from Species Fungorum (https://www.speciesfungorum.org, accessed on 20 September 2025), MycoBank (https://www.mycobank.org/), reputable journal publications, authoritative books, the U.S. National Fungus Collections Fungus-Host Database [73], and the Catalogue of Life Checklist (https://www.catalogueoflife.org/, accessed on 20 September 2025). All the collected data were listed with appropriate references (Table 3). In total, 154 publications were reviewed to compile data for 164 species, accessed via Google Scholar and Research Gate. The nomenclatural validity of the taxa was confirmed using MycoBank (https://www.mycobank.org/, accessed on 25 September 2025). We included only taxa that were validly published, morphologically described, and assigned to one of the above families with clearly indicated host and/or locality data. Records with ambiguous identifications, unverified host information, or duplicate entries were excluded. Publications and records from 1800 to 2025 were considered. However, we noted that many species remain unverified by molecular data, and their identification and phylogenetic affinities require clarification through combined morphological and multi-gene phylogenetic analyses. Consequently, the distribution patterns may show slight variations. The online tool SankeyMATIC by Steve Bogart (www.sankeymatic.com, accessed on 27 September 2025) was used to visualize the species distribution through plant host families. The MapChart program (https://www.mapchart.net/index.html, accessed on 30 September 2025) was used to construct the distribution map.

Table 2. GenBank and culture collection accession numbers of species included in the phylogenetic study. The newly generated sequences are shown in bold. Unavailable sequences are indicated as “-”.

Taxon	Strain/Voucher Number	GenBank Accession Numbers			Reference
		LSU	SSU	tef1-α
Aigialus grandis	MFLUCC 15-1281	MN420684	MN420694	-	[74]
A. parvus	BCC 32558	GU479779	GU479743	GU479843	[75]
Astrosphaeriella bakeriana	CBS 115556	GU301801	-	GU349015	[76]
As. bambusae	MFLUCC 13-0230	KT955461	-	KT955424	[58]
As. bambusae	MBSZU 25-061	PX225037	PX225048	PX226738	this study
As. fusispora	MFLUCC 10-0555	KT955462	KT955443	KT955425	[58]
As. lophiostomopsis	HKUCC 2984	GU205215	GU205232	-	[77]
As. neofusispora	MFLUCC 11-0161	KT955463	KT955444	KT955426	[58]
As. neostellata	CX003	MN629351	MN629353	MN635787	[78]
As. neostellata	MFLUCC 11-0625	KT955464	-	-	[58]
As. stellata	MFLUCC10-0555	JN846723	JN846733	-	[79]
As. thailandica	MFLUCC 11-0191	KT955465	KT955445	KT955427	[58]
As. thysanolaenae	MFLUCC 11-0186	KT955466	KT955446	KT955428	[58]
Astrosphaeriellopsis caryotae	MFLUCC 13-0830	MF588990	MF588980	-	[59]
Carinispora nypae	BCC 36316	-	GU479749	GU479849	[75]
C. aquatica	MFLUCC 11-0008	MH057847	MH057850	-	[80]
C. aquatica	HKAS 112608	OP377899	OP377986	-	[81]
C. aquatica	MFLUCC 18-1030	MT627666	MT864295	MT954394	[60]
C. minima	taxon:492516	EU196550	EU196551	-	[82]
C. pruni	MBSZU 25-055	PX225040	PX225051	PX226741	this study
C. pruni	MBSZU 25-056	PX225041	PX225052	PX226742	this study
C. pruni	MBSZU 25-057	PX225042	PX225053	PX226743	this study
C. quercus	MFLU 18-2151	MK347979	MK347869	-	[83]
C. quercus	MFLUCC 17-2342	MN913681	MT864311	-	[60]
C. quercus	MFLUCC 17-2323	MN913683	MT864309	-	[60]
C. quercus	SZU25-042	PX225043	PX225054	-	this study
C. quercus	SZU25-043	PX225044	PX225055	-	this study
C. submersa	MFLUCC 18-1283	NG_073802	MN913720	-	[60]
C. submersa	MFLUCC 18-1409	MN913719	-	-	[60]
Delitschia chaetomioides	SMH 3253.2	GU390656	-	GU327753	[84]
D. winteri	AFTOL-ID 1599	DQ678077	DQ678026	DQ677922	[85]
Fissuroma calami	MFLUCC 13-0836	MF588993	MF588983	MF588975	[59]
F. caryotae	MFLU 17-1253	MF588996	MF588986	MF588979	[59]
F. caryotae	SNT12	MN712335	MN699322	MN744228	[86]
F. caryotae	SZU25-040	PX225038	PX225049	PX226739	this study
F. maculans	MFLUCC 10-0886	JN846724	JN846734	-	[79]
F. neoaggregatum	MFLUCC 10-0554	KT955470	KT955450	KT955432	[58]
F. palmae	MFLU 19-0820	MN712336	-	MN744229	[86]
F. taiwanense	FU30861	MG189605	MG189607	MG252072	[87]
F. taiwanense	FU30862	MG189606	MG189608	MG252073	[87]
F. thailandicum	MFLUCC 11-0189	KT955472	KT955452	KT955434	[58]
F. wallichiae	MFLUCC 15-0315	MN726235	MN726247	MN953045	[88]
Neoastrosphaeriella aquatica	MFLUCC 18-0209	MK138829	MK138789	MK132866	[89]
N. aquatica	SNT240	MN712338	-	MN744231	[86]
N. aquatica	SNT190	MN712337	MN699323	MN744230	[86]
N. aquatica	SZU25-047	PX225039	PX225050	PX226740	this study
N. krabiensis	MFLUCC 11-0025	JN846729	JN846739	-	[79]
N. krabiensis	MFLUCC 11-0022	JN846727	JN846735	-	[79]
N. phoenicis	MFLUCC 18-1477	MN712339	MN699324	MN744232	[86]
N. sribooniensis	MFLUCC 13-0834	MF588997	MF588987	MF588977	[59]
Pithomyces caryotae	MFLUCC 13-0828	MF588999	MF588989	MF588978	[59]
P. licualae	MFLUCC 17-2031	MF588995	MF588985		[59]
Pseudoastrosphaeriella africana	MFLUCC 11-0176	KT955474	KT955454	KT955436	[58]
P. aquatica	MFLUCC 18-0984	MN913742	MT864336	MT954400	[60]
P. aquatica	MFLUCC 18-0991	MN325076	-	MT954401	[89]
P. aquatica	KUMCC 19-0096	MN913746	MT627731	-	[60]
P. bambusae	MFLUCC 10-0885	MN913695	-	-	[60]
P. bambusae	KUMCC 19-0091	MN913698	-	MT954365	[60]
P. bambusae	KUMCC 19-0093	MN913699	MT864301	MT954363	[60]
P. bambusae	KUMCC 19-0095	MN913700	-	MT954364	[60]
P. bambusae	MFLUCC 11-0205	KT955475	KT955455	KT955437	[58]
P. longicolla	MFLUCC 11-0171	KT955476	-	KT955438	[58]
P. thailandensis	MFLUCC 14-0038	KT955479	KT955458	KT955441	[58]
P. thailandensis	MFLUCC 11-0144	KT955478	KT955457	KT955440	[58]
P. thailandensis	MFLUCC 10-0553	KT955477	KT955456	KT955439	[58]
P. zingiberacearum	MBSZU 25-058	PX225045	PX225056	PX226744	this study
P. zingiberacearum	MBSZU 25-059	PX225046	PX225057	PX226745	this study
P. zingiberacearum	MBSZU 25-060	PX225047	PX225058	PX226746	this study
Pseudoastrosphaeriellopsis kaveriana	PUFD33	MG947595	MG947598	MG968955	[58]
Pteridiospora bambusae	MFLU 10-0071	MG831565	MG831566	MG833012	[90]
Pt. chiangraiensis	MFLUCC 11-0162	KT955480	KT955459	KT955442	[58]
Pt. javanica	MFLUCC 11-0195	KJ742941	KT955460	KJ739606	[58]
Pt. javanica	MFLUCC 11-0159	KJ742940	KJ739607	KJ739605	[91]
Quercicola fusiformis	MFUCC 18-0479	MK348009	MK347898	MK360085	[83]
Q. guttulospora	MFUCC 18-0481	MK348010	MK347899	MK360086	[83]
Xenoastrosphaeriella aquatica	DLUCC 1525	MZ420753	MZ420755	MZ442701	[92]
X. tornata	MFLUCC 11-0196	KT955467	KT955447	KT955429	[58]
X. trochus	KUMCC 18-0194	MT659668	MT659669	MT653597	[93]

Table 2. GenBank and culture collection accession numbers of species included in the phylogenetic study. The newly generated sequences are shown in bold. Unavailable sequences are indicated as “-”.

Taxon	Strain/Voucher Number	GenBank Accession Numbers			Reference
		LSU	SSU	tef1-α
Aigialus grandis	MFLUCC 15-1281	MN420684	MN420694	-	[74]
A. parvus	BCC 32558	GU479779	GU479743	GU479843	[75]
Astrosphaeriella bakeriana	CBS 115556	GU301801	-	GU349015	[76]
As. bambusae	MFLUCC 13-0230	KT955461	-	KT955424	[58]
As. bambusae	MBSZU 25-061	PX225037	PX225048	PX226738	this study
As. fusispora	MFLUCC 10-0555	KT955462	KT955443	KT955425	[58]
As. lophiostomopsis	HKUCC 2984	GU205215	GU205232	-	[77]
As. neofusispora	MFLUCC 11-0161	KT955463	KT955444	KT955426	[58]
As. neostellata	CX003	MN629351	MN629353	MN635787	[78]
As. neostellata	MFLUCC 11-0625	KT955464	-	-	[58]
As. stellata	MFLUCC10-0555	JN846723	JN846733	-	[79]
As. thailandica	MFLUCC 11-0191	KT955465	KT955445	KT955427	[58]
As. thysanolaenae	MFLUCC 11-0186	KT955466	KT955446	KT955428	[58]
Astrosphaeriellopsis caryotae	MFLUCC 13-0830	MF588990	MF588980	-	[59]
Carinispora nypae	BCC 36316	-	GU479749	GU479849	[75]
C. aquatica	MFLUCC 11-0008	MH057847	MH057850	-	[80]
C. aquatica	HKAS 112608	OP377899	OP377986	-	[81]
C. aquatica	MFLUCC 18-1030	MT627666	MT864295	MT954394	[60]
C. minima	taxon:492516	EU196550	EU196551	-	[82]
C. pruni	MBSZU 25-055	PX225040	PX225051	PX226741	this study
C. pruni	MBSZU 25-056	PX225041	PX225052	PX226742	this study
C. pruni	MBSZU 25-057	PX225042	PX225053	PX226743	this study
C. quercus	MFLU 18-2151	MK347979	MK347869	-	[83]
C. quercus	MFLUCC 17-2342	MN913681	MT864311	-	[60]
C. quercus	MFLUCC 17-2323	MN913683	MT864309	-	[60]
C. quercus	SZU25-042	PX225043	PX225054	-	this study
C. quercus	SZU25-043	PX225044	PX225055	-	this study
C. submersa	MFLUCC 18-1283	NG_073802	MN913720	-	[60]
C. submersa	MFLUCC 18-1409	MN913719	-	-	[60]
Delitschia chaetomioides	SMH 3253.2	GU390656	-	GU327753	[84]
D. winteri	AFTOL-ID 1599	DQ678077	DQ678026	DQ677922	[85]
Fissuroma calami	MFLUCC 13-0836	MF588993	MF588983	MF588975	[59]
F. caryotae	MFLU 17-1253	MF588996	MF588986	MF588979	[59]
F. caryotae	SNT12	MN712335	MN699322	MN744228	[86]
F. caryotae	SZU25-040	PX225038	PX225049	PX226739	this study
F. maculans	MFLUCC 10-0886	JN846724	JN846734	-	[79]
F. neoaggregatum	MFLUCC 10-0554	KT955470	KT955450	KT955432	[58]
F. palmae	MFLU 19-0820	MN712336	-	MN744229	[86]
F. taiwanense	FU30861	MG189605	MG189607	MG252072	[87]
F. taiwanense	FU30862	MG189606	MG189608	MG252073	[87]
F. thailandicum	MFLUCC 11-0189	KT955472	KT955452	KT955434	[58]
F. wallichiae	MFLUCC 15-0315	MN726235	MN726247	MN953045	[88]
Neoastrosphaeriella aquatica	MFLUCC 18-0209	MK138829	MK138789	MK132866	[89]
N. aquatica	SNT240	MN712338	-	MN744231	[86]
N. aquatica	SNT190	MN712337	MN699323	MN744230	[86]
N. aquatica	SZU25-047	PX225039	PX225050	PX226740	this study
N. krabiensis	MFLUCC 11-0025	JN846729	JN846739	-	[79]
N. krabiensis	MFLUCC 11-0022	JN846727	JN846735	-	[79]
N. phoenicis	MFLUCC 18-1477	MN712339	MN699324	MN744232	[86]
N. sribooniensis	MFLUCC 13-0834	MF588997	MF588987	MF588977	[59]
Pithomyces caryotae	MFLUCC 13-0828	MF588999	MF588989	MF588978	[59]
P. licualae	MFLUCC 17-2031	MF588995	MF588985		[59]
Pseudoastrosphaeriella africana	MFLUCC 11-0176	KT955474	KT955454	KT955436	[58]
P. aquatica	MFLUCC 18-0984	MN913742	MT864336	MT954400	[60]
P. aquatica	MFLUCC 18-0991	MN325076	-	MT954401	[89]
P. aquatica	KUMCC 19-0096	MN913746	MT627731	-	[60]
P. bambusae	MFLUCC 10-0885	MN913695	-	-	[60]
P. bambusae	KUMCC 19-0091	MN913698	-	MT954365	[60]
P. bambusae	KUMCC 19-0093	MN913699	MT864301	MT954363	[60]
P. bambusae	KUMCC 19-0095	MN913700	-	MT954364	[60]
P. bambusae	MFLUCC 11-0205	KT955475	KT955455	KT955437	[58]
P. longicolla	MFLUCC 11-0171	KT955476	-	KT955438	[58]
P. thailandensis	MFLUCC 14-0038	KT955479	KT955458	KT955441	[58]
P. thailandensis	MFLUCC 11-0144	KT955478	KT955457	KT955440	[58]
P. thailandensis	MFLUCC 10-0553	KT955477	KT955456	KT955439	[58]
P. zingiberacearum	MBSZU 25-058	PX225045	PX225056	PX226744	this study
P. zingiberacearum	MBSZU 25-059	PX225046	PX225057	PX226745	this study
P. zingiberacearum	MBSZU 25-060	PX225047	PX225058	PX226746	this study
Pseudoastrosphaeriellopsis kaveriana	PUFD33	MG947595	MG947598	MG968955	[58]
Pteridiospora bambusae	MFLU 10-0071	MG831565	MG831566	MG833012	[90]
Pt. chiangraiensis	MFLUCC 11-0162	KT955480	KT955459	KT955442	[58]
Pt. javanica	MFLUCC 11-0195	KJ742941	KT955460	KJ739606	[58]
Pt. javanica	MFLUCC 11-0159	KJ742940	KJ739607	KJ739605	[91]
Quercicola fusiformis	MFUCC 18-0479	MK348009	MK347898	MK360085	[83]
Q. guttulospora	MFUCC 18-0481	MK348010	MK347899	MK360086	[83]
Xenoastrosphaeriella aquatica	DLUCC 1525	MZ420753	MZ420755	MZ442701	[92]
X. tornata	MFLUCC 11-0196	KT955467	KT955447	KT955429	[58]
X. trochus	KUMCC 18-0194	MT659668	MT659669	MT653597	[93]

3. Results

3.1. Phylogenetic Analyses

The final combined gene (LSU, SSU, and tef1-α) data contained 78 strains (3268 characters with gaps), including newly added strains (SZU25-040 to SZU25-050). Delitschia chaetomioides (SMH 3253.2) and D. winteri (AFTOL-ID 1599) were used as outgroup taxa. Maximum Likelihood (ML) and Bayesian Inference (BI) analyses yielded congruent topologies, providing robust support to the inferred evolutionary relationships (Figure 2). The Bayesian analysis has resulted in 30,000 trees after 3,000,000 generations. Bootstrap support values for ML higher than 70% and BYPP greater than 0.90 are given above each branch, respectively (Figure 2). The overall topology of phylogenetic trees was concurred with previous studies [59,60,66]. Some other phylogenetic output data are mentioned in the Supplementary File S1.

Phylogenetic results indicate that isolate (SZU25-040) clusters with Fissuroma taxa, and makes a close phylogenetic relationship with F. caryotae isolates (MFLUCC 17-1253 and SNT 12); the isolate (SZU25-047) groups with Neoastrosphaeriella aquatica isolates (SNT 190, SNT 240, and MFLUCC 18-0209) in a well-supported clade (87% ML, 1.00 BYPP). Three isolates (MBSZU 25-055, MBSZU 25-056, and MBSZU 25-057) cluster together and make a sister lineage to Caryospora submersa isolates (MFLUCC 18-1283 and MFLUCC 18-1409); another two isolates (SZU25-042 and SZU25-043) also cluster with Caryospora species, but close to C. quercus isolates (MFLUCC 17-2323, MFLUCC 17-2342, and MFLU 18-2151). The isolate, MBSZU 25-061, groups with Astrosphaeriella bambusae (MFLUCC 13-0230) with robust statistical support (83% ML, 0.99 BYPP). In addition, another three isolates (MBSZU 25-058, MBSZU 25-059, and MBSZU 25-060) make a sister lineage with Pseudoastrosphaeriella aquatica isolates (MFLUCC 18-0984, MFLUCC 18-0991, and KUMCC 19-0096) with high statistical support (80% ML, 1.00 BYPP).

3.2. Taxonomy

3.2.1. Aigialaceae Suetrong, Sakay., E.B.G. Jones, Kohlm., Volkm.-Kohlm. & C.L. Schoch, Stud. Mycol. 64: 166 (2009)

Fissuroma Jian K. Liu, Phookamsak, E.B.G. Jones & K.D. Hyde, Fungal Diversity 51(1): 145 (2011)

This genus was introduced by Liu et al. [79] and typified by Fissuroma maculans, which was previously known as Metasphaeria maculans [94]. Fissuroma currently consists of 16 species, most of which have been recorded from terrestrial habitats [58,59,66,87]. Species have diverse morphological traits, such as ascomata with slit-like ostioles, trabeculate pseudoparaphyses, and fusiform, hyaline, 1-septate ascospores [79,88]. The asexual morph has been identified as coelomycetous, pleurophomopsis-like with globose to subglobose conidiomata, phialidic conidiogenous cells, and hyaline, globose, or oblong conidia [58,79,95,96]. The host specificity of Fissuroma species has yet to be investigated since they have been reported from various host species (e.g., Arenga pinnata, Bambusa spp., Borassus flabellifer, Calamus andamanicus, Calamus conirostris, Calamus rotang, Caryota urens, Wallichia sp.) [58,59,66,73,79,87,95].

Fissuroma caryotae Wanas., E.B.G. Jones & K.D. Hyde, Mycological Progress 17(5): 579 (2018)

Index Fungorum number: IF554088; Facesoffungi number: FoF 03608; Figure 3

Saprobic on dead stem of Arenga undulatifolia (Arecaceae). Sexual morph: Ascomata 270–400 × 230–350 μm ($\overline{\mathit{x}}$ = 320 × 280 μm, n = 6), immersed or semi-immersed, appear as numerous, black or dark brown, raised, dome-shaped structures on host surface, solitary or clustered, hemispherical, flattened at the base, glabrous with rough walls, uni-loculate, carbonaceous, ostiolate. Ostioles central, with carbonaceous, slit-like opening. Peridium 15–42 μm wide ($\overline{\mathit{x}}$ = 28 μm, n = 10), carbonaceous, black, of unequal thickness, poorly developed at the base, thick at sides towards the apex, composed of several layers of brown to dark brown cells, inner layer composed of several layers of hyaline, textura angularis cells, thick-walled. Hamathecium comprising 1–2.5 μm wide ($\overline{\mathit{x}}$ = 1.9 μm, n = 10), septate, filiform, numerous, trabeculate pseudoparaphyses, embedded in a hyaline gelatinous matrix. Asci 100–170 × 12–15 μm ($\overline{\mathit{x}}$ = 130 × 13.8 μm, n = 20), 8-spored, bitunicate, fissitunicate, cylindrical to obclavate, apically rounded, short pedicellate, with an ocular chamber. Ascospores 37–48 × 6.4–9 μm ($\overline{\mathit{x}}$ = 41 × 7 μm, n = 30), overlapping, 1–2-seriate, hyaline, fusiform with acute ends, 1-septate, constricted at the septum, straight or slightly curved, asymmetrical, smooth-walled, with a thin mucilaginous sheath. Asexual morph: Undetermined.

Known hosts: Arenga undulatifolia, Calamus sp., and Caryota urens [59].

Known distribution: China and Thailand [59].

Material examined: China, Guangdong Province, Shenzhen, on dead stem of Arenga undulatifolia (Arecaceae), 15 January 2025, D.S. Tennakoon, DGSP040 (SZU25-040, new host record).

Notes: Fissuroma caryotae was introduced by Wanasinghe et al. [59] from a trunk of Caryota urens in China. The morphological characteristics of our collection (SZU25-040) strongly tally with the type of F. caryotae (MFLU 17-1253) in having immersed or semi-immersed, hemispherical, carbonaceous ascomata, trabeculate pseudoparaphyses, cylindrical to obclavate asci, and hyaline, fusiform, 1-septate ascospores with a thin mucilaginous sheath [59]. In addition, they share overlapping dimensions of asci (100–170 × 12–15 μm vs. 120–150 × 14–18 μm) and ascospores (37–48 × 6.4–9 μm vs. 40–50 × 7–9 μm). According to the phylogenetic analyses, our collection groups with F. caryotae isolates (MFLU 17-1253 and MFLUCC 16-1383) in a well-supported clade (93% ML, 0.98 BYPP). Thus, we identify our collection as a new host record of F. caryotae from Arenga undulatifolia in China.

3.2.2. Astrosphaeriellaceae Phookamsak & K.D. Hyde, Fungal Diversity 74: 161 (2015)

Astrosphaeriella Syd. & P. Syd., Annls Mycol. 11(3): 260 (1913)

Astrosphaeriella has a cosmopolitan distribution worldwide and is mostly reported from bamboos, palms, and grass species [58,60,66,95,97]. The typical morphological characteristics of Astrosphaeriella are conical to mammiform, carbonaceous ascomata, fissitunicate, cylindrical asci, and hyaline to brown, fusiform ascospores [58,93]. The asexual morph is coelomycetous and has phialidic, cylindrical to ampulliform conidiogenous cells and hyaline, globose to subglobose, aseptate conidia [58,95]. To date, 55 Astrosphaeriella species have been accepted [98].

Astrosphaeriella bambusae Phookamsak & K.D. Hyde, Fungal Diversity: 165 (2015)

Index Fungorum number: IF551633; Facesoffungi number: FoF 01223; Figure 4

Saprobic on dead stem of Metroxylon sagu (Arecaceae). Sexual morph: Ascomata 250–500 × 300–610 μm ($\overline{\mathit{x}}$ = 350 × 460 μm, n = 6), semi-immersed, erumpent through host surface, appear as numerous, black, raised, cone-like structures on host surface, solitary or clustered, mammiform to conical, flattened at the base, dark brown to black, uni-loculate, carbonaceous, with indistinct ostioles. Peridium 12–20 μm wide ($\overline{\mathit{x}}$ = 16 μm, n = 10), carbonaceous, black, of unequal thickness, poorly developed at the base, fragile, composed of several layers of brown to dark brown cells, thick-walled. Hamathecium comprising 1–2 μm wide ($\overline{\mathit{x}}$ = 1.6 μm, n = 10), septate, branched, filiform, numerous, trabeculate pseudoparaphyses, embedded in a hyaline gelatinous matrix. Asci 120–200 × 9–13 μm ($\overline{\mathit{x}}$ = 152 × 10 μm, n = 20), 8-spored, bitunicate, fissitunicate, cylindrical, short pedicellate, apically rounded, with an ocular chamber. Ascospores 32–40 × 5–6.4 μm ($\overline{\mathit{x}}$ = 35 × 5 μm, n = 30), overlapping, 1–2-seriate, hyaline when immature, pale brown at maturity, fusiform with acute ends, 1-septate, constricted at the septum, smooth-walled, without a mucilaginous sheath. Asexual morph: Undetermined.

Culture characteristics: Ascospores germinate on PDA within 8 h at 24 °C. Colonies on PDA reaching 10 mm diameter after 15 days at 24 °C. Colonies dense, circular, raised, surface with hyphae growing, rough-surface, fairly fluffy, with entire edge, margin well-defined. Colony from above: dark gray to dark brown at the center, and the margin; colony from below: dark brown to black at the center, and the margin.

Known hosts: Bamboo sp. and Metroxylon sagu [58,66]

Known distribution: China and Thailand [58,66]

Material examined: China, Guangdong Province, Shenzhen, on dead stem of Metroxylon sagu (Arecaceae), 12 January 2025, D.S. Tennakoon, DVIP004 (SZU25-041, new host record), living culture (MBSZU 25-061)

Notes: Due to morphological characteristics (e.g., semi-immersed to erumpent, mammiform to conical ascomata, trabeculate pseudoparaphyses, cylindrical, short pedicellate, apically rounded asci, and hyaline, 1-septate, fusiform ascospores) largely overlapping with Astrosphaeriella bambusae (MFLUCC 13-0230), we report our collection (MBSZU 25-061) as a new host record of A. bambusae from the dead stem of Metroxylon sagu in China. In particular, our collection shares overlapping dimensions of ascomata (250–500 × 300–610 μm vs. 360–600 × 380–660 μm), asci (120–200 × 9–13 μm vs. 130–180 × 10–12 μm), and ascospores (32–40 × 5–6.4 μm vs. 34–39 × 5–6 μm) with the type of Astrosphaeriella bambusae (MFLUCC 13-0230). Multi-gene phylogeny also indicates that our collection groups with A. bambusae (MFLUCC 13-0230) with a robust statistical support (83% ML, 0.99 BYPP). However, our collection differs from the Astrosphaeriella bambusae (MFLUCC 13-0230) by lacking a mucilaginous sheath. This is the first Astrosphaeriella bambusae species occurrence on Metroxylon sagu (Arecaceae).

Caryospora De Not., Mém. R. Accad. Sci. Torino, Ser. 2 16: 463 (1857)

Caryospora was established by De Notaris [99] with C. putaminum as the type species. The taxonomic placement of Caryospora has been controversial for a long time. Initially, this was placed in Phaeophragmiae, based on the terminal septa and subsequently transferred to Zopfiaceae [100,101,102]. Ariyawansa et al. [80] transferred this genus to a new fungal family, Caryosporaceae, based on in-depth morphology and phylogeny evidence. However, this genus has been placed in Astrosphaeriellaceae in recent studies [8,60,83,103]. Caryospora species have been recorded from both terrestrial and freshwater habitats and characterized by obclavate asci with ellipsoidal to biconic ascospores [60,104]. To date, 12 Caryospora species have been accepted [98].

Caryospora aquatica H. Zhang, K.D. Hyde & Ariyawansa, Fungal Diversity 75: 54 (2015), comb. nov.

Index Fungorum number: IF551418; Facesoffungi number: FoF 00958

Basionym: Caryospora minima Jeffers, Mycologia 32(4): 561 (1940)

Holotype: Berlin, Maryland, USA, putrescent putamina of Amygdalus persica, August 1938, BPI 71132.

Description: see Jeffers (1940)

Caryospora minima was introduced by Jeffers (1940) from MD, USA. Subsequently, Cai and Hyde [82] provided LSU and SSU sequence data (EU196550 and EU196551) for this species without any strain number/code, morphological description, herbarium details, or illustrations. In our multigene phylogenetic study, Caryospora minima strain (taxon:492516) was clustered with C. aquatica isolates (MFLUCC 11-0008, MFLUCC 18-1030, and HKAS 112608) in a well-supported clade (81% ML, 0.95 BYPP). The morphological characteristics of the type of Caryospora minima (BPI 71132) tally well with the type of C. aquatica (MFLUCC 11-0008) with overlapping characteristics and dimensions, such as hemispherical or conical ascomata (450–750 μm vs. 400–700 μm diam.), cylindrical clavate asci (160–190 × 60–80 μm vs. 150–180 × 35–50 μm), and 1-septete ascospores (44–52 × 20–27 μm vs. 40–50 × 20–30 μm) [80,100]. Thus, based on strong phylogenetic and morphological characteristics similarities, we treat Caryospora minima as a synonym of C. aquatica in this study.

Caryospora pruni Tennakoon & S. Hongsanan, sp. nov.

Index Fungorum number: IF904313; Facesoffungi number: FoF 18109; Figure 5

Etymology: The specific epithet “pruni” was given after the host genus.

Holotype: SZU25-044

Saprobic on decaying fruit pericarp of Prunus persica (Rosaceae). Sexual morph: Ascomata 350–650 × 400–500 μm ($\overline{\mathit{x}}$ = 490 × 350 μm, n = 6), superficial, appear as numerous, black, raised, cone-like structures on host surface, solitary or clustered, conical, flattened at the base, dark brown to black, uni-loculate, carbonaceous, ostiolate. Ostiole central, apapillate, carbonaceous, not prominent. Peridium 18–40 μm wide ($\overline{\mathit{x}}$ = 26 μm, n = 10), carbonaceous, black, poorly developed at the base, fragile, composed of several layers of brown to dark brown cells, thick-walled. Hamathecium comprising 1–2 μm wide ($\overline{\mathit{x}}$ = 1.5 μm, n = 10), septate, branched, filiform, numerous, trabeculate pseudoparaphyses. Asci 95–120 × 33–50 μm ($\overline{\mathit{x}}$ = 108 × 41 μm, n = 20), 8-spored, bitunicate, fissitunicate, cylindric-clavate, short pedicellate, apically rounded with an ocular chamber. Ascospores 45–56 × 20–30 μm ($\overline{\mathit{x}}$ = 51 × 26 μm, n = 30), overlapping, 1–2-seriate, hyaline when immature, pale brown to dark brown at maturity, ellipsoidal, diamond-shaped, apex pointed, 1-septate, distinctly constricted at the septum, mostly with a dark band around the septum, walls thickened at both ends, symmetrical or asymmetrical, straight or slightly curved, guttulate, present polar germ pores, surrounded by a gelatinous mucilaginous sheath when immature (5–8 μm wide). Asexual morph: Undetermined.

Culture characteristics: Ascospores germinated on PDA within 8 h at 24 °C. Colonies on PDA reached 21 mm in diameter after 12 days at 24 °C. Colonies dense, circular, raised, surface with hyphae growing, smooth-surface, fairly fluffy, with entire edge, margin well-defined. Colony from above: dark gray to dark brown at the center, gray at the margin; colony from below: dark brown to black at the center, pale brown at the margin.

Material examined: China, Guangdong Province, Shenzhen, on decaying fruit pericarp of Prunus persica (Rosaceae), 17 January 2025, D.S. Tennakoon, SZ3 (SZU25-044, holotype), ex-type living culture (MBSZU 25-055); ibid. 18 January 2025, DPSZ3B, DPSZ3 (SZU25-045, SZU25-046, isotypes), living cultures (MBSZU 25-056, MBSZU 25-057).

Notes: The morphological characteristics of our collection resemble generic concept of Caryospora in having conical, uni-loculate, carbonaceous ascomata, cylindric-clavate, short pedicellate asci, and ellipsoidal, diamond-shaped ascospores [60,80,83,104]. Multi-gene phylogeny revealed that our isolates (MBSZU 25-055, MBSZU 25-056, and MBSZU 25-057) form an independent lineage sister to Caryospora submersa isolates (MFLUCC 18-1283 and MFLUCC 18-1409) with 96% ML and 1.00 BYPP support. However, our collection can be distinguished from C. submersa, which has broadly cylindrical to clavate asci and pale brown to dark brown, diamond-shaped ascospores with polar germ pores, whereas C. submersa has obclavate asci and narrowly fusiform, hyaline, thin-walled ascospores [60]. Thus, we introduce our collection as a new species, Caryospora pruni from Prunus persica in China.

Caryospora quercus Jayasiri, E.B.G. Jones & K.D. Hyde, Mycosphere 10(1): 34 (2019)

Index Fungorum number: IF555535; Facesoffungi number: FoF 05236; Figure 6

Saprobic on dead stem of Citrus maxima (Rutaceae). Sexual morph: Ascomata 250–400 × 300–520 μm ($\overline{\mathit{x}}$ = 290 × 450 μm, n = 6), semi-immersed, erumpent, appear as black dots, solitary or clustered, conical, flattened at the base, dark brown to black, uni-loculate, carbonaceous, ostiolate. Ostiole central and filled with periphyses. Peridium 10–15 μm wide ($\overline{\mathit{x}}$ = 13 μm, n = 10), carbonaceous, black, poorly developed at the base, fragile, two-layered, outer layer strongly carbonized, composed of several layers of brown to dark brown cells, inner layer composed of several layers of hyaline cells, thick-walled. Hamathecium comprising 1–2 μm wide ($\overline{\mathit{x}}$ = 1.5 μm, n = 10), septate, branched, filiform, numerous, trabeculate pseudoparaphyses. Asci 90–200 × 25–38 μm ($\overline{\mathit{x}}$ = 145 × 32 μm, n = 20), 8-spored, bitunicate, fissitunicate, cylindric-clavate, short pedicellate, apically rounded with an ocular chamber. Ascospores 40–50 × 16–30 μm ($\overline{\mathit{x}}$ = 46 × 22 μm, n = 30), overlapping, 1–2-seriate, hyaline when immature, pale brown to dark brown at maturity, ellipsoidal, diamond-shaped, apex pointed, 1-septate, distinctly constricted at the septum, mostly with a dark band around the septum, walls thickened at both ends, symmetrical or asymmetrical, guttulate, present polar germ pores, surrounded by a gelatinous mucilaginous sheath (5–8 μm wide). Asexual morph: Undetermined.

Known hosts: Citrus maxima and Quercus sp. (Jayasiri et al., 2019 [83]; Dong et al., 2020 [60]; this study)

Known distribution: China and Thailand (Jayasiri et al., 2019 [83]; Dong et al., 2020 [60]; this study)

Material examined: China, Guangdong Province, Shenzhen, on dead stem of Citus maxima (Rutaceae), 12 January 2025, D.S. Tennakoon, WD002 (SZU25-042, new host record), ibid. 15 January 2025, DST5 (SZU25-043).

Notes: According to the multi-gene phylogeny (LSU, SSU, and tef1-α), our collection (SZU25-042 and SZU25-043) clustered with Caryospora quercus isolates (MFLUCC 17-2323, MFLUCC 17-2342, and MFLU 18–2151) in a well-supported clade (75% ML, 1.00 BYPP). Morphological characteristics also indicate that our collection resembles C. quercus in having conical, dark brown to black, uni-loculate, carbonaceous ascomata, cylindric-clavate, short pedicellate asci, and ellipsoidal, diamond-shaped, 1-septate ascospores with gelatinous mucilaginous sheath [60,83,93]. In addition, our collection has overlapping dimensions of ascomata (250–400 × 300–520 μm vs. 300–420 × 450–483 μm), asci (90–200 × 25–38 μm vs. 110 –147 × 30–35 μm), and ascospores (40–50 × 16–30 μm vs. 41–54 × 18–28 μm) as well [83]. Based on the robust morphology and phylogeny support, we identify our collection as C. quercus. Caryospora quercus was initially introduced by Jayasiri et al. [83] from decaying fruit pericarp of Quercus sp. (Fagaceae) in Thailand. Thus, we introduce our collection as a new host record of C. quercus from Citrus maxima in China.

Neoastrosphaeriella Jian K. Liu, E.B.G. Jones & K.D. Hyde, Fungal Diversity 51(1): 148 (2011)

Liu et al. [79] introduced Neoastrosphaeriella to accommodate N. krabiensis as the type species, which was collected from a dead petiole of Metroxylon sagu. The species of Neoastrosphaeriella have been recorded from both terrestrial and freshwater habitats [59,79,86,89,105]. In particular, most have been reported from Thailand (N. aquatica, N. krabiensis, N. phoenicis, and N. sribooniensis). Neoastrosphaeriella species are characterized by immersed to semi-immersed ascomata with slit-like ostioles, fissitunicate, obclavate asci, and brown, verrucose ascospores [79]. To date, there are five Neoastrosphaeriella species, such as N. alankrithabeejae, N. aquatica, N. krabiensis, N. phoenicis, and N. sribooniensis [98].

Neoastrosphaeriella aquatica D.F. Bao, Z.L. Luo, K.D. Hyde & Hong Y. Su, Phytotaxa 391(3): 201 (2019)

Index Fungorum number: IF555357; Facesoffungi number: FoF 04910; Figure 7

Saprobic on dead stem of Phoenix paludosa (Arecaceae). Sexual morph: Ascomata 210–520 × 200–350 μm ($\overline{\mathit{x}}$ = 341 × 230 μm, n = 6), semi-immersed, appear as numerous, black or dark brown, raised, dome-shaped structures on host surface, solitary or clustered, hemispherical with wedged sides, flattened at the base, glabrous with rough walls, uni-loculate, carbonaceous, ostiolate. Ostioles central, with carbonaceous, slit-like opening. Peridium 16–28 μm wide ($\overline{\mathit{x}}$ = 23 μm, n = 10), carbonaceous, black, of unequal thickness, poorly developed at the base, thick at sides towards the apex, composed of several layers of brown to dark brown cells, inner layer composed of several layers of hyaline, textura angularis cells, thick-walled. Hamathecium comprising 1–2 μm wide ($\overline{\mathit{x}}$ = 1.6 μm, n = 10), septate, filiform, numerous, cellular pseudoparaphyses, embedded in a hyaline gelatinous matrix. Asci 80–100 × 12–16 μm ($\overline{\mathit{x}}$ = 92 × 14 μm, n = 20), 8-spored, bitunicate, fissitunicate, cylindrical to obclavate, apically rounded, with a short furcate pedicel, with an ocular chamber. Ascospores 30–40 × 5–7 μm ($\overline{\mathit{x}}$ = 33 × 6 μm, n = 30), overlapping, 1–2-seriate, hyaline, fusiform with acute ends, 1-septate, constricted at the septum, straight or slightly curved, asymmetrical, smooth-walled, guttulate, with a distinct mucilaginous sheath. Asexual morph: Undetermined.

Known hosts: decaying submerged wood of unknown host, and Phoenix paludosa [89].

Known distribution: China and Thailand [89]

Material examined: China, Guangdong Province, Shenzhen, on dead stem of Phoenix paludosa (Arecaceae), 20 January 2025, D.S. Tennakoon, DPC044 (SZU25-047, new host record).

Notes: In this study, our phylogenetic analyses indicate that our collection (SZU25-047) groups with Neoastrosphaeriella aquatica isolates (MFLUCC 18–0209, MFLUCC 18-1531, HKAS 105481) in a well-supported clade (87% ML, 1.00 BYPP). The morphological characteristics also tally well with the type of N. aquatica in having semi-immersed, solitary or clustered, hemispherical ascomata with slit-like ostioles, cylindrical to obclavate asci, and hyaline, fusiform, 1-septate ascospores [89]. Their overlapping dimensions of ascomata (210–520 × 200–350 μm vs. 250–400 × 160–250 μm), asci (80–100 × 12–16 μm vs. 84–112 × 14–19 μm), and ascospores (30–40 × 5–7 μm vs. 31–37 × 5–8 μm) also indicate that they are the same species. Therefore, based on both morphology and phylogeny support, we report our collection as a new host record of N. aquatica from China.

3.2.3. Pseudoastrosphaeriellaceae Phookamsak & K.D. Hyde, Fungal Diversity: 181 (2015)

Pseudoastrosphaeriella Phookamsak, Z.L. Luo & K.D. Hyde, Fungal Diversity: 182 (2015)

Phookamsak et al. [58] introduced Pseudoastrosphaeriella to accommodate astrosphaeriella-like species in Pseudoastrosphaeriellaceae. Pseudoastrosphaeriella was typified by P. thailandensis, which was collected from a dead stem of bamboo in Thailand. The morphology of Pseudoastrosphaeriella species differs from Astrosphaeriella by ascomata characteristics, such as immersed, hemispherical or dome-shaped with short to long necks, whereas Astrosphaeriella has erumpent, raised, conical ascomata and has a star-like or rounded flange with small papilla [58]. Currently, seven Pseudoastrosphaeriella species have been accepted, such as P. aequatoriensis, P. africana, P. aquatica, P. bambusae, P. longicolla, P. papillate, and P. thailandensis [98].

Pseudoastrosphaeriella zingiberacearum Tennakoon & S. Hongsanan, sp. nov.

Index Fungorum number: IF904314; Facesoffungi number: FoF 18110; Figure 8

Etymology. The specific epithet zingiberacearum was given after the host family, Zingiberaceae.

Holotype: SZU25-048

Saprobic on dead stem of Hedychium coronarium (Zingiberaceae). Sexual morph: Ascomata 400–600 × 800–1300 μm ($\overline{\mathit{x}}$ = 520 × 980 μm, n = 6) (excluding neck), immersed in host epidermis, erumpent through host surface, appear as numerous, black or dark brown, raised, dome-shaped structures on host surface, solitary or clustered, uni-loculate, carbonaceous, depressed conical or lageniform, flattened at the base, ostiolate. Necks 100–200 × 5–10 μm ($\overline{\mathit{x}}$ = 125 × 8 μm, n = 4), dark brown or black, central, cylindrical, oblique, fragile, carbonaceous. Peridium 14–38 μm wide ($\overline{\mathit{x}}$ = 26 μm, n = 10), carbonaceous, black, of unequal thickness, poorly developed at the base, thick at sides towards the apex, composed of several layers of brown to dark brown cells, comprising host cells plus fungal tissue at outside, inner layer composed of several layers of pale brown or hyaline, textura angularis cells, thick-walled. Hamathecium comprising 1–2.6 μm wide ($\overline{\mathit{x}}$ = 1.8 μm, n = 10), septate, filiform, numerous, trabeculate pseudoparaphyses, anastomosing at the apex, embedded in a hyaline gelatinous matrix. Asci 150–172 × 11–14 μm ($\overline{\mathit{x}}$ = 160 × 12 μm, n = 20), 8-spored, bitunicate, fissitunicate, cylindrical to clavate, apically rounded, with a short furcate pedicel, with an ocular chamber. Ascospores 46–57 × 5–7 μm ($\overline{\mathit{x}}$ = 52 × 6 μm, n = 30), overlapping, 1–2-seriate, initially hyaline, pale brown to brown when mature, broadly fusiform with acute or rounded ends, 1–6-septate, constricted at the middle septum, straight or slightly curved, asymmetrical, slightly swollen above middle septum, rough-walled with minute striations, guttulate. Asexual morph: Undetermined.

Material examined: China, Jiangxi Province, Nanchang, on dead stem of Hedychium coronarium (Zingiberaceae), 20 January 2024, D.S. Tennakoon, DDP007 (SZU25-048, holotype), ex-type living culture (MBSZU 25-058); ibid. 29 January 2025, DP007-ITB, DP007-ITC (SZU25-049, SZU25-050, isotypes), living cultures (MBSZU 25-059, MBSZU 25-060).

Notes: In our phylogenetic analysis, our collection (MBSZU 25-058, MBSZU 25-059, and MBSZU 25-060) nested with Pseudoastrosphaeriella isolates and formed a sister lineage with P. aquatica with 80% ML and 1.00 BYPP statistical support (Figure 2). The morphological characteristics of our collection resemble Pseudoastrosphaeriella in having hemispherical ascomata, cylindrical to clavate, apically rounded asci, and reddish brown ascospores, with minute striations [58,60]. Our collection can be distinguished from P. aquatica in having larger ascomata (400–600 × 800–1300 μm vs. 250–350 × 280–320 μm), short neck (100–200 × 5–10 μm vs. 450–500 × 100–110 μm), narrow asci (150–172 × 11–14 μm vs. 145–260 × 19–25 μm), and broadly fusiform, 1–6-septate ascospores with striations (46–57 × 5–7 μm vs. 40–48 × 8–10.5 μm), whereas P. aquatica has 3-septate ascospores with prominent guttules and lacking striations [60]. In addition, we compared our collection (MBSZU 25-058) with P. aquatica (MFLUCC 18-0984) based on base pair differences, and there are 39 base pair differences (4.67%) across 834 nucleotides in the tef1-α gene region. Thus, due to these phylogenetic and morphological distinctions, we have introduced our collection as a novel species, Pseudoastrosphaeriella zingiberacearum, collected from Hedychium coronarium in China.

3.3. Geographical Distribution and Their Host Occurrences of Aigialaceae, Astrosphaeriellaceae, and Pseudoastrosphaeriellaceae Species

This study documents 164 species across Aigialaceae, Astrosphaeriellaceae, and Pseudoastrosphaeriellaceae, representing 18 genera, along with their host associations and geographical distributions (Table 3). Based on the data collected, it appears that the members of Aigialaceae, Astrosphaeriellaceae, and Pseudoastrosphaeriellaceae have mostly been collected from China (46 records) and Thailand (41 records). This could be attributed to the well-documented fungal collections, coupled with the presence of specialized research institutions and proper identification techniques (e.g., morphology coupled with multi-gene phylogenetic analyses, fungal evolution analyses, Genealogical Concordance Phylogenetic Species Recognition (GCPSR) analysis to distinguish the cryptic species) in these countries. Apart from these main countries, significant records exist from India (22 records), the United States (12 records), Brunei (11 records), Australia (9 records), Indonesia and Japan (8 records), Ecuador (7 records), Papua New Guinea (6 records), Cuba and Philippines (5 records), while other have less than five species records from 28 countries (e.g., Brazil, France, Italy, Malaysia, Nicaragua, Pakistan, Peru, Poland, South Africa, Sri Lanka, Sweden, Tanzania, Venezuela, Vietnam, etc.) (Figure 9).

A key finding reveals that Arecaceae (58 records) and Poaceae (48 records) represent the predominant host families for these fungal taxa (Figure 10). This raises an exciting ecological question: Are these species host-specific to either the Arecaceae or Poaceae families? (Figure 10 and Figure 11). In addition, these species produce carbonaceous fruiting bodies, raising questions about potential relationships between their nutritional or evolutionary adaptations and their Arecaceae/Poaceae hosts. In particular, these interactions are critical for understanding biodiversity, ecosystem functioning, and the evolutionary adaptations of these fungi to their environments. However, this could be answered with a comprehensive study with multiple taxon samplings. The geographical distribution and host occurrences of each family are discussed in the following section.

3.3.1. Aigialaceae

In total, 29 Aigialaceae species in five genera (Aigialus, Fissuroma, Neoastrosphaeriella, Posidoniomyces, and Rimora) are listed with their geographical distributions and host occurrences (Table 3). According to the collected data, Aigialaceae species have been reported from subtropical, tropical, and temperate countries worldwide (e.g., Australia, Brunei, China, Croatia, Ecuador, India, Japan, Thailand, Papua New Guinea, the Philippines, and the United States). Of them, the highest number of species records has been reported from Thailand (12 records), and this is followed by India (7 records), China (5 records), and the United States (3 records), while other countries have single records (Table 3). It is worth noting that the majority of Aigialaceae species have been recorded from Asia. Some species exhibit extensive distribution throughout multiple countries; for instance, Fissuroma fissuristomum has been reported in Australia, Brunei, China, Ecuador, and Papua New Guinea [73,106,107]. The lower number of species recorded may indicate that fewer taxonomic investigations have been conducted in those countries.

When considering the host occurrences of Aigialaceae species, most of the species have been recorded from Arecaceae host species (12 records), such as Arenga pinnata, Borassus flabellifer, Calamus andamanicus, C. conirostris, C. rotang, Caryota urens, Metroxylon sagu, and Phoenix paludosa (Table 3). In addition, some others have been reported from Poaceae hosts (7 records; Bambusa spp. and Phyllostachys reticulata) and Rhizophoraceae host species (6 records; Rhizophora apiculata, R. mangle, and R. mucronata). In particular, the occurrence of Rhizophoraceae host species is interesting since they have been collected from submerged root parts (e.g., Aigialus grandis, A. mangrovis, A. parvus, A. rhizophorae, and A. striatisporus). Other species’ host occurrence has been limited to single host families, such as Lythraceae, Posidoniaceae, Theaceae, Verbenaceae, and Zingiberaceae (Table 3).

3.3.2. Astrosphaeriellaceae

In total, 126 Astrosphaeriellaceae species in 10 genera (Aquatospora, Astrosphaeriella, Astrosphaeriellopsis, Caryospora, Javaria, Mycopepon, Pithomyces, Pteridiospora, Quercicola, and Xenoastrosphaeriella) are listed with their geographical distributions and host occurrences (Table 3). Our summarized data suggests that Astrosphaeriellaceae species exhibit a cosmopolitan distribution, given their presence on numerous continents (e.g., Asia, Africa, Australia, Europe, North America, and South America). Of them, the majority of species records have been reported from Asian countries, such as Brunei, China, India, Indonesia, Japan, the Philippines, and Thailand (Table 3). The highest number of species have been collected from China (42 records), and this is followed by Thailand (24 records), India (14 records), the United States (9 records), Indonesia (8 records), Australia and Japan (7 records), Brunei (6 records), Cuba, Ecuador and Papua New Guinea (5 records), Nicaragua, Philippines, Poland, Sierra Leone, Tanzania, and South Africa (3 records) and other have less than two species records (e.g., Austria, Brazil, Costa Rica, France, Ghana, Italy, Malaysia, Mexico, Myanmar, New Zealand, Pakistan, Peru, Seychelles, Singapore, Sri Lanka, Sweden, the United Kingdom, and Vietnam). Some species, like Astrosphaeriella stellata, are widely distributed (e.g., Australia, China, India, Japan, Papua New Guinea, the Philippines, and Vietnam). In addition, Astrosphaeriella vesuvius has been reported from eight countries, including Australia, Brunei, Indonesia, Thailand, Malaysia, Papua New Guinea, and Sri Lanka. The substantial number of species records from China, India, and Thailand may result from extensive taxonomic sampling and in-depth studies conducted in these countries over the last two decades [58,59,60,83,90,105,108,109,110].

The host associations of Astrosphaeriellaceae species are particularly noteworthy, with documented occurrences across 37 different plant families (Table 3). Of them, highest numbers of species records have been reported from Arecaceae (41 records) and followed by Poaceae (36 records), Fagaceae (13 records), Lythraceae (4 records), Apocynaceae, Moraceae, Myrtaceae, and Rosaceae (3 records), Anacardiaceae, Lauraceae, Musaceae, Oleaceae, Proteaceae (2 records), and others have single occurrences (e.g., Acoraceae, Altingiaceae, Annonaceae, Bromeliaceae, Cannaceae, Juglandaceae, Juncaceae, Liliaceae, Malvaceae, Sapindaceae) (Table 3). The most frequently recorded Arecaceae hosts include Archontophoenix alexandrae, Arenga undulatifolia, Calamus spp., Cocos nucifera, Daemonorops margaritae, Eleiodoxa conferta, Licuala longicalycata, Livistona spp., Nothofagus spp., Oncosperma spp., and Sabal palmetto (Table 3). The most commonly reported Poaceae hosts are Bambusa spp., Miscanthus spp., Melocalamus compactiflorus, Phyllostachys spp., and Saccharum officinarum [73]. Several species, including Pithomyces cupaniae, exhibit broad host ranges in multiple plant families such as Anacardiaceae, Anisophylleaceae, Apocynaceae, Fabaceae, Lauraceae, Oleaceae, and Sapindaceae [73,111,112]. Furthermore, both Pithomyces graminicola (associated with Anacardiaceae, Cannaceae, Fabaceae, Lauraceae, Poaceae, and Strelitziaceae) and P. obscuriseptatus (associated with Acoraceae, Arecaceae, Butomaceae, Cyperaceae, Juncaceae, and Typhaceae) exhibit extensive host ranges [73,110,113,114,115,116]. Another interesting fact is that some Astrosphaeriellaceae species have been collected from soil as well. Beyond their plant associations, some Astrosphaeriellaceae species (e.g., P. longiclavisporus and P. pallidus) have been collected from soil habitats in China [117].

3.3.3. Pseudoastrosphaeriellaceae

In total, 10 Pseudoastrosphaeriellaceae species in three genera (Carinispora, Pseudoastrosphaeriella, and Pseudoastrosphaeriellopsis) are listed with their geographical distributions and host occurrences (Table 3). Current records indicate Pseudoastrosphaeriellaceae species have been mostly collected from Thailand (5 records) and Brunei (4 records), with single occurrences reported from Australia, Ecuador, India, Malaysia, Philippines, and Tanzania [58,73,118,119]. Reported species have been mainly associated with Arecaceae hosts (Arenga undulatifolia, Avicennia marina, Calamus spp., Daemonorops spp., Licuala longicalycata, Nypa fruticans, Oncosperma tigillarium, and Phytelephas spp.) and Poaceae hosts (Bambusa spp. and Phragmites australis) (Table 3).

Table 3. Host association and geographical distribution of reported Aigialaceae, Astrosphaeriellaceae, and Pseudoastrosphaeriellaceae species.

Species	Host	Family	Locality	References
Aigialus grandis	Rhizophora mangle, Rhizophora mucronata, Sonneratia acida	Lythraceae, Rhizophoraceae	The United States, India	[120,121,122]
Aigialus mangrovis	Rhizophora mucronata	Rhizophoraceae	India	[121,123]
Aigialus parvus	Avicennia alba, Rhizophora mangle, Sonneratia acida	Lythraceae, Rhizophoraceae	The United States	[121,122]
Aigialus rhizophorae	Rhizophora mucronata	Rhizophoraceae	India	[121,123]
Aigialus striatisporus	Rhizophora apiculata	Rhizophoraceae	Thailand	[73]
Fissuroma aggregatum	Phyllostachys reticulata	Poaceae	Japan	[95,124,125,126,127]
Fissuroma arengae	Arenga pinnata	Arecaceae	Thailand	[88]
Fissuroma bambusae	Bambusa spp.	Poaceae	Thailand	[58]
Fissuroma bambusicola	Bambusa spp.	Poaceae	China	[128]
Fissuroma calami	Calamus rotang	Arecaceae	Thailand	[59]
Fissuroma caryotae	Arenga undulatifolia Caryota urens	Arecaceae	China	[59], this study
Fissuroma chinense	Bambusa spp.	Poaceae	China	[66]
Fissuroma fissuristomum	Bambusa spp. Calamus conirostris, Licuala sp., Mauritia flexuosa	Arecaceae, Poaceae	Australia, Brunei, China, Ecuador, Papua New Guinea	[73,107,129]
Fissuroma kavachabeejae	Calamus andamanicus	Arecaceae	India	[105]
Fissuroma maculans	Arenga spp.	Arecaceae	Philippines	[79,130]
Fissuroma microsporum	Borassus flabellifer	Arecaceae	India	[105]
Fissuroma neoaggregatum	Bambusa spp.	Poaceae	Thailand	[58]
Fissuroma palmae	Arenga pinnata	Arecaceae	Thailand	[86]
Fissuroma taiwanense	Hedychium coronarium	Zingiberaceae	China	[87])
Fissuroma thailandicum	Bambusa spp.	Poaceae	Thailand	[58]
Fissuroma wallichiae	Wallichia sp.	Theaceae	Thailand	[88]
Neoastrosphaeriella alankrithabeejae	Calamus andamanicus	Arecaceae	India	[105]
Neoastrosphaeriella aquatica	Phoenix paludosa	Arecaceae	China, Thailand	[89], this study
Neoastrosphaeriella krabiensis	Metroxylon sagu	Arecaceae	Thailand	[79]
Neoastrosphaeriella phoenicis	Phoenix paludosa	Arecaceae	Thailand	[86]
Neoastrosphaeriella sribooniensis	Calamus rotang	Arecaceae	Thailand	[59]
Posidoniomyces atricolor	Posidonia oceanica	Posidoniaceae	Croatia	[131]
Rimora mangrovei	Avicennia officinalis, Rhizophora mangle	Rhizophoraceae, Verbenaceae	The United States, India	[73,121,122]
Aquatospora cylindrica	Unknown host	-	Thailand	[60]
Astrosphaeriella angustispora	Eleiodoxa conferta, Licuala spp.	Arecaceae	Brunei	[119,132,133]
Astrosphaeriella aosimensis	Livistona subglobosa	Arecaceae	Japan	[134,135]
Astrosphaeriella applanata	Alnus sp., Carpinus sp., Quercus spp.	-	Poland, Sweden, the United Kingdom,	[73,109,136]
Astrosphaeriella aquatica	Licuala longicalycata, Livistona spp.	Arecaceae	Ecuador, Papua New Guinea, Thailand	[73,119,133,137]
Astrosphaeriella asiana	Aegiceras corniculatum, Sonneratia alba	Lythraceae, Primulaceae	Thailand	[119,138]
Astrosphaeriella australiensis	Calamus spp.	Arecaceae	Australia	[119]
Astrosphaeriella bambusae	Bambusa spp., Metroxylon sagu	Arecaceae, Poaceae	China, Thailand	[58], this study
Astrosphaeriella bambusella	Bambusa spp.	Poaceae	Indonesia	[126,139]
Astrosphaeriella callicarpa	Unknown host	-	Indonesia	[140]
Astrosphaeriella daemonoropis	Daemonorops margaritae	Arecaceae	China	[115,129]
Astrosphaeriella erumpens	Unknown host	Arecaceae	Cuba	[141]
Astrosphaeriella exorrhiza	Iriartea sp.	Arecaceae	Venezuela	[119,142]
Astrosphaeriella floridana	Sabal palmetto	Arecaceae	The United States, Thailand	[133,143]
Astrosphaeriella frondicola	Calamus spp., Daemonorops spp., Laccospadix australasica, Oraniopsis appendiculata	Arecaceae	Australia, Brunei, China	[73,115,119,144]
Astrosphaeriella fuscomaculans	Phyllostachys nigra	Poaceae	Japan	[73,125,126]
Astrosphaeriella fusispora	Bambusa spinosa, Phyllostachys bambusoides, Pleioblastus pubescens	Poaceae	Japan, Philippines	[73,125,126,130,145]
Astrosphaeriella gaofengensis	Bambusa spp.	Poaceae	China	[66]
Astrosphaeriella immersa	Archontophoenix alexandrae	Arecaceae	China	[115,129]
Astrosphaeriella lageniformis	Cocos nucifera	Arecaceae	China	[73,146]
Astrosphaeriella lenticularis	Geonoma sp.	Arecaceae	Brunei, Ecuador	[73,119]
Astrosphaeriella linguiformis	Bambusa spp.	Poaceae	China	[147]
Astrosphaeriella livistonicola	Livistona chinensis	Arecaceae	China, Thailand	[73,115,129,133]
Astrosphaeriella longispora	Unknown host	-	Costa Rica	[148]
Astrosphaeriella lophiostomopsis	Arenga undulatifolia	Arecaceae	Brunei, Thailand	[119,133]
Astrosphaeriella macrospora	Miscanthus spp.	Poaceae	China	[149]
Astrosphaeriella malayensis	Daemonorops sp., Licuala longicalycata	Arecaceae	Malaysia, Papua New Guinea, Thailand	[119,129,133]
Astrosphaeriella maquilingiana	Calamus spp., Iriartea sp.	Arecaceae	Australia, Ecuador, Philippines	[73,119]
Astrosphaeriella mauritiae	Mauritia flexuosa	Arecaceae	Ecuador	[119]
Astrosphaeriella minima	Bambusa spp.	Poaceae	China, Indonesia	[140,150]
Astrosphaeriella minoensis	Licuala ramsayi, Phyllostachys reticulata, Sasa kurilensis	Arecaceae, Poaceae	Australia, Japan	[119,142,150]
Astrosphaeriella neofusispora	Bambusa spp.	Poaceae	Thailand	[58]
Astrosphaeriella neostellata	Bambusa spp.	Poaceae	Thailand	[58]
Astrosphaeriella nipicola	Nipa sp.	Arecaceae	Indonesia	[119]
Astrosphaeriella nypae	Bambusa spp., Nypa fruticans, Phoenix hanceana	Arecaceae, Poaceae	Brunei, China	[73,115,119]
Astrosphaeriella pallidipolaris	Unknown host	-	China	[149]
Astrosphaeriella papuana	Bambusa spp.	Poaceae	Papua New Guinea	[126,150]
Astrosphaeriella picea	Unknown host	-	-	[151]
Astrosphaeriella pinicola	Pinus spp.	Pinaceae	Austria	[152]
Astrosphaeriella polymorpha	Ulmus spp.	Ulmaceae	The United States	[153]
Astrosphaeriella roseobrunnea	Bambusa spp.	Poaceae	China	[66]
Astrosphaeriella seychellensis	Unknown host	-	Seychelles	[154]
Astrosphaeriella splendida	Arundinaria hindsii, Astrocaryum sp., Iriartea sp., Jessenia bataua, Mauritia flexuosa	Arecaceae, Poaceae	China, Ecuador	[73,107,119]
Astrosphaeriella stellata	Bambusa spp., Calamus spp., Dendrocalamus spp., Phyllostachys heterocycla, Thysanolaena maxima	Arecaceae, Poaceae	Australia, China, India, Japan, Papua New Guinea, Philippines, Vietnam	[107,115,119,127,150,155,156,157]
Astrosphaeriella striaspora	Valota insularis	Poaceae	Venezuela	[119]
Astrosphaeriella sundarbanensis	Sonneratia apetala	Lythraceae	India	[73]
Astrosphaeriella thailandensis	Unknown host	-	Thailand	[158]
Astrosphaeriella thailandica	Bambusa spp.	Poaceae	Thailand	[58]
Astrosphaeriella thysanolaenae	Thysanolaena maxima	Poaceae	Thailand	[58]
Astrosphaeriella trochus	Bambusa spp., Phragmites spp., Phyllostachys spp.	Poaceae	China, Indonesia, South Africa	[73,107,119]
Astrosphaeriella uberina	Unknown host	Arecaceae	France, Nicaragua	[73,119]
Astrosphaeriella uniseptata	Miliusa tectona	Annonaceae	India	[159]
Astrosphaeriella vaginata	Bactris baculifera	Arecaceae	Mexico	[160]
Astrosphaeriella venezuelensis	Bambusa spp.	Poaceae	Venezuela	[126]
Astrosphaeriella vesuvius	Calamus spp., Daemonorops oxycarpus, Korthalsia sp., Licuala sp.	Arecaceae	Australia, Brunei, Indonesia, Thailand, Malaysia, Papua New Guinea, Sri Lanka	[73,119]
Astrosphaeriella yunnanensis	Bambusa spp.	Poaceae	China	[161]
Astrosphaeriellopsis bakeriana	Livistona sinensis	Arecaceae	Singapore	[162]
Astrosphaeriellopsis caryotae	Caryota sp.	Arecaceae	Thailand	[59]
Caryospora aquatica	Unknown host	-	Thailand	[80]
Caryospora australiensis	Unknown host	-	Australia	[163]
Caryospora coffeae	Coffea sp.	Rubiaceae	Venezuela	[164]
Caryospora daweiensis	Melocalamus compactiflorus	Poaceae	China	[165]
Caryospora langloisii	Arundinaria sp., Grewia asiatica	Malvaceae, Poaceae	India, The United States	[126,166,167,168]
Caryospora masonii	Eugenia caryophyllus	Myrtaceae	Tanzania	[169]
Caryospora minima	Amygdalus persica, Prunus persica	Rosaceae	The United States	[168]
Caryospora obclavata	Unknown host	-		[104]
Caryospora phyllostachydis	Phyllostachys bambusoides	Poaceae	Japan	[135]
Caryospora pruni	Prunus persica	Rosaceae	China	this study
Caryospora quercus	Citus maxima, Quercus sp.	Fagaceae, Rutaceae	China, Thailand	[60,83], this study
Caryospora submersa	Unknown host	-	Thailand	[60]
Javaria samuelsii	Nothofagus sp.	Arecaceae, Nothofagaceae	Brazil, New Zealand	[170,171]
Javaria shimekii	Unknown host	-	Nicaragua	[143]
Mycopepon bambusae	Babmbusa spp.	Poaceae	China	[172]
Mycopepon fusoidisporus	Babmbusa spp.	Poaceae	China	[172]
Mycopepon smithii	Unknown host	-	Nicaragua	[170]
Pithomyces africanus	Borassus spp., Ficus spp., Hyphaene thebaica, Musa balbisiana, Ophiopogon japonicus, Trachelospermum jasminoides	Apocynaceae, Arecaceae, Asparagaceae, Moraceae, Musaceae	China, Ghana, Sierra Leone	[73,110,111]
Pithomyces alabamensis	Quercus spp.	Fagaceae	The United States	[173]
Pithomyces arecastri	Arecastrum romanzoffianum	Arecaceae	China	[174]
Pithomyces bulbilus	Eucalyptus spp.	Myrtaceae	India	[175]
Pithomyces caryotae	Caryota sp.	Arecaceae	Thailand	[59]
Pithomyces cateniformis	Wisteria sinensis	Fabaceae	China	[110]
Pithomyces cinnamomeus	Unknown host	-	Cuba	[176]
Pithomyces clavisporopsis	Lilium amoenum	Liliaceae	China	[110]
Pithomyces clavisporus	Unknown host	-	The United States	[177]
Pithomyces cupaniae	Actinodaphne angustifolia, Albizia ferruginea, Anisophyllea laurina, Carpodinus hirsuta, Clitandra sp., Cupania guatemalensis, Funtumia africana, Jasminum dichotomum, Millettia pallens, Sorindeia juglandifolia	Anacardiaceae, Anisophylleaceae, Apocynaceae, Fabaceae, Lauraceae, Oleaceae, Sapindaceae	Costa Rica, Myanmar, Sierra Leone	[73,111,178]
Pithomyces dimorphosporus	Unknown host	-	Brazil	[179]
Pithomyces divaricatus	Casearia tomentosa	Salicaceae	India	[180]
Pithomyces djbhatii	Unknown host	Arecaceae	India	[73]
Pithomyces elaeidicola	Elaeis guineensis, Phoenix canariensis, Trachycarpus spp.	Arecaceae	China, Sierra Leone, Tanzania	[73,110,111,181]
Pithomyces ellipticus	Lagerstroemia speciosa, Trachycarpus fortunei	Arecaceae, Lythraceae	China	[73,110]
Pithomyces ellisii	Butea monosperma, Eucalyptus sp.	Fabaceae, Myrtaceae	India	[182]
Pithomyces flavus	Oncosperma sp.	Arecaceae	Sri Lanka	[73,111]
Pithomyces gladioli	Gladiolus communis	Iridaceae	China	[73,110]
Pithomyces graminicola	Arachis hypogaea, Canna spp., Dendrocalamus sp., Mangifera indica, Panicum spp., Persea americana, Phyllostachys spp., Ravenala spp., Saccharum spp., Sporobolus fertilis	Anacardiaceae, Cannaceae, Fabaceae, Lauraceae, Poaceae, Strelitziaceae	China, Fiji, India, South Africa	[73,110,111,112,113,114,115]
Pithomyces helminthosporioides	Ficus elastica	Moraceae	China	[73,110]
Pithomyces hyalosporus	Unknown host	-	India	[159]
Pithomyces leprosus	Faurea saligna	Proteaceae	Tanzania	[183]
Pithomyces licualae	Licuala sp.	Arecaceae	China	[59]
Pithomyces longiclavisporus	Soil	-	China	[117]
Pithomyces longipes	Bambusa ventricosa	Poaceae	China	[174]
Pithomyces musae	Musa wilsonii	Musaceae	China	[73]
Pithomyces niger	Bambusa spp.	Poaceae	Cuba	[184]
Pithomyces obpyriformis	Lagerstroemia speciosa	Lythraceae	China	[174]
Pithomyces obscuriseptatus	Acorus calamus, Butomus umbellatus, Carex spp., Cyperus fuscus, Eleocharis spp., Juncus spp., Sparganium spp.	Acoraceae, Arecaceae, Butomaceae, Cyperaceae, Juncaceae, Typhaceae	Peru, Poland	[73,116]
Pithomyces pallidus	Soil	-	China	[117]
Pithomyces prolatus	Pithecellobium cubense	Fabaceae	Cuba	[185]
Pithomyces pulvinatus	Ficus microcarpa, Phoenix sp., Setaria pumila	Arecaceae, Fabaceae, Moraceae, Poaceae	China, Indonesia, Pakistan, Poland	[73,109,110,186]
Pithomyces quadratus	Crataegus sp.	Rosaceae	The United States	[187]
Pithomyces saccharicola	Saccharum officinarum	Poaceae	China	[174]
Pithomyces sivaramaprasadii	Unknown host	-	India	[188]
Pithomyces subramanianii	Unknown host	-	India	[73]
Pithomyces sumiderensis	Unknown host	-	Cuba	[176]
Pithomyces taiwanensis	Arecastrum romanzoffianum	Arecaceae	China	[73,110,189]
Pithomyces trachelospermi	Trachelospermum jasminoides	Apocynaceae	China	[174]
Pithomyces valparadisiacus	Calopsis spp., Leucadendron sp., Puya chilensis, Puya coerulea, Rhodocoma capensis	Bromeliaceae, Proteaceae, Restionaceae	Chile, South Africa	[73,190,191]
Pithomyces variegatae	Bauhinia variegata	Fabaceae	China	[174]
Pteridiospora bambusae	Bambusa sp.	Poaceae	China	[90]
Pteridiospora chiangraiensis	Bambusa sp.	Poaceae	Thailand	[58]
Pteridiospora chochrjakovii	Quercus pedunculiflora	Fagaceae	Azerbaijan	[73]
Pteridiospora javanica	Bambusa sp.	Poaceae	Indonesia, Thailand	[91,126]
Pteridiospora munkii	Phoenix sylvestris	Arecaceae	India	[121]
Pteridiospora spinosispora	Fraxinus pennsylvanica, Liquidambar styraciflua	Altingiaceae, Oleaceae	The United States	[192]
Quercicola fusiformis	Quercus sp.	Fagaceae	Thailand	[83]
Quercicola guttulospora	-	Fagaceae	Thailand	[83]
Xenoastrosphaeriella aquatica	Unknown host	-	China	[193]
Xenoastrosphaeriella tornata	Bambusa sp.	Poaceae	Thailand	[58,194]
Carinispora nypae	Licuala longicalycata, Nypa fruticans	Arecaceae	Brunei, Thailand	[97,133,195]
Carinispora velatispora	Oncosperma tigillarium	Arecaceae	Brunei	[137]
Pseudoastrosphaeriella aequatoriensis	Phytelephas sp.	Arecaceae	Ecuador	[73,119]
Pseudoastrosphaeriella africana	Arenga undulatifolia, Calamus spp., Daemonorops sp., Phragmites australis	Arecaceae, Poaceae	Australia, Brunei, Malaysia, Philippines, Tanzania	[119,142]
Pseudoastrosphaeriella aquatica	Unknown host	-	Thailand	[60]
Pseudoastrosphaeriella bambusae	Bambusa spp.	Poaceae	Thailand	[58]
Pseudoastrosphaeriella longicolla	Bambusa spp.	Poaceae	Thailand	[58]
Pseudoastrosphaeriella papillata	Bambusa spp.	Poaceae	Brunei	[119]
Pseudoastrosphaeriella thailandensis	Bambusa spp.	Poaceae	Thailand	[119]
Pseudoastrosphaeriellopsis kaveriana	Avicennia marina	Arecaceae	India	[58]
Pseudoastrosphaeriella zingiberacearum	Hedychium coronarium	Zingiberaceae	China	this study

Table 3. Host association and geographical distribution of reported Aigialaceae, Astrosphaeriellaceae, and Pseudoastrosphaeriellaceae species.

Species	Host	Family	Locality	References
Aigialus grandis	Rhizophora mangle, Rhizophora mucronata, Sonneratia acida	Lythraceae, Rhizophoraceae	The United States, India	[120,121,122]
Aigialus mangrovis	Rhizophora mucronata	Rhizophoraceae	India	[121,123]
Aigialus parvus	Avicennia alba, Rhizophora mangle, Sonneratia acida	Lythraceae, Rhizophoraceae	The United States	[121,122]
Aigialus rhizophorae	Rhizophora mucronata	Rhizophoraceae	India	[121,123]
Aigialus striatisporus	Rhizophora apiculata	Rhizophoraceae	Thailand	[73]
Fissuroma aggregatum	Phyllostachys reticulata	Poaceae	Japan	[95,124,125,126,127]
Fissuroma arengae	Arenga pinnata	Arecaceae	Thailand	[88]
Fissuroma bambusae	Bambusa spp.	Poaceae	Thailand	[58]
Fissuroma bambusicola	Bambusa spp.	Poaceae	China	[128]
Fissuroma calami	Calamus rotang	Arecaceae	Thailand	[59]
Fissuroma caryotae	Arenga undulatifolia Caryota urens	Arecaceae	China	[59], this study
Fissuroma chinense	Bambusa spp.	Poaceae	China	[66]
Fissuroma fissuristomum	Bambusa spp. Calamus conirostris, Licuala sp., Mauritia flexuosa	Arecaceae, Poaceae	Australia, Brunei, China, Ecuador, Papua New Guinea	[73,107,129]
Fissuroma kavachabeejae	Calamus andamanicus	Arecaceae	India	[105]
Fissuroma maculans	Arenga spp.	Arecaceae	Philippines	[79,130]
Fissuroma microsporum	Borassus flabellifer	Arecaceae	India	[105]
Fissuroma neoaggregatum	Bambusa spp.	Poaceae	Thailand	[58]
Fissuroma palmae	Arenga pinnata	Arecaceae	Thailand	[86]
Fissuroma taiwanense	Hedychium coronarium	Zingiberaceae	China	[87])
Fissuroma thailandicum	Bambusa spp.	Poaceae	Thailand	[58]
Fissuroma wallichiae	Wallichia sp.	Theaceae	Thailand	[88]
Neoastrosphaeriella alankrithabeejae	Calamus andamanicus	Arecaceae	India	[105]
Neoastrosphaeriella aquatica	Phoenix paludosa	Arecaceae	China, Thailand	[89], this study
Neoastrosphaeriella krabiensis	Metroxylon sagu	Arecaceae	Thailand	[79]
Neoastrosphaeriella phoenicis	Phoenix paludosa	Arecaceae	Thailand	[86]
Neoastrosphaeriella sribooniensis	Calamus rotang	Arecaceae	Thailand	[59]
Posidoniomyces atricolor	Posidonia oceanica	Posidoniaceae	Croatia	[131]
Rimora mangrovei	Avicennia officinalis, Rhizophora mangle	Rhizophoraceae, Verbenaceae	The United States, India	[73,121,122]
Aquatospora cylindrica	Unknown host	-	Thailand	[60]
Astrosphaeriella angustispora	Eleiodoxa conferta, Licuala spp.	Arecaceae	Brunei	[119,132,133]
Astrosphaeriella aosimensis	Livistona subglobosa	Arecaceae	Japan	[134,135]
Astrosphaeriella applanata	Alnus sp., Carpinus sp., Quercus spp.	-	Poland, Sweden, the United Kingdom,	[73,109,136]
Astrosphaeriella aquatica	Licuala longicalycata, Livistona spp.	Arecaceae	Ecuador, Papua New Guinea, Thailand	[73,119,133,137]
Astrosphaeriella asiana	Aegiceras corniculatum, Sonneratia alba	Lythraceae, Primulaceae	Thailand	[119,138]
Astrosphaeriella australiensis	Calamus spp.	Arecaceae	Australia	[119]
Astrosphaeriella bambusae	Bambusa spp., Metroxylon sagu	Arecaceae, Poaceae	China, Thailand	[58], this study
Astrosphaeriella bambusella	Bambusa spp.	Poaceae	Indonesia	[126,139]
Astrosphaeriella callicarpa	Unknown host	-	Indonesia	[140]
Astrosphaeriella daemonoropis	Daemonorops margaritae	Arecaceae	China	[115,129]
Astrosphaeriella erumpens	Unknown host	Arecaceae	Cuba	[141]
Astrosphaeriella exorrhiza	Iriartea sp.	Arecaceae	Venezuela	[119,142]
Astrosphaeriella floridana	Sabal palmetto	Arecaceae	The United States, Thailand	[133,143]
Astrosphaeriella frondicola	Calamus spp., Daemonorops spp., Laccospadix australasica, Oraniopsis appendiculata	Arecaceae	Australia, Brunei, China	[73,115,119,144]
Astrosphaeriella fuscomaculans	Phyllostachys nigra	Poaceae	Japan	[73,125,126]
Astrosphaeriella fusispora	Bambusa spinosa, Phyllostachys bambusoides, Pleioblastus pubescens	Poaceae	Japan, Philippines	[73,125,126,130,145]
Astrosphaeriella gaofengensis	Bambusa spp.	Poaceae	China	[66]
Astrosphaeriella immersa	Archontophoenix alexandrae	Arecaceae	China	[115,129]
Astrosphaeriella lageniformis	Cocos nucifera	Arecaceae	China	[73,146]
Astrosphaeriella lenticularis	Geonoma sp.	Arecaceae	Brunei, Ecuador	[73,119]
Astrosphaeriella linguiformis	Bambusa spp.	Poaceae	China	[147]
Astrosphaeriella livistonicola	Livistona chinensis	Arecaceae	China, Thailand	[73,115,129,133]
Astrosphaeriella longispora	Unknown host	-	Costa Rica	[148]
Astrosphaeriella lophiostomopsis	Arenga undulatifolia	Arecaceae	Brunei, Thailand	[119,133]
Astrosphaeriella macrospora	Miscanthus spp.	Poaceae	China	[149]
Astrosphaeriella malayensis	Daemonorops sp., Licuala longicalycata	Arecaceae	Malaysia, Papua New Guinea, Thailand	[119,129,133]
Astrosphaeriella maquilingiana	Calamus spp., Iriartea sp.	Arecaceae	Australia, Ecuador, Philippines	[73,119]
Astrosphaeriella mauritiae	Mauritia flexuosa	Arecaceae	Ecuador	[119]
Astrosphaeriella minima	Bambusa spp.	Poaceae	China, Indonesia	[140,150]
Astrosphaeriella minoensis	Licuala ramsayi, Phyllostachys reticulata, Sasa kurilensis	Arecaceae, Poaceae	Australia, Japan	[119,142,150]
Astrosphaeriella neofusispora	Bambusa spp.	Poaceae	Thailand	[58]
Astrosphaeriella neostellata	Bambusa spp.	Poaceae	Thailand	[58]
Astrosphaeriella nipicola	Nipa sp.	Arecaceae	Indonesia	[119]
Astrosphaeriella nypae	Bambusa spp., Nypa fruticans, Phoenix hanceana	Arecaceae, Poaceae	Brunei, China	[73,115,119]
Astrosphaeriella pallidipolaris	Unknown host	-	China	[149]
Astrosphaeriella papuana	Bambusa spp.	Poaceae	Papua New Guinea	[126,150]
Astrosphaeriella picea	Unknown host	-	-	[151]
Astrosphaeriella pinicola	Pinus spp.	Pinaceae	Austria	[152]
Astrosphaeriella polymorpha	Ulmus spp.	Ulmaceae	The United States	[153]
Astrosphaeriella roseobrunnea	Bambusa spp.	Poaceae	China	[66]
Astrosphaeriella seychellensis	Unknown host	-	Seychelles	[154]
Astrosphaeriella splendida	Arundinaria hindsii, Astrocaryum sp., Iriartea sp., Jessenia bataua, Mauritia flexuosa	Arecaceae, Poaceae	China, Ecuador	[73,107,119]
Astrosphaeriella stellata	Bambusa spp., Calamus spp., Dendrocalamus spp., Phyllostachys heterocycla, Thysanolaena maxima	Arecaceae, Poaceae	Australia, China, India, Japan, Papua New Guinea, Philippines, Vietnam	[107,115,119,127,150,155,156,157]
Astrosphaeriella striaspora	Valota insularis	Poaceae	Venezuela	[119]
Astrosphaeriella sundarbanensis	Sonneratia apetala	Lythraceae	India	[73]
Astrosphaeriella thailandensis	Unknown host	-	Thailand	[158]
Astrosphaeriella thailandica	Bambusa spp.	Poaceae	Thailand	[58]
Astrosphaeriella thysanolaenae	Thysanolaena maxima	Poaceae	Thailand	[58]
Astrosphaeriella trochus	Bambusa spp., Phragmites spp., Phyllostachys spp.	Poaceae	China, Indonesia, South Africa	[73,107,119]
Astrosphaeriella uberina	Unknown host	Arecaceae	France, Nicaragua	[73,119]
Astrosphaeriella uniseptata	Miliusa tectona	Annonaceae	India	[159]
Astrosphaeriella vaginata	Bactris baculifera	Arecaceae	Mexico	[160]
Astrosphaeriella venezuelensis	Bambusa spp.	Poaceae	Venezuela	[126]
Astrosphaeriella vesuvius	Calamus spp., Daemonorops oxycarpus, Korthalsia sp., Licuala sp.	Arecaceae	Australia, Brunei, Indonesia, Thailand, Malaysia, Papua New Guinea, Sri Lanka	[73,119]
Astrosphaeriella yunnanensis	Bambusa spp.	Poaceae	China	[161]
Astrosphaeriellopsis bakeriana	Livistona sinensis	Arecaceae	Singapore	[162]
Astrosphaeriellopsis caryotae	Caryota sp.	Arecaceae	Thailand	[59]
Caryospora aquatica	Unknown host	-	Thailand	[80]
Caryospora australiensis	Unknown host	-	Australia	[163]
Caryospora coffeae	Coffea sp.	Rubiaceae	Venezuela	[164]
Caryospora daweiensis	Melocalamus compactiflorus	Poaceae	China	[165]
Caryospora langloisii	Arundinaria sp., Grewia asiatica	Malvaceae, Poaceae	India, The United States	[126,166,167,168]
Caryospora masonii	Eugenia caryophyllus	Myrtaceae	Tanzania	[169]
Caryospora minima	Amygdalus persica, Prunus persica	Rosaceae	The United States	[168]
Caryospora obclavata	Unknown host	-		[104]
Caryospora phyllostachydis	Phyllostachys bambusoides	Poaceae	Japan	[135]
Caryospora pruni	Prunus persica	Rosaceae	China	this study
Caryospora quercus	Citus maxima, Quercus sp.	Fagaceae, Rutaceae	China, Thailand	[60,83], this study
Caryospora submersa	Unknown host	-	Thailand	[60]
Javaria samuelsii	Nothofagus sp.	Arecaceae, Nothofagaceae	Brazil, New Zealand	[170,171]
Javaria shimekii	Unknown host	-	Nicaragua	[143]
Mycopepon bambusae	Babmbusa spp.	Poaceae	China	[172]
Mycopepon fusoidisporus	Babmbusa spp.	Poaceae	China	[172]
Mycopepon smithii	Unknown host	-	Nicaragua	[170]
Pithomyces africanus	Borassus spp., Ficus spp., Hyphaene thebaica, Musa balbisiana, Ophiopogon japonicus, Trachelospermum jasminoides	Apocynaceae, Arecaceae, Asparagaceae, Moraceae, Musaceae	China, Ghana, Sierra Leone	[73,110,111]
Pithomyces alabamensis	Quercus spp.	Fagaceae	The United States	[173]
Pithomyces arecastri	Arecastrum romanzoffianum	Arecaceae	China	[174]
Pithomyces bulbilus	Eucalyptus spp.	Myrtaceae	India	[175]
Pithomyces caryotae	Caryota sp.	Arecaceae	Thailand	[59]
Pithomyces cateniformis	Wisteria sinensis	Fabaceae	China	[110]
Pithomyces cinnamomeus	Unknown host	-	Cuba	[176]
Pithomyces clavisporopsis	Lilium amoenum	Liliaceae	China	[110]
Pithomyces clavisporus	Unknown host	-	The United States	[177]
Pithomyces cupaniae	Actinodaphne angustifolia, Albizia ferruginea, Anisophyllea laurina, Carpodinus hirsuta, Clitandra sp., Cupania guatemalensis, Funtumia africana, Jasminum dichotomum, Millettia pallens, Sorindeia juglandifolia	Anacardiaceae, Anisophylleaceae, Apocynaceae, Fabaceae, Lauraceae, Oleaceae, Sapindaceae	Costa Rica, Myanmar, Sierra Leone	[73,111,178]
Pithomyces dimorphosporus	Unknown host	-	Brazil	[179]
Pithomyces divaricatus	Casearia tomentosa	Salicaceae	India	[180]
Pithomyces djbhatii	Unknown host	Arecaceae	India	[73]
Pithomyces elaeidicola	Elaeis guineensis, Phoenix canariensis, Trachycarpus spp.	Arecaceae	China, Sierra Leone, Tanzania	[73,110,111,181]
Pithomyces ellipticus	Lagerstroemia speciosa, Trachycarpus fortunei	Arecaceae, Lythraceae	China	[73,110]
Pithomyces ellisii	Butea monosperma, Eucalyptus sp.	Fabaceae, Myrtaceae	India	[182]
Pithomyces flavus	Oncosperma sp.	Arecaceae	Sri Lanka	[73,111]
Pithomyces gladioli	Gladiolus communis	Iridaceae	China	[73,110]
Pithomyces graminicola	Arachis hypogaea, Canna spp., Dendrocalamus sp., Mangifera indica, Panicum spp., Persea americana, Phyllostachys spp., Ravenala spp., Saccharum spp., Sporobolus fertilis	Anacardiaceae, Cannaceae, Fabaceae, Lauraceae, Poaceae, Strelitziaceae	China, Fiji, India, South Africa	[73,110,111,112,113,114,115]
Pithomyces helminthosporioides	Ficus elastica	Moraceae	China	[73,110]
Pithomyces hyalosporus	Unknown host	-	India	[159]
Pithomyces leprosus	Faurea saligna	Proteaceae	Tanzania	[183]
Pithomyces licualae	Licuala sp.	Arecaceae	China	[59]
Pithomyces longiclavisporus	Soil	-	China	[117]
Pithomyces longipes	Bambusa ventricosa	Poaceae	China	[174]
Pithomyces musae	Musa wilsonii	Musaceae	China	[73]
Pithomyces niger	Bambusa spp.	Poaceae	Cuba	[184]
Pithomyces obpyriformis	Lagerstroemia speciosa	Lythraceae	China	[174]
Pithomyces obscuriseptatus	Acorus calamus, Butomus umbellatus, Carex spp., Cyperus fuscus, Eleocharis spp., Juncus spp., Sparganium spp.	Acoraceae, Arecaceae, Butomaceae, Cyperaceae, Juncaceae, Typhaceae	Peru, Poland	[73,116]
Pithomyces pallidus	Soil	-	China	[117]
Pithomyces prolatus	Pithecellobium cubense	Fabaceae	Cuba	[185]
Pithomyces pulvinatus	Ficus microcarpa, Phoenix sp., Setaria pumila	Arecaceae, Fabaceae, Moraceae, Poaceae	China, Indonesia, Pakistan, Poland	[73,109,110,186]
Pithomyces quadratus	Crataegus sp.	Rosaceae	The United States	[187]
Pithomyces saccharicola	Saccharum officinarum	Poaceae	China	[174]
Pithomyces sivaramaprasadii	Unknown host	-	India	[188]
Pithomyces subramanianii	Unknown host	-	India	[73]
Pithomyces sumiderensis	Unknown host	-	Cuba	[176]
Pithomyces taiwanensis	Arecastrum romanzoffianum	Arecaceae	China	[73,110,189]
Pithomyces trachelospermi	Trachelospermum jasminoides	Apocynaceae	China	[174]
Pithomyces valparadisiacus	Calopsis spp., Leucadendron sp., Puya chilensis, Puya coerulea, Rhodocoma capensis	Bromeliaceae, Proteaceae, Restionaceae	Chile, South Africa	[73,190,191]
Pithomyces variegatae	Bauhinia variegata	Fabaceae	China	[174]
Pteridiospora bambusae	Bambusa sp.	Poaceae	China	[90]
Pteridiospora chiangraiensis	Bambusa sp.	Poaceae	Thailand	[58]
Pteridiospora chochrjakovii	Quercus pedunculiflora	Fagaceae	Azerbaijan	[73]
Pteridiospora javanica	Bambusa sp.	Poaceae	Indonesia, Thailand	[91,126]
Pteridiospora munkii	Phoenix sylvestris	Arecaceae	India	[121]
Pteridiospora spinosispora	Fraxinus pennsylvanica, Liquidambar styraciflua	Altingiaceae, Oleaceae	The United States	[192]
Quercicola fusiformis	Quercus sp.	Fagaceae	Thailand	[83]
Quercicola guttulospora	-	Fagaceae	Thailand	[83]
Xenoastrosphaeriella aquatica	Unknown host	-	China	[193]
Xenoastrosphaeriella tornata	Bambusa sp.	Poaceae	Thailand	[58,194]
Carinispora nypae	Licuala longicalycata, Nypa fruticans	Arecaceae	Brunei, Thailand	[97,133,195]
Carinispora velatispora	Oncosperma tigillarium	Arecaceae	Brunei	[137]
Pseudoastrosphaeriella aequatoriensis	Phytelephas sp.	Arecaceae	Ecuador	[73,119]
Pseudoastrosphaeriella africana	Arenga undulatifolia, Calamus spp., Daemonorops sp., Phragmites australis	Arecaceae, Poaceae	Australia, Brunei, Malaysia, Philippines, Tanzania	[119,142]
Pseudoastrosphaeriella aquatica	Unknown host	-	Thailand	[60]
Pseudoastrosphaeriella bambusae	Bambusa spp.	Poaceae	Thailand	[58]
Pseudoastrosphaeriella longicolla	Bambusa spp.	Poaceae	Thailand	[58]
Pseudoastrosphaeriella papillata	Bambusa spp.	Poaceae	Brunei	[119]
Pseudoastrosphaeriella thailandensis	Bambusa spp.	Poaceae	Thailand	[119]
Pseudoastrosphaeriellopsis kaveriana	Avicennia marina	Arecaceae	India	[58]
Pseudoastrosphaeriella zingiberacearum	Hedychium coronarium	Zingiberaceae	China	this study

4. Discussion

The families Aigialaceae, Astrosphaeriellaceae, and Pseudoastrosphaeriellaceae are notable within the order Pleosporales, as they all possess carbonaceous ascomata and trabeculate pseudoparaphyses [58,93,196]. Of them, Aigialaceae was established by Suetrong et al. [75] to include three genera, Aigialus, Ascocratera, and Rimora, which were collected from mangrove habitats. Liu et al. [79] added Fissuroma and Neoastrosphaeriella to Aigialaceae from terrestrial habitats. Subsequently, Posidoniomyces was accommodated to the family from Mediterranean seagrass [197]. Thus, currently 29 species belonging to six genera are accepted in Aigialaceae [93,98,103]. Fissuroma is the most diverse genus in the family with 16 species, and all other genera have fewer than six species (Aigialus: 5 species, Neoastrosphaeriella: 5 species, Ascocratera: 1 species, Posidoniomyces: 1 species, Rimora: 1 species). Genera within the Aigialaceae family have been observed in diverse environments, including freshwater, mangrove, marine, and terrestrial ecosystems [58,59,60,66]. Aigialaceae species have carbonaceous, conical to hemispherical ascomata with slit-like opening, trabeculate pseudoparaphyses, cylindrical or cylindrical-clavate asci, and hyaline to brown, ellipsoidal to fusiform, septate to muriform ascospores with a sheath or gelatinous appendages around the apical cells [58,75,87,102]. In this study, we have revealed two new host records, Fissuroma caryotae and Neoastrosphaeriella aquatica from Hedychium coronarium (Zingiberaceae) and Phoenix paludosa (Arecaceae), respectively.

Phookamsak et al. [58] established Astrosphaeriellaceae to include two genera, such as Astrosphaeriella and Pteridiospora. The species have carbonaceous, conical ascomata, trabeculate pseudoparaphyses, bitunicate asci, and fusiform or obclavate ascospores. The asexual morph can be either coelomycetous or hyphomycetous [59,93]. The phylogenetic affinity of Astrosphaeriellopsis and Pithomyces in Astrosphaeriellaceae was discussed by Wanasinghe et al. [59] based on LSU, SSU, and tef1-α sequences. In addition, many novel Astrosphaeriellaceae genera were discovered in recent studies. For instance, four genera, such as Mycopepon [172], Quercicola, Xenoastrosphaeriella [83], and Aquatospora [60], were established in just three years. The phylogenetic placement of Javaria is still not well-resolved since it is lacking molecular data, but it has been placed in Astrosphaeriellaceae in recent outlines [103]. In addition, the taxonomic placement of the Caryospora has been controversial. This was placed in Caryosporaceae based on C. aquatica and C. minima, but later transferred to Astrosphaeriellaceae due to the similarity of carbonaceous ascostromata and trabeculate pseudoparaphyses [80,83]. The affinity of Caryospora to Astrosphaeriellaceae was followed by a recent outline of Wijayawardene et al. [103] as well. Therefore, currently 10 genera are accepted in Astrosphaeriellaceae [60,103]. Of them, some genera are highly diverse (e.g., Astrosphaeriella: 55 species, Pithomyces: 41 species), while others have a few numbers of species (Caryospora: 12 species, Pteridiospora: 6 species, Mycopepon: 4 species, Astrosphaeriellopsis: 2 species, Javaria: 2 species, Quercicola: 2 species, Xenoastrosphaeriella: 2 species, Aquatospora: 1 species). In this study, we introduce a new species, Caryospora pruni, from the decaying fruit pericarp of Prunus persica (Rosaceae), and two new host records, Astrosphaeriella bambusae and Caryospora quercus from Hedychium coronarium (Zingiberaceae) and Citus maxima (Rutaceae), respectively.

Pseudoastrosphaeriellaceae consists of three genera, such as Carinispora, Pseudoastrosphaeriella, and Pseudoastrosphaeriellopsis, which have hemispherical to lenticular ascostromata, trabeculate pseudoparaphyses, and brown, fusiform to obclavate ascospores with striations or longitudinal ridges [58,93,118,198]. Pseudoastrosphaeriella is the most diverse genus in the family, with seven species, and others have fewer species (Carinispora: 2 species and Pseudoastrosphaeriellopsis: 1 species). The asexual morph has been recorded as coelomycetous with pycnidial, conical, or hemispherical to globose conidiomata, phialidic, cylindric-clavate or ampulliform conidiogenous cells, and hyaline, globose to subglobose, or oblong, aseptate conidia [58]. The type genus is Pseudoastrosphaeriella, which was previously placed in Astrosphaeriella sensu lato. In this study, we introduce a new species, Pseudoastrosphaeriella zingiberacearum, from the dead stem of Hedychium coronarium in China. Interestingly, this is the first Pseudoastrosphaeriellaceae species reported from the host family, Zingiberaceae.

The new species and host records from Guangdong and Jiangxi Provinces extend the known distributions of Aigialaceae, Astrosphaeriellaceae, and Pseudoastrosphaeriellaceae within humid subtropical regions of China. Their occurrence on diverse hosts, Arecaceae, Zingiberaceae, and Rutaceae, suggests these families are not restricted to mangrove or aquatic habitats, but can adapt to terrestrial plant litter environments. This supports the idea that subtropical forests act as biodiversity hotspots for pleosporalean fungi, where microclimatic conditions such as high humidity, seasonal rainfall, and decaying organic matter availability provide suitable niches. Biogeographically, the occurrence of these fungi in subtropical regions of China indicates possible hotspots of fungal diversity within humid subtropical ecosystems. The simultaneous presence of these fungal families in plant litter may result from similar ecological preferences, such as high humidity, nutrient-rich decaying substrates, and stable microhabitats, which together facilitate their coexistence.

Future studies with broader geographic sampling, the use of multi-gene (e.g., ITS, rpb2), environmental, or metabarcoding analyses would improve the understanding of fungal diversity and ecological interactions of these families. Since the host specificity of these proposed taxa remains unconfirmed, it could be validated through expanded sampling. Incorporating metagenomics and high-throughput sequencing would also allow for the detection of non-cultivable species, enabling a comprehensive assessment of fungal communities in plant litter and other substrates.

5. Conclusions

The morphological characteristics of the new species (Caryospora pruni and Pseudoastrosphaeriella zingiberacearum), which are introduced in this study, tally well with their respective generic concepts and can be distinguished from related species in their morphology and DNA molecular data. The new host records (Astrosphaeriella bambusae, Caryospora quercus, Fissuroma caryotae, and Neoastrosphaeriella aquatica) also provide similar morphological characteristics to their type species, and multi-gene phylogeny analyses also offer evidence for their placements. These discoveries significantly expand our understanding of fungal biodiversity across diverse hosts, substrates, and habitats, which is crucial for ecological research and conservation efforts. Future collections are required to understand the circumscription of some Aigialaceae, Astrosphaeriellaceae, and Pseudoastrosphaeriellaceae genera, which have single species, such as Ascocratera, Aquatospora, Posidoniomyces, Pseudoastrosphaeriellopsis, and Rimora. Although some genera are highly diverse with numerous species, most of them lack molecular data. For instance, Pithomyces comprises 41 species, but molecular data are available for only 7 of them. Similarly, Astrosphaeriella includes 55 species, with molecular data available for only 13 species [93,98]. In addition, some genera (e.g., Javaria) are still lacking molecular data, and thus, new collections are needed to clarify their phylogenetic affinities.