Phylogenetic and Pathogenic Evidence Reveals Novel Host–Pathogen Interactions between Species of Lasiodiplodia and Citrus latifolia Dieback Disease in Southern Mexico
Abstract
:1. Introduction
2. Materials and Methods
2.1. Field Survey and Sampling
2.2. Fungal Isolations from Persian Lime Branches with Dieback
2.3. DNA Extraction, Polymerase Chain Reaction Amplification, and Sequencing
2.4. Phylogenetic Analyses
2.5. Pathogenicity Tests on Detached Branches of Persian Lime
2.6. Pathogenicity on Persian Lime Plants from Certified Commercial Nursery and Virulence Tests
3. Results
3.1. Sample Collection, Isolation, and DNA Sequencing
3.2. Phylogenetic Analyses
3.3. Pathogenicity and Virulence on Detached Branches and Plants from Certified Commercial Nursery of Persian Lime
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- FAO (Food and Agriculture Organization). Online Statistical Database. FAOSTAT. 2022. Available online: https://www.fao.org/faostat/es/#data/QCL (accessed on 15 April 2024).
- SIAP (Servicio de Información Agroalimentaria y Pesquera). Anuario Estadístico de la Producción Agrícola. 2022. Available online: https://www.gob.mx/siap (accessed on 15 April 2024).
- Talhinhas, P.; Baroncelli, R. Colletotrichum species and complexes: Geographic distribution, host range and conservation status. Fungal Divers 2021, 110, 109–198. [Google Scholar] [CrossRef]
- Gaikwad, P.N.; Sharma, V.; Singh, J.; Sidhu, G.S.; Singh, H.; Omar, A. Biotechnological advancements in Phytophthora disease diagnosis, interaction and management in citrus. Sci. Hortic. 2023, 310, 111739. [Google Scholar] [CrossRef]
- Phillips, A.J.L.; Alves, A.; Abdollahzadeh, J.; Slippers, B.; Wingfield, M.J.; Groenewald, J.Z.; Crous, P.W. The Botryosphaeriaceae: Genera and species known from culture. Stud. Mycol. 2013, 76, 51–167. [Google Scholar] [CrossRef] [PubMed]
- Tarnowski, T.; Palmateer, A.J.; Maguire, I.; Crane, J.H. Florida Plant Disease Management Guide: ‘Tahiti’ Lime (Citrus latifolia), 1st ed.; University of Florida, IFAS Extension: Gainesville, FL, USA, 2013; PP24/VH049. [Google Scholar] [CrossRef]
- Sáenz-Pérez, C.A.; Osorio-Hernández, E.; Estrada-Drouaillet, B.; Poot-Poot, W.A.; Delgado-Martínez, A.; Rodríguez-Herrera, R. Main diseases in citrus. Rev. Mex. Cienc. Agríc. 2019, 10, 1653–1665. [Google Scholar] [CrossRef]
- Phillips, A.J.L.; Hyde, K.D.; Alves, A.; Liu, J.K. Families in Botryosphaeriales: A phylogenetic, morphological, and evolutionary perspective. Fungal Divers. 2019, 94, 1–22. [Google Scholar] [CrossRef]
- Slippers, B.; Wingfield, M.J. Botryosphaeriaceae as endophytes and latent pathogens of woody plants: Diversity, ecology and impact. Fungal Biol. Rev. 2007, 21, 90–106. [Google Scholar] [CrossRef]
- Zhang, W.; Groenewald, J.Z.; Lombard, L.; Schumacher, R.K.; Phillips, A.J.L.; Crous, P.W. Evaluating species in Botryosphaeriales. Persoonia 2021, 46, 63–115. [Google Scholar] [CrossRef] [PubMed]
- El-Ganainy, S.M.; Ismail, A.M.; Iqbal, Z.; Elshewy, E.S.; Alhudaib, K.A.; Almaghasla, M.I.; Magistà, D. Diversity among Lasiodiplodia Species Causing Dieback, Root Rot and Leaf Spot on Fruit Trees in Egypt, and a Description of Lasiodiplodia newvalleyensis sp. nov. J. Fungi 2022, 8, 1203. [Google Scholar] [CrossRef] [PubMed]
- Mondragón-Flores, A.; Rodríguez-Alvarado, G.; Gómez-Dorantes, N.; Guerra-Santos, J.J.; Fernández-Pavía, S.P. Botryosphaeriaceae: A complex, diverse and cosmopolitan family of fungi. Rev. Mex. Cienc. Agríc. 2021, 12, 643–654. [Google Scholar] [CrossRef]
- Piattino, V.; Aiello, D.; Dardani, G.; Martino, I.; Flores, M.; Aćimović, S.G.; Spadaro, D.; Polizzi, G.; Guarnaccia, V. Lasiodiplodia iraniensis and Diaporthe spp. are Associated with Twig Dieback and Fruit Stem-End Rot of Sweet Orange, Citrus sinensis, in Florida. Horticulturae 2024, 10, 406. [Google Scholar] [CrossRef]
- Leyva-Mir, S.G.; Bautista-Cruz, M.A.; Almaguer-Vargas, G.; Colinas-León, M.T.; Tovar-Pedraza, J.M.; Camacho-Tapia, M. Effectiveness of fungicides and Trichorderma spp. for the control of Lasiodiplodia spp. in ‘Persian’ lemon orchards in Veracruz. Rev. Mex. Cienc. Agríc. 2021, 12, 345–353. [Google Scholar] [CrossRef]
- Rathnayaka, A.R.; Chethana, K.W.T.; Manawasinghe, I.S.; Wijesinghe, S.N.; de Silva, N.I.; Tennakoon, D.S.; Phillips, A.J.L.; Liu, J.K.; Jones, E.B.G.; Wang, Y.; et al. Lasiodiplodia: Generic revision by providing molecular markers, geographical distribution and haplotype diversity. Mycosphere 2023, 14, 1254–1339. [Google Scholar] [CrossRef]
- Wang, Y.; Song, X.; Xie, S.; Geng, Y.; Xu, C.; Yin, X.; Zang, R.; Guo, L.; Zhang, M.; Guo, Y. Diversity of Lasiodiplodia Species Associated with Canker and Dieback in Fruit Trees in the Henan and Shandong Provinces of China. Plant Dis. 2024, 108, 563–575. [Google Scholar] [CrossRef]
- Liu, J.K.; Phookamsak, R.; Doilom, M.; Wikee, S.; Li, Y.M.; Ariyawansha, H.; Boonmee, S.; Chomnunti, P.D.D.Q.; Bhat, J.D.; Romero, A.I.; et al. Towards a natural classification of Botryosphaeriales. Fungal Divers. 2012, 57, 149–210. [Google Scholar] [CrossRef]
- Slippers, B.; Roux, J.; Wingfield, M.J.; van der Walt, F.J.; Jami, F.; Mehl, J.W.; Marais, G.J. Confronting the constraints of morphological taxonomy in the Botryosphaeriales. Persoonia 2014, 33, 155–168. [Google Scholar] [CrossRef] [PubMed]
- Berraf-TebbalI, A.; Eddine-Mahamedi, A.; Aigoun-Mouhous, W.; Spetik, M.; Cechova, J.; PokludaI, R.; Barane, M.; Eichmeier, A.; Alves, A. Lasiodiplodia mitidjana sp. nov. and other Botryosphaeriaceae species causing branch canker and dieback of Citrus sinensis in Algeria. PLoS ONE 2020, 15, e0232448. [Google Scholar] [CrossRef]
- Freire, F.C.O.; Cardoso, J.E.; Viana, F.M.P.; Martins, M.V.V. Status of Lasiodiplodia theobromae as a plant pathogen in Brazil. Essentia 2011, 12, 53–71. [Google Scholar]
- Coutinho, I.B.L.; Freire, F.C.O.; Lima, C.S.; Lima, J.S.; Gonçalves, F.J.T.; Machado, A.R.; Silva, A.M.S.; Cardoso, J.E. Diversity of genus Lasiodiplodia associated with perennialtropical fruit plants in northeastern Brazil. Plant Path. 2017, 66, 90–104. [Google Scholar] [CrossRef]
- Xiao, X.E.; Wang, W.; Crous, P.W.; Wang, H.K.; Jiao, C.; Huang, F.; Pu, Z.X.; Zhu, Z.R.; Li, H.Y. Species of Botryosphaeriaceae associated with citrus branch diseases in China. Persoonia 2021, 47, 106–135. [Google Scholar] [CrossRef]
- Abdollahzadeh, J.; Javadi, A.; Mohammadi-Goltapeh, E.; Zare, R.; Phillips, A.J.L. Phylogeny and morphology of four new species of Lasiodiplodia from Iran. Persoonia 2010, 25, 1–10. [Google Scholar] [CrossRef]
- Espargham, N.; Mohammadi, H.; Gramaje, D. A Survey of Trunk Disease Pathogens within Citrus Trees in Iran. Plants 2020, 9, 754. [Google Scholar] [CrossRef] [PubMed]
- Polanco-Florián, L.G.; Alvarado-Gómez, O.G.; Pérez-González, O.; González-Garza, R.; Olivares-Sáenz, E. Fungi associated with the regressive death of citrus fruits in Nuevo Leon and Tamaulipas, Mexico. Rev. Mex. Cienc. Agríc. 2019, 10, 757–764. [Google Scholar] [CrossRef]
- Al-Sadi, A.M.; Al-Weheibi, A.N.; Al-Shariqi, R.M.; Al-Hammadi, M.S.; Al-Hosni, I.A.; Al-Mahmooli, I.H.; Al-Ghaithi, A.G. Population genetic analysis reveals diversity in Lasiodiplodia species infecting date palm, Citrus, and mango in Oman and the UAE. Plant Dis. 2013, 97, 1363–1369. [Google Scholar] [CrossRef] [PubMed]
- Adesemoye, A.O.; Mayorquin, J.S.; Wang, D.H.; Twizeyimana, M.; Lynch, S.C.; Eskalen, A. Identification of species of Botryosphaeriaceae causing bot gummosis in citrus in California. Plant Dis. 2014, 98, 55–61. [Google Scholar] [CrossRef] [PubMed]
- Bautista-Cruz, M.A.; Almaguer-Vargas, G.; Leyva-Mir, G.; Colinas-León, M.T.; Correia, K.; Camacho-Tapia, M. Phylogeny, distribution, and pathogenicity of Lasiodiplodia species associated with cankers and dieback symptoms of persian lime in Mexico. Plant Dis. 2019, 103, 1156–1165. [Google Scholar] [CrossRef] [PubMed]
- Santillán-Mendoza, R.; Fernández-Pavía, S.P.; O’Donnell, K.; Ploetz, R.C.; Ortega-Arreola, R.; Vázquez-Marrufo, G.; Benítez-Malvido, J.; Montero-Castro, J.C.; Soto-Plancarte, A.; Rodríguez-Alvarado, G. A novel disease of big-leaf mahogany caused by two Fusarium species in Mexico. Plant Dis. 2018, 102, 1965–1972. [Google Scholar] [CrossRef] [PubMed]
- White, T.J.; Bruns, T.; Lee, S.; Taylor, J. Amplification and direct sequencing of fungal ribosomal rna genes for phylogenetics. PCR Protoc. A Guide Methods Appl. 1990, 18, 315–322. [Google Scholar]
- Glass, N.L.; Donaldson, G.C. Development of primer sets designed for use with the PCR to amplify conserved genes from filamentous ascomycetes. Appl. Environ. Microbiol. 1995, 61, 1323–1330. [Google Scholar] [CrossRef]
- Alves, A.; Crous, P.W.; Correia, A.; Phillips, A.J.L. Morphological and molecular data reveal cryptic species in Lasiodiplodia theobromae. Fungal Divers. 2008, 28, 1–13. [Google Scholar]
- Liu, Y.J.; Whelen, S.; Hall, B.D. Phylogenetic relationships among ascomycetes: Evidence from an RNA polymerse II subunit. Mol. Biol. Evol. 1999, 16, 1799–1808. [Google Scholar] [CrossRef]
- Staden, R.; Beal, K.F.; Bonfield, J.K. The Staden Package. In Bioinformatics Methods and Protocols; Misener, S., Krawetz, S.A., Eds.; Humana Press: Totowa, NJ, USA, 1998; Volume 132, pp. 115–130. [Google Scholar] [CrossRef]
- Katoh, K.; Rozewicki, J.; Yamada, K.D. MAFFT online service: Multiple sequence alignment, interactive sequence choice and visualization. Brief. Bioinform. 2019, 20, 1160–1166. [Google Scholar] [CrossRef] [PubMed]
- Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef]
- Vaidya, G.; Lohman, D.J.; Meier, R. SequenceMatrix: Concatenation software for the fast assembly of multi-gene datasets with character set and codon information. Cladistics 2011, 27, 171–180. [Google Scholar] [CrossRef] [PubMed]
- Darriba, D.; Posada, D.; Kozlov, A.M.; Stamatakis, A.; Morel, B.; Flouri, T. ModelTest-NG: A New and Scalable Tool for the Selection of DNA and Protein Evolutionary Models. Mol. Biol. Evol. 2020, 37, 291–294. [Google Scholar] [CrossRef] [PubMed]
- Stamatakis, A. RAxML version 8: A tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics 2014, 30, 1312–1313. [Google Scholar] [CrossRef] [PubMed]
- Ronquist, F.; Teslenko, M.; van der Mark, P.; Ayres, D.L.; Darling, A.; Höhna, S.; Larget, B.; Liu, L.; Suchard, M.A.; Huelsenbeck, J.P. MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Syst. Biol. 2012, 61, 539–542. [Google Scholar] [CrossRef] [PubMed]
- Miller, M.A.; Pfeiffer, W.; Schwartz, T. Creating the CIPRES Science Gateway for inference of large phylogenetic trees. In Gateway Computing Environments Workshop; IEEE: New Orleans, LA, USA, 2010; pp. 1–8. [Google Scholar] [CrossRef]
- Rambaut, A. FigTree v1.4.0; University of Oxford: Oxford, UK, 2012; Available online: http://tree.bio.ed.ac.uk/software/figtree (accessed on 10 June 2024).
- Fawcett, H.S.; Burger, O.F. A gum-inducing Diplodia of peach and orange. Mycologia 1911, 3, 151–153. [Google Scholar] [CrossRef]
- Feder, W.A.; Hutchins, P.C. Twig gumming and dieback of the ‘Robinson’ tangerine. Plant Dis. Rep. 1966, 50, 429–430. [Google Scholar]
- Mayorquin, J.S.; Wang, D.H.; Twizeyimana, M.; Eskalen, A. Identification, distribution, and pathogenicity of Diatrypaceae and Botryosphaeriaceae associated with citrus branch canker in the southern California desert. Plant Dis. 2016, 100, 2402–2413. [Google Scholar] [CrossRef]
- Davis, R.M.; Farrald, C.J.; Davila, D. Botryodiplodia trunk lesions in Texas citrus. Plant Dis. 1987, 71, 848–849. [Google Scholar] [CrossRef]
- Chen, J.; Zhu, Z.; Fu, Y.; Cheng, J.; Xie, J.; Lin, Y. Identification of Lasiodiplodia pseudotheobromae Causing Fruit Rot of Citrus in China. Plants 2021, 10, 202. [Google Scholar] [CrossRef]
- Ahmed, M.Z.; Shafique, M.S.; Anwaar, H.A.; Sarfraz, S.; Tufail, M.R.; Fayyaz, A.; Muntaha, S.; Haque, K.; Ghuffar, S.; Amrao, L. First report of Lasiodiplodia pseudotheobromae causing trunk cankers in Citrus reticulata in Pakistan. Plant Dis. 2020, 104, 2522. [Google Scholar] [CrossRef]
- Awan, Q.N.; Akgul, D.S.; Unal, G. First report of Lasiodiplodia pseudotheobromae causing postharvest fruit rot of lemon in Turkey. Plant Dis. 2016, 100, 2327. [Google Scholar] [CrossRef]
- Mohali, S.; Burgess, T.; Wingfield, M.J. Diversity and host association of the tropical tree endophyte Lasiodiplodia theobromae revealed using simple sequence repeat markers. For. Pathol. 2005, 35, 385–396. [Google Scholar] [CrossRef]
- Guajardo, J.; Riquelme, N.; Tapia, L.; Larach, A.; Torres, C.; Camps, R.; Besoain., X. First Report of Lasiodiplodia theobromae Causing Bot Gummosis in Citrus limon in Chile. Plant Dis. 2018, 102, 818. [Google Scholar] [CrossRef]
- Luo, M.; Dong, Z.Y.; Bin, S.Y.; Lin, J.T. First Report of Fruit Rot Disease on Pomelo Caused by Lasiodiplodia theobromae in China. Plan Dis. 2011, 95, 1190. [Google Scholar] [CrossRef]
- Pereira-Bezerra, J.D.; Crous, P.W.; Aiello, D.; Gullino, M.L.; Polizzi, G.; Guarnaccia, V. Genetic Diversity and Pathogenicity of Botryosphaeriaceae Species Associated with Symptomatic Citrus Plants in Europe. Plants 2021, 10, 492. [Google Scholar] [CrossRef]
- Flores-Hernández, H.; Flores-Gracia, J.; Varela-Fuentes, S.E.; Pérez-Rodríguez, A.; Azuara-Domínguez, A.; Monteon-Ojeda, A. Report of Lasiodiplodia theobromae (Pat.) Griffon and Maubl. in citrus trees in Tamaulipas. Rev. Mex. Cienc. Agríc. 2021, 12, 499–511. [Google Scholar] [CrossRef]
- Ferrari, F.D.; Ochoa, C.F.M.; Subero, M.L.J. Dieback and gummosis induced by Lasiodiplodia theobromae (Pat.) Griffon and Maubl. on three citrus tree species. An. Bot. Agric. 1996, 3, 46–49. [Google Scholar]
- Fayyaz, A.; Bonello, P.; Tufail, M.R.; Amrao, L.; Habib, A.; Gai, Y.; Sahi, S.T. First Report of Citrus Withertip (Tip Dieback), a Disease Complex Caused by Colletotrichum siamense and Lasiodiplodia iraniensis, on Citrus reticulata cv. Kinnow in Punjab, Pakistan. Plant Dis. 2018, 102, 2659. [Google Scholar] [CrossRef]
- Ruban, V.V.; Kaliamurthy, J.; Dineshkumar, M.; Jesudasan, C.A.N.; Geraldine, P.; Thomas, P.A. Keratitis Due to the Wood Saprobic Ascomycete, Auerswaldia lignicola (Family Botryosphaeriaceae), in a Carpenter in India. Mycopathologia 2013, 176, 463–466. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Lin, S.; Zhao, L.; Sun, X.; He, W.; Zhang, Y.; Dai, Y.C. Lasiodiplodia spp. associated with Aquilaria crassna in Laos. Mycol. Prog. 2019, 18, 683–701. [Google Scholar] [CrossRef]
- Karani, S.; Njuguna, J.; Runo, S.; Muchugi, A.; Machua, J.; Mwaniki, P. Molecular and morphological identification of fungi causing canker and dieback diseases on Vangueria infausta (Burch) subsp. rotundata (Robyns) and Berchemia discolor (Klotzsch) Hemsl in lower Eastern Kenya. Afr. J. Biotechnol. 2022, 21, 6–15. [Google Scholar] [CrossRef]
- Rodríguez-Gálvez, E.; Guerrero, P.; Barradas, C.; Crous, P.W.; Alves, A. Phylogeny and pathogenicity of Lasiodiplodia species associated with dieback of mango in Peru. Fungal Biol. 2017, 121, 452–465. [Google Scholar] [CrossRef] [PubMed]
- Douanla-Meli, C.; Scharnhorst, A. Palm Foliage as Pathways of Pathogenic Botryosphaeriaceae Fungi and Host of New Lasiodiplodia Species from Mexico. Pathogens 2021, 10, 1297. [Google Scholar] [CrossRef]
- Cracraft, J. Species Concepts and Speciation Analysis. In Current Ornithology; Johnston, R.F., Ed.; Springer: New York, NY, USA, 1983; Volume 1, pp. 159–187. [Google Scholar] [CrossRef]
- Chen, S.F.; Fichtner, E.; Morgan, D.P.; Michailides, T.J. First Report of Lasiodiplodia citricola and Neoscytalidium dimidiatum Causing Death of Graft Union of English Walnut in California. Plant Dis. 2013, 97, 993. [Google Scholar] [CrossRef]
- Chen, S.F.; Morgan, D.P.; Hasey, J.K.; Michailides, T.J. First report of Lasiodiplodia citricola associated with stem canker of peach in California, USA. J. Plant Pathol. 2013, 95, 659. [Google Scholar] [CrossRef]
- Costanzo, M.B.; Gusella, G.; Fiorenza, A.; Leonardi, G.R.; Aiello, D.; Polizzi, G. Lasiodiplodia citricola, a new causal agent of Acacia spp. dieback. New Dis. Rep. 2022, 45, e12094. [Google Scholar] [CrossRef]
- Fiorenza, A.; Gusella, G.; Vecchio, L.; Aiello, D.; Polizzi, G. Diversity of Botryosphaeriaceae species associated with canker and dieback of avocado (Persea americana) in Italy. Phytopathol. Medit. 2023, 62, 47–63. [Google Scholar] [CrossRef]
- Valle-de la Paz, M.; Guillén-Sánchez, D.; Gijón-Hernández, A.R.; Alía-Tecal, I.; López-Martínez, V.; Juárez-López, P.; Martínez-Fernández, E.; Hernández-Arenas, M.; Ariza-Flores, R. Species of Lasiodiplodia in lima ‘Persa’ (Citrus latifolia Tanaka) in Morelos, México. Rev. Bio Cienc. 2019, 6, e595. [Google Scholar] [CrossRef]
Locus | Primer | Sequence | Reference |
---|---|---|---|
Internal transcribed spacer (ITS) | ITS5 | GGAAGTAAAAGTCGTAACAAGG | [30] |
ITS4 | TCCTCCGCTTATTGATATGC | ||
β-tubulin (tub2) | Bt2a | GGTAACCAAATCGGTGCTGCTTTC | [31] |
Bt2b | ACCCTCAGTGTAGTGACCCTTGGC | ||
Translation elongation factor 1-alpha (tef1-α) | EF1-688F | CGGTCACTTGATCTACAAGTGC | [32] |
EF1-1251R | CCTCGAACTCACCAGTACCG | [33] | |
RNA polymerase II second largest subunit (rpb2) | RPB2-5F | GAYGAYMGWGATCAYTTYGG | |
RPB2-7cR | CCCATRGCTTGYTTRCCCAT |
Species | Strain | Host | Location | GenBank Accession Number | |||
---|---|---|---|---|---|---|---|
ITS | tef1-α | tub2 | rpb2 | ||||
Lasiodiplodia acaciae | CBS 136434 T | Acacia sp. | Indonesia | MT587421 | MT592133 | MT592613 | MT592307 |
L. aquilariae | CGMCC 3.18471 T | Aquilaria crassna | Laos | KY783442 | KY848600 | N/A | KY848562 |
L. avicenniae | CMW 41467 T | Avicennia marina | South Africa | KP860835 | KP860680 | KP860758 | KU587878 |
L. avicenniae | CBS 139670 | Avicennia marina | South Africa | KU587957 | KU587947 | KU587868 | KU587880 |
L. brasiliensis | CMM 4015 T | Mangifera indica | Brazil | JX464063 | JX464049 | N/A | N/A |
L. brasiliensis | CMM 4469 | Anacardium occidentale | Brazil | KT325574 | KT325580 | N/A | N/A |
L. bruguierae | CMW 41470 T | Bruguiera gymnorrhiza | South Africa | KP860832 | KP860677 | KP860755 | KU587875 |
L. bruguierae | CMW 42480 | Bruguiera gymnorrhiza | South Africa | KP860834 | KP860679 | KP860757 | KU587876 |
L. chiangraiensis | MFLUCC21- 0003 T | Unknown host | Thailand | MW760854 | MW815630 | MW815628 | N/A |
L. chiangraiensis | GZCC21- 0003 | Unknown host | Thailand | MW760853 | MW815629 | MW815627 | N/A |
L. cinnamomi | CFCC 51997 T | Cinnamomum camphora | China | MG866028 | MH236799 | MH236797 | MH236801 |
L. cinnamomi | CFCC 51998 | Cinnamomum camphora | China | MG866029 | MH236800 | MH236798 | MH236802 |
L. citricola | CBS 124707 T | Citrus sp. | Iran | GU945354 | GU945340 | KU887505 | KU696351 |
L. citricola | CBS 124706 | Citrus sp. | Iran | GU945353 | GU945339 | KU887504 | KU696350 |
L. citricola | UACH262 | Citrus latifolia | Mexico | MH277948 | MH286541 | MH279934 | N/A |
L. crassispora | CBS 118741 T | Santalum album | Australia | DQ103550 | DQ103557 | KU887506 | KU696353 |
L. crassispora | CMW 13488 | Eucalyptus urophylla | Venezuela | DQ103552 | DQ103559 | KU887507 | KU696352 |
L. euphorbiaceicola | CMM 3609 T | Jatropha curcas | Brazil | KF234543 | KF226689 | KF254926 | N/A |
L. euphorbiaceicola | CMW 33268 | Adansonia sp. | Senegal | KU887131 | KU887008 | KU887430 | KU887367 |
L. gilanensis | IRAN1523 CT | Citrus sp. | Iran | GU945351 | GU945342 | KU887511 | KP872462 |
L. gilanensis | IRAN1501C | Citrus sp. | Iran | GU945352 | GU945341 | KU887510 | KP872463 |
L. gonubiensis | CMW 14077 T | Syzygium cordatum | South Africa | AY639595 | DQ103566 | DQ458860 | N/A |
L. gonubiensis | CMW 14078 | Syzygium cordatum | South Africa | AY639594 | DQ103567 | EU673126 | N/A |
L. gravistriata | CMM 4564 T | Anacardium humile | Brazil | KT250949 | KT250950 | N/A | N/A |
L. gravistriata | CMM 4565 | Anacardium humile | Brazil | KT250947 | KT266812 | N/A | N/A |
L. hormozganensis | IRAN1500CT | Olea sp. | Iran | GU945355 | GU945343 | KU887515 | KP872466 |
L. hormozganensis | IRAN1498C | Mangifera indica | Iran | GU945356 | GU945344 | KU887514 | KP872467 |
L. iraniensis | IRAN1520CT | Salvadora persica | Iran | GU945348 | GU945336 | KU887516 | KP872468 |
L. iraniensis | IRAN1502C | Juglans sp. | Iran | GU945347 | GU945335 | KU887517 | KP872469 |
L. iraniensis | CMM 3610 | Jatropha curcas | Brazil | KF234544 | KF226690 | KF254927 | N/A |
L. iraniensis | IXBLT 14 | Citrus latifolia | Mexico | PP778685 | PP779539 | PP769242 | PP784203 |
L. iraniensis | IXBLT 16 | Citrus latifolia | Mexico | PP778687 | PP779541 | PP769244 | PP784205 |
L. laeliocattleyae | CBS 130992 T | Mangifera indica | Egypt | NR_120002 | KU507454 | KU887508 | KU696354 |
L. laeliocattleyae | BOT 29 | Mangifera indica | Egypt | JN814401 | JN814428 | N/A | N/A |
L. lignicola | CBS 134112 T | Dead wood | Thailand | JX646797 | KU887003 | KT852958 | KU696364 |
L. lignicola | CGMCC 3.18061 | Woody branch | China | NR_152983 | KX499927 | KX500002 | KX499965 |
L. lignicola | IXBLT 3 | Citrus latifolia | Mexico | PP778677 | PP779531 | PP769234 | PP784195 |
L. macrospora | CMM 3833 T | Jatropha curcas | Brazil | NR_147349 | KF226718 | KF254941 | N/A |
L. mahajangana | CMW 27801 T | Terminalia catappa | Madagascar | NR_147325 | FJ900641 | FJ900630 | N/A |
L. mahajangana | CGMCC 3.18456 | Aquilaria crassna | Laos | KY783437 | KY848596 | KY848529 | KY848557 |
L. margaritacea | CBS 122519 T | Adansonia gibbosa | Australia | KT852959 | EU144065 | KU887520 | KU696367 |
L. mediterranea | CBS 137783 T | Quercus ilex | Italy | KJ638312 | KJ638331 | KU887521 | KU696368 |
L. mediterranea | CBS 137784 | Vitis vinifera | Italy | KJ638311 | KJ638330 | KU887522 | KU696369 |
L. mexicanensis | DSM 112342 T | Chamaedorea seifrizii | Mexico | MW274151 | MW604234 | MW604243 | MW604222 |
L. mexicanensis | AGQMy0015 | Chamaedorea seifrizii | Mexico | MW274150 | MW604233 | MW6042423 | MW604221 |
L. mexicanensis | LACAM1 | Mangifera indica | Peru | KU507469 | KU507436 | N/A | N/A |
L. mexicanensis | IXBLT 15 | Citrus latifolia | Mexico | PP778686 | PP779540 | PP769243 | PP784204 |
L. microconidia | CGMCC 3.18485 T | Aquilaria crassna | Laos | KY783441 | KY848614 | N/A | KY848561 |
L. parva | CBS 456.78 T | cassava-field soil | Colombia | EF622083 | EF622063 | KU887523 | KP872477 |
L. parva | CBS 494.78 | cassava-field soil | Colombia | EF622084 | EF622064 | EU673114 | KU696373 |
L. plurivora | STE-U 5803 T | Prunus salicina | South Africa | EF445362 | EF445395 | KP872421 | KP872479 |
L. plurivora | STE-U 4583 | Vitis vinifera | South Africa | AY343482 | EF445396 | KU887525 | KU696375 |
L. pontae | CMM 1277 T | Spondias purpurea | Brazil | KT151794 | KT151791 | KT151797 | N/A |
L. pseudotheobromae | CBS 116459 T | Gmelina arborea | Costa Rica | EF622077 | EF622057 | EU673111 | KU696376 |
L. pseudotheobromae | GXJG4.5 | Macadamia integrifolia | China | MH487656 | MH487655 | MH487654 | N/A |
L. pseudotheobromae | MFLU22-0283 | Panicum sp. | Thailand | OQ123587 | OQ509114 | OQ509083 | N/A |
L. pseudotheobromae | IXBLT 4 | Citrus latifolia | Mexico | PP778678 | PP779532 | PP769235 | PP784196 |
L. pseudotheobromae | IXBLT 5 | Citrus latifolia | Mexico | PP778679 | PP779533 | PP769236 | PP784197 |
L. pseudotheobromae | IXBLT 6 | Citrus latifolia | Mexico | PP778680 | PP779534 | PP769237 | PP784198 |
L. pseudotheobromae | IXBLT 12 | Citrus latifolia | Mexico | PP778684 | PP779538 | PP769241 | PP784202 |
L. pseudotheobromae | IXBLT 18 | Citrus latifolia | Mexico | PP778688 | PP779542 | PP769245 | PP784206 |
L. rubropurpurea | WAC 12535 T | Eucalyptus grandis | Australia | DQ103553 | DQ103571 | EU673136 | KP872485 |
L. rubropurpurea | WAC 12536 | Eucalyptus grandis | Australia | DQ103554 | DQ103572 | KU887530 | KP872486 |
L. subglobosa | CMM3872 T | Jatropha curcas | Brazil | KF234558 | KF226721 | KF254942 | N/A |
L. subglobosa | CMM 4046 | Jatropha curcas | Brazil | KF234560 | KF226723 | KF254944 | N/A |
L. syzygii | MFLUCC 19-0257 T | Syzygium samarangense | Thailand | MT990531 | MW016943 | MW014331 | N/A |
L. thailandica | CGMCC 3.17975 T | Acacia confusa | China | KX499879 | KX499917 | KX499992 | KX499955 |
L. thailandica | MFLUCC 18-0244 | Swietenia mahagoni | Thailand | MK347789 | MK340870 | MK412877 | N/A |
L. theobromae | CBS 164.96 T | Fruit along coral reef coast | Papua New Guinea | AY640255 | AY640258 | KU887532 | KU696383 |
L. theobromae | CBS 111530 | Leucospermum sp. | USA | EF622074 | EF622054 | KU887531 | KU696382 |
L. theobromae | MFLU22-0290 | Artocarpus heterophyllus | Thailand | OQ123594 | OQ509109 | OQ509088 | OQ509080 |
L. theobromae | IXBLT 7 | Citrus latifolia | Mexico | PP778681 | PP779535 | PP769238 | PP784199 |
L. theobromae | IXBLT 9 | Citrus latifolia | Mexico | PP778682 | PP779536 | PP769239 | PP784200 |
L. theobromae | IXBLT 10 | Citrus latifolia | Mexico | PP778683 | PP779537 | PP769240 | PP784201 |
L. tropica | CGMCC3.18477 T | Aquilaria crassna | Laos | KY783454 | KY848616 | KY848540 | KY848574 |
L. venezuelensis | WAC 12539 T | Acacia mangium | Venezuela | DQ103547 | DQ103568 | KU887533 | KP872490 |
L. venezuelensis | WAC 12540 | Acacia mangium | Venezuela | DQ103548 | DQ103569 | KU887534 | KP872491 |
L. viticola | CBS 128313 T | Vitis vinifera | USA | HQ288227 | HQ288269 | HQ288306 | KU696385 |
L. viticola | UCD 2604MO | Vitis vinifera | USA | HQ288228 | HQ288270 | HQ288307 | KP872493 |
L. vitis | CBS: 124060 T | Vitis vinifera | Italy | KX464148 | KX464642 | KX464917 | KX463994 |
Diplodia seriata | CBS 112555 T | Vitis vinifera | Portugal | AY259094 | AY573220 | DQ458856 | KX463962 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Santillán-Mendoza, R.; Estrella-Maldonado, H.; Marín-Oluarte, L.; Matilde-Hernández, C.; Rodríguez-Alvarado, G.; Fernández-Pavía, S.P.; Flores-de la Rosa, F.R. Phylogenetic and Pathogenic Evidence Reveals Novel Host–Pathogen Interactions between Species of Lasiodiplodia and Citrus latifolia Dieback Disease in Southern Mexico. J. Fungi 2024, 10, 484. https://doi.org/10.3390/jof10070484
Santillán-Mendoza R, Estrella-Maldonado H, Marín-Oluarte L, Matilde-Hernández C, Rodríguez-Alvarado G, Fernández-Pavía SP, Flores-de la Rosa FR. Phylogenetic and Pathogenic Evidence Reveals Novel Host–Pathogen Interactions between Species of Lasiodiplodia and Citrus latifolia Dieback Disease in Southern Mexico. Journal of Fungi. 2024; 10(7):484. https://doi.org/10.3390/jof10070484
Chicago/Turabian StyleSantillán-Mendoza, Ricardo, Humberto Estrella-Maldonado, Lucero Marín-Oluarte, Cristian Matilde-Hernández, Gerardo Rodríguez-Alvarado, Sylvia P. Fernández-Pavía, and Felipe R. Flores-de la Rosa. 2024. "Phylogenetic and Pathogenic Evidence Reveals Novel Host–Pathogen Interactions between Species of Lasiodiplodia and Citrus latifolia Dieback Disease in Southern Mexico" Journal of Fungi 10, no. 7: 484. https://doi.org/10.3390/jof10070484
APA StyleSantillán-Mendoza, R., Estrella-Maldonado, H., Marín-Oluarte, L., Matilde-Hernández, C., Rodríguez-Alvarado, G., Fernández-Pavía, S. P., & Flores-de la Rosa, F. R. (2024). Phylogenetic and Pathogenic Evidence Reveals Novel Host–Pathogen Interactions between Species of Lasiodiplodia and Citrus latifolia Dieback Disease in Southern Mexico. Journal of Fungi, 10(7), 484. https://doi.org/10.3390/jof10070484