Next Article in Journal
Temporal Dynamics of Airborne Concentrations of Ganoderma Basidiospores and Their Relationship with Environmental Conditions in Oil Palm (Elaeis guineensis)
Previous Article in Journal
Development of a Shuttle Vector That Transforms at High Frequency for the Emerging Human Fungal Pathogen: Candida auris
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

CfHMG Differentially Regulates the Sexual Development and Pathogenicity of Colletotrichum fructicola Plus and Minus Strains

by
Wei Zhang
1,†,
Wenkui Liu
1,†,
Xiaofei Liang
1,*,
Rong Zhang
1,
Mark L. Gleason
2 and
Guangyu Sun
1,*
1
State Key Laboratory of Crop Stress Biology in Arid Areas and College of Plant Protection, Northwest A&F University, Yangling 712100, China
2
Department of Plant Pathology and Microbiology, Iowa State University, Ames, IA 50011, USA
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
J. Fungi 2024, 10(7), 478; https://doi.org/10.3390/jof10070478
Submission received: 22 May 2024 / Revised: 27 June 2024 / Accepted: 9 July 2024 / Published: 11 July 2024

Abstract

Colletotrichum fructicola shows morphological and genetic differences in plus and minus strains. However, the mechanism of the differentiation between two types of strains is still largely unclear. Our early transcriptome analysis revealed that CfHMG expression differed in plus and minus strains. To define the functions of the CfHMG gene, we constructed gene deletion mutants by homologous recombination. We found that a CfHMG deletion mutant of the minus strain, CfHMG-M, could lead to a reduction in perithecium sizes and densities on media and sterile perithecium formation compared with the minus wild type (WT), whereas there was no effect for the plus mutant CfHMG-P. In co-cultures between CfHMG-P and minus WT, CfHMG-M and plus WT, or CfHMG-P and CfHMG-M, the quantities of perithecia were all reduced significantly. When conidial suspensions were inoculated on non-wounded apple fruit, it was found that the virulence of the minus mutant decreased significantly but not for the plus one. Further, we found that the virulence decrease in minus mutants was caused by a decrease in the conidium germination rate. Our results indicate that CfHMG of C. fructicola plays an important role in the mating line formation between the plus and minus strain for both strains and differentially regulates the perithecium size, density, fertilization, and virulence of the minus strain. The results are significant for further detecting the differentiated mechanisms between the plus and minus strains in Colletotrichum fungi.

1. Introduction

Colletotrichum species are among the 10 most damaging genera of fungal plant pathogens in the world [1,2]. Glomerella leaf spot (GLS) caused by Colletotrichum spp. is a devastating disease in apple (Malus × domestica), resulting in severe premature defoliation and fruit lesions [3]. GLS was first found in southeast USA [4]. Later, it was found in Brazil, China, Japan, and Uruguay [5,6,7,8]. Colletotrichum fructicola is the main pathogen of GLS in China, in addition to apple, Colletotrichum fructicola also damages many commercial crops, such as pear, strawberry, tea, rubber trees, and some ornamental plants [9,10,11,12,13].
Edgerton [14,15] differentiated the teleomorph of Colletotrichum into plus and minus types according to differences in morphology and sexual reproduction. The plus strain usually develops grey and livid colonies with thick and felty aerial mycelia, accompanied by aggregated masses of fertile perithecia with asci and ascospores. In contrast, the minus strains are black colonies with sparse aerial mycelia, sparse perithecia that produce a few or no asci. Plus and minus strains are sexually compatible each other. On artificial media, a mating line forms on the intersection of plus- and minus-strain co-culture colonies, along with abundant fertile perithecia. Dong et al. [16] found that there were plus and minus strains in C. fructicola. Kong et al. [17] found that the autophagy gene CfAtg8 of C. fructicola was differentially expressed in the plus and minus strains and that a C2H2-containing transcription factor Cfcpmd1 was also found related to plus and minus differentiation [18]. At present, however, the differentiation mechanism of plus and minus remains elusive.
High-mobility-group box (HMGB) proteins belong to the HMG superfamily, a large group of transcription factors, which is divided into the UBF_HMG and SOX/TCF/MATA_HMG family [19]. The MATA_HMG subfamily encodes proteins relevant to fungi that are important to regulate differentiation and the sexual process. Most of the genes in this subfamily are located in the mating type locus and act as mating genes, whereas others are located outside of the mating type gene cluster [20].
In our previous whole genomics and transcriptome analysis, a MATA_HMG protein, CfHMG, was found to be expressed differently in the plus and minus strains of C. fructicola [21]. In the present study, we found that CfHMG differentially regulated the pathogenicity, sexual reproduction, and mating in plus and minus strains of this fungus and clarified the mechanism of the differentiation of plus–minus phenotypes.

2. Materials and Methods

2.1. Fungal Strains, Media, Culture Conditions

Wild-type 1104-4 (plus) and 1104-6 (minus) strains of Colletotrichum fructicola Prihastuti, L. Cai & K.D. Hyde from apple leaves with GLS were stored in the laboratory of the Fungal Research Laboratory of NWAFU, Yangling, China. Cultures were grown on potato dextrose agar (PDA) or oatmeal agar (OA) at 25 °C. For mating line formation or cross-fertility tests, both strains were co-cultured on OA media [22]. The mycelial plugs of strains were preserved in 15% glycerol at −80 °C for long-time storage. The mycelial plugs of strains were preserved in 15% glycerol at −80 °C for long-term storage. To obtain conidia, three mycelial plugs with a diameter of 6 mm were placed in 60 mL of potato dextrose broth (PDB) to produce conidia with shaking at 180 rpm at 25 °C for 4 d, after which the culture liquids were filtered by three layers of sterile MiraCloth (EMD Millipore Corporation, Burlington, MA, USA). The filtrate was centrifuged for 3 min at 10,000 rpm and 4 °C, and then, the supernatant was discarded.

2.2. Sequence Analysis, Deletion, and Complementation of CfHMG

The CfHMG gene sequence was obtained from C. fructicola 1104-7 genome (GenBank Accession No. MVNS00000000.2). CfHMG homolog animo acid sequences in fungal species from Colletotrichum spp. and other species were searched by the blastp program on NCBI. DNAman 6.0 and MEGA 7.0 were used for sequence alignment and phylogenetic analysis.
Genomic DNA (gDNA) of aerial hyphae was extracted by the cetyltrimethylammonium bromide (CTAB) method, and the CfHMG deletion mutants were generated using a split-marker approach [23]. The upstream and downstream flanking sequences of CfHMG were amplified with primers CfHMG-LFup/CfHMG-LRup and CfHMG-RFDown/CfHMG-RRDown from gDNA. The gene replacement cassette was constructed by connecting upstream and downstream flanking sequences with hygromycin resistance gene. Primers CfHMG-LF/HyR and NYGF/CfHMG-RR were used to amplify two split-marker-based gene replacement constructs. The final PCR products were purified and transformed to the wild-type strains by PEG-mediated protoplast transformation [24]. To confirm the gene deletion strains, three pairs of primers were used to detect wild types and CfHMG gene deletion mutants. The fragments of upstream and downstream amplified by LF/Xu855R and Xu866F/RR were only observed in the CfHMG deletion mutants. In addition, a fragment amplified by DF/DR at the ORF region of the CfHMG gene in WT strain was missing in CfHMG deletion mutants (Table A1).
To complement CfHMG-deletion strains, recombinant pHZ-100-CfHMG was brought into protoplasts of mutant strains ΔCfHMG-P and ΔCfHMG-M. Complementation strains were identified from G418-resistant transformants using PCR.

2.3. Tests for the Perithecium Development and Mating Line Formation between Plus and Minus Strains

For analyzing the gene functions of CfHMG in sexual development, isolates of wild types and mutants were tested for both self-fertility and cross fertility in all possible co-culture combinations on OA media.
For self-fertility tests, 5 mm diameter plugs taken from a 3-day-old PDA colony were transferred to OA and cultured for a further 7 d at 25 °C in darkness. For WT of minus strains, mutant ΔCfHMG-M, and complement strain ΔCfHMG-MC, OA plugs with perithecia were examined microscopically after 7 d to estimate the time to formation as well as the density and the size of perithecia. More than 100 perithecia were measured. Meanwhile, for WT of plus strains, mutant ΔCfHMG-P, and complement strain ΔCfHMG-PC, the number of perithecia per cluster in each plate of diameter 9 cm were counted after 7 dpi, and their diameters were measured. For cross-fertility-tested strains, OA medium plugs from cross lines were sampled after 2 dpi of contact between different strains for the microscopical examination of perithecia.

2.4. Pathogenicity Assays

To analyze the ability to colonize apple fruit, conidial suspensions (20 μL) of deletion mutant strains and their associated wild-type strains were inoculated in the non-wounded fruit of Malus domestica Borkh. cv. Gala. To clearly see the lesions on the infected fruit, the bagged mature apple fruit in yellow were used. Conidial suspension was prepared with shaken cultures in PDB medium at 25 °C and then adjusted to a concentration of 5 × 105 conidia/mL in sterile distilled water. Apple fruit surfaces were sterilized by rubbing with 70% ethanol, followed by wiping with sterile distilled water. The fruits were sprayed with the conidial suspensions and then incubated at 25 °C in a moisture chamber. Photos were taken, and the diameter of each lesion was measured after 6 d. Three fruits were used per strain in each run of the assay. All inoculations were conducted at least three times independently using all the wild-type strains and CfHMG mutant strains, and similar results were obtained.

2.5. Measurements of Conidial Germination, Appressorium Formation

To estimate the rate of appressorium formation and the development of infection hyphae, conidial suspensions of each strain were spread on cellophane appressed to the surface of water–agar medium and incubated at 25 °C in darkness. Amounts of appressoria formation and infection hyphae were assessed at 12 and 16 h, respectively.

3. Results

3.1. CfHMG Encoded a Novel MATA_HMG Protein

The CfHMG was found to be a single-copy gene in C. fructicola (both plus and minus strain) genome based on a local blast search. Sequence analysis revealed that CfHMG carried an open reading frame (ORF) of 2151 bp containing two exons and one intron. The gene encoded a putative HMG protein of 682 amino acids containing a highly conserved high-mobility-group box. The sequence homolog bast of CfHMG showed that there was very high aa identity in the Colletotrichum (the identity > 67.5%) and higher similarity in Gloeosporioides section (the identity > 96.5%). All Colletotrichum spp. were clustered in a clade in the phylogenetic tree of whole CfHMG aa sequences of Colletotrichum spp. and related genera (Figure 1A). A further aa sequence comparison of the HMG motif showed that it was conserved in Colletotrichum spp. (100% identity) and with high similarity with Fusarium oxysporium, Verticillium longisporium, Hypoxylon fuscum, etc. However, there were lower sequence similarities with Mat 1-2-1 and other function-known proteins, including Saccharomyces cerevisiae Rox, Candida albicans Rfg, Podospora anserina PaHMG5, and Schizosacharomyces pombe Ste11 (Figure 1B).

3.2. Generating Gene Deletion and Complementation Mutants of CfHMG

For the functional characterization of CfHMG, we generated gene deletion mutants by a PEG-mediated transformation of the gene replacement cassette to the plus and minus wild-type strains (Figure 2A). Putative deletion strains were identified by PCR amplification with different primers (Table A1). We obtained mutant ΔCfHMG-P from plus wild type WT(P) and mutant ΔCfHMG-M from minus wild type WT(M). Each deletion mutant was purified by the single spore purification procedure. In the meantime, we obtained complementation strains ΔCfHMG-PC and ΔCfHMG-MC. To test the function of CfHMG in hyphal growth, we observed colony morphology and growth rate on PDA. The mutants showed similar growth rates to wild types, and no obvious difference was observed in colony morphology between wild types and mutants (Figure 2B).

3.3. CfHMG Affected the Development and Fertility of Perithecium in the Minus Strain

To illustrate the function of CfHMG in sexual reproduction, the strains were cultured on OA media, and the perithecium amount, size, and fertility were observed. The results showed that WT(M) produced abundant, scattered, dark black perithecia; among them, about 10% perithecia could produce asci and ascospores (Figure 3A–D). In contrast, the perithecia of the knockout mutant ΔCfHMG-M had an average diameter 45.1 ± 6.4 μm, which was much smaller than that in WT(M) (70.9 1 ± 7.1 1 μm) (Figure 3A,B). In addition, we found that the deletion of CfHMG caused a sharp increase in the density of perithecia when compared with WT(M) (Figure 3A,C), and no ascus and ascospore was found in mutants (Figure 3A,D).
For the wild plus strain WT(P), deletion of CfHMG mutant, and complement mutant ΔCfHMG-PC, all strains could produce perithecial cluster and fertile perithecia (Figure 4), implying that CfHMG did not affect the sexual reproduction structure and the fertility for the plus strain, which was different from that in the minus strain.

3.4. CfHMG Is Involved in the Formation of Mating Line for Both Plus and Minus Strains

To further analyze the functions of CfHMG in sexual reproduction, tests were arranged for cross-fertility in various combinations. For the WT(P) and WT(M) co-culture, a nigrescent line appeared in the contact area after contact for about 3 d, and a clear mating line appeared within 7 d. Lots of scattered or clumped perithecia formed on the line (Figure 5A). Compared with the wild strains, the number of perithecia on the mating line of ΔCfHMG-P × WT(M) co-culturing decreased 60.0%; for ΔCfHMG-M × WT(P) co-culturing, it decreased about 34.8%. For ΔCfHMG-P × ΔCfHMG-M, fewer perithecia formed, which decreased about 96.2% compared with the wild strains (Figure 5B). In addition, for the co-culturing of ΔCfHMG-P × ΔCfHMG-M, the average diameter of perithecia was 38.7 μm, which was smaller than the wild strains (62.0 μm) (Figure 5C). These results suggest that CfHMG could affect the mating line formation ability of both plus and minus strains.

3.5. CfHMG Deletion Reduces Virulence in Minus Strain

To investigate if CfHMG influences the virulence of C. fructicola, we assayed the pathogenicity of WT(P), WT(M), and relevant mutants on apple fruit. The results showed that the disease index of CfHMG-M reduced by approximately 25% compared with the wild mutant WT(M), and CfHMG-MC could restore most of the virulence which the deletion mutant lost, while there was no difference between WT(P) and their mutants (Figure 6). These results suggest that CfHMG played an important role in virulence in C. fructicola in the minus strain but not in the plus strain.
To further understand the reason for the CfHMG mutant losing virulence, the infection-related structures were observed on cellophane. It was found that the conidial germination rate of wild strain WT(M) was 82.7%, and the germination rate of ΔCfHMG-M was only 52.4%. Compared to WT(M), it decreased about 36.6% (Figure 7B), while for the plus strain, there was no significant difference between the wild and mutants, implying that CfHMG did not affect the conidium germination for the plus strain. In addition, there was almost no difference among the wild type and mutants in both plus strains or minus strains in rates of appressorium formation and penetration hypha. These results imply that the virulence reduction might be caused by a decrease in conidial germination rate in the minus strain.

4. Conclusions

In this study, we characterized the functions of an HMG-BOX transcription factor CfHMG in Colletotrichum fructicola by loss-of-function and gain-of-function analysis. We found that CfHMG could affect the sizes, densities on media, and fertility of perithecia for the minus strain, whereas there was no effect for the plus one. The co-culture of plus and minus strains assay showed that CfHMG played an important role in the mating line formation on media. It was also found that CfHMG deletion could reduce the virulence of the minus mutant but not of the plus one. Furthermore, the percentage of conidium germination was lower, implying that CfHMG regulates the virulence of the minus strain possibly by affecting its conidium germination.

5. Discussion

The differentiation of plus and minus strains was first described in Glomerella cingulata, the teleomorph of C. gloeosporioides [25]. In the recent classification system, former C. gloeosporioides was thought of as a species complex, and Gloeosporioides section. C. fructicola was identified as a unique species in this section [9,26]. Liang et al. [22] found that the expression levels of pheromone precursors and receptors in C. fructicola were different in the mycelia of two type strains and supposed this might be a reason for the differentiation of plus and minus strains. Kong et al. [17] found that the absence of autophagy gene CfAtg8 had different effects on the colony morphology and mating of plus and minus strains, indicating that this gene is an important regulator of the differentiation of plus and minus strains. In addition, the C2H2 transcription factor CfCpmd1 was also found to be involved in the regulation of plus and minus strain differentiation [18]. In our study, we found that CfHMG played an important role in differentially regulating perithecium development, crossing ability, and pathogenicity in C. fructicola plus and minus strains, implying that CfHMG is one of the key genes regulating differentiation in C. fructicola.
The MATA_HMG subfamily transcription factors that determine the sexual differentiation of fungi and regulate the sexual reproduction process occur widely among fungi. Some members of the MATA_HMG subfamily regulate differentiation and the sexual process directly, such as the most studied mating type gene MAT1-2-1. Phylogenetic analysis showed that CfHMG protein formed a monophyletic clade within the genus Colletotrichum and that these amino acid sequences were highly conserved, indicating that CfHMG orthologs in Colletotrichum may have similar functions. Phylogeny analysis and amino acid comparisons showed that CfHMG homology proteins share lower similarity with MAT1-2-1, even in the HMG-box motif region. Our genome annotation also found that CfHMG did not distribute in the mating type gene cluster, indicating CfHMG is different from MAT1-2-1.
In Schizosaccharomyces pombe, the fmf gene encodes a MATA_HMG-box protein SpSte11, which regulates the transcription of mating genes matP and matM through nuclear accumulation, thus regulating the sexual reproduction process [27,28]. In P. anserina, the PaHMG5 is a key activator of mating type genes and is located at the center of several HMG-box factor networks that regulate mating type genes and mating type target genes [29]. ROX1 in S. cerevisiae inhibits the expression of hypoxia genes [30]. In Candida albicans, Rfg1 controls filamentous growth in an environment-dependent manner and affects virulence in mice [31]. In our study, the knockout of CfHMG resulted in defective perithecia development, impaired virulence in the minus strain, and the possible recognition between the minus and plus strain. The amino acid comparisons of the HMG-box motif region showed that CfHMG shares lower homology with Rfg1, ROX1, Ste11, and PaHMG5. Our finding showed for the first time that CfHMG was a new functional protein different from the reported MATA_HMG-box proteins.
Conidial germination is critical for Colletotrichum fungi to infect hosts. Many factors affect the germination of conidia. Some genes affecting conidial germination of C. fructicola have also been found, such as ubiquitin-binding enzyme protein Chip1, vacuole-copper ion transporter CgCTR2 [32,33]. In our study, the deletion of CfHMG caused reduction in conidial germination and further decreased the virulence of the minus strain.
Differentiating plus and minus strains is a very important property of the Colletotrichum fungi. However, because both plus and minus strains can carry out the relatively less efficient sexual reproduction, the more efficient sexual reproduction occurs when plus and minus strains meet. Our research found CfHMG was related to the differentiation of plus and minus strains and differentially regulated the perithecium development, mating ability, and virulence of C. fructicola, providing valuable information for understanding the regulatory mechanisms of plus–minus differentiation. Considering the economic loss caused by Colletotrichum fungi and the high sequence conservation of CfHMG in Colletotrichum, CfHMG could be treated as a potential fungicidal target for designing novel fungicides in the future.

Author Contributions

Methodology, W.Z.; Validation, G.S.; Resources, G.S.; Writing—original draft, W.Z., W.L. and G.S.; Writing—review & editing, X.L., M.L.G. and R.Z. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China (32370049, 32070144), and the China Agriculture Research System (CARS-27).

Data Availability Statement

The data presented in this study are openly available in FigShare at https://doi.org/10.1094/MPMI-11-19-0316-A.

Conflicts of Interest

The authors declare no conflict of interest.

Appendix A

Table A1. Primers used in this study.
Table A1. Primers used in this study.
NameSequence
CfHMG-LFupCTCCCAGCCTAGACCACTTTC
CfHMG-RFDownTGACAGTTCTGGTTAGCCGTCACCAGTGTGCCATGTCAGGGCAAGTAAGA
CfHMG-RRDownTTGTTGTAGAACGGGCGGTAG
CfHMG-LFnestCATTCCAACCGACCTACTTGC
CfHMG-RRnestATCCTTGGATGGCGATGTAGC
CfHMG-DFGCCGCTCTAGAACTAGTGCTCCCAGCCTAGACCACTTTC
CfHMG-DRTTCCTGCAGCCCGGGGATCTCGGCCAAATCCCTCCTGGA
NHYGHSFAGTCGACGACAACTACCATCGATCTGACGGTCGACAGAAGATGATATTGAAGGA
HYRAGAGTTGGTCAAGACCAATGC
NYGFCGAAAAGTTCGACAGCGTCTC
NHYGHSRACACTGGTGACGGCTAACCAGAACTGTCAGAAGAGGTAAACCCGAAACGC
HYRNestGTATTGACCGATTCCTTGCGGTCCGAA
HYGHNestGATGTAGGAGGGCGTGGATATGTCCT
Xu855RGCTGATCTGACCAGTTGCCT
Xu866FGTCGATGCGACGCAATCGT
HYCGCCCTTCCTCCCTTTATTTC
YGTGTCGTCCATCACAGTTTGCC

References

  1. Cannon, P.F.; Damm, U.; Johnston, P.R.; Weir, B.S. Colletotrichum: Current status and future directions. Stud. Mycol. 2012, 73, 181–213. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Dean, R.; Van Kan, J.A.; Pretorius, Z.A.; Hammond-Kosack, K.E.; Di Pietro, A.; Spanu, P.D.; Rudd, J.J.; Dickman, M.; Kahmann, R.; Ellis, J.; et al. The top 10 fungal pathogens in molecular plant pathology. Mol. Plant Pathol. 2012, 13, 414–430. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Wang, W.; Fu, D.D.; Zhang, R.; Sun, G.Y. Etiology of apple leaf spot caused by Colletotrichum spp. Mycosystema 2015, 34, 13–25. [Google Scholar]
  4. Taylor, J. A necrotic leaf blotch and fruit rot of apple caused by a strain of Glomerella cingulata. Phytopathology 1971, 61, 221–224. [Google Scholar] [CrossRef] [Scilit]
  5. Leite, R.P.; Tsuneta, M.; Kishino, A.Y. Ocorréncia de mancha foliar de Glomerella em maicieira no estado do Paraná. Fundação Institito Agronômico do Paraná. Inf. Pesqui. 1988, 81. [Google Scholar]
  6. Wang, C.X.; Zhang, Z.F.; Li, B.H.; Wang, Y.; Dong, X.L. First report of Glomerella leaf spot of apple caused by Glomerella cingulata in China. Plant Dis. 2012, 96, 912. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  7. Yokosawa, S.; Eguchi, N.; Kondo, K.I.; Sato, T. Phylogenetic relationship and fungicide sensitivity of members of the Colletotrichum gloeosporioides species complex from apple. J. Gen. Plant Pathol. 2017, 83, 291–298. [Google Scholar] [CrossRef] [Scilit]
  8. Alaniz, S.; Hernandez, L.; Damasco, D.; Mondino, P. First report of Colletotrichum acutatum and C. fragariae causing bitter rot of apple in Uruguay. Plant Dis. 2012, 96, 458. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  9. Weir, B.S.; Johnston, P.R.; Damm, U. The Colletotrichum gloeosporioides species complex. Stud. Mycol. 2012, 73, 115–180. [Google Scholar] [CrossRef] [Scilit]
  10. Li, H.N.; Jiang, J.J.; Hong, N.; Wang, G.P.; Xu, W.X. First report of Colletotrichum fructicola causing bitter rot of pear (Pyrus bretschneideri) in China. Plant Dis. 2013, 97, 1000. [Google Scholar] [CrossRef] [Scilit]
  11. Lin, S.-R.; Yu, S.-Y.; Chang, T.-D.; Lin, Y.-J.; Wen, C.-J.; Lin, Y.-H. First report of anthracnose caused by Colletotrichum fructicola on tea in Taiwan. Plant Dis. 2021, 105, 710. [Google Scholar] [CrossRef] [Scilit]
  12. Gan, P.; Nakata, N.; Suzuki, T.; Shirasu, K. Markers to differentiate species of anthracnose fungi identify Colletotrichum fructicola as the predominant virulent species in strawberry plants in Chiba Prefecture of Japan. J. Gen. Plant Pathol. 2017, 83, 14–22. [Google Scholar] [CrossRef] [Scilit]
  13. Liu, X.; Li, B.; Cai, J.; Zheng, X.; Feng, Y.; Huang, G. Colletotrichum species causing anthracnose of rubber trees in China. Sci. Rep. 2018, 8, 10435. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Edgerton, C.W. Plus and minus strains in an ascomycetes (abstract). Science 1912, 35, 151. [Google Scholar]
  15. Edgerton, C.W. Plus and minus strains in the genus Glomerella. Am. J. Bot. 1914, 1, 244–254. [Google Scholar] [CrossRef] [Scilit]
  16. Dong, Q.Y.; Ling, X.F.; Zhang, W.; Sun, G.Y.; Zhang, R. Fluorescent labeling of Colletotrichum fructicola nuclei based on a reporter gene knock-in strategy. Mycosystema 2018, 37, 166–174. [Google Scholar]
  17. Kong, Y.Y.; Yuan, Y.L.; Liang, X.F.; Zhang, R.; Sun, G.Y. Function of CfAtg8 in regulating the differentiation of plus and minus strains of Colletotrichum fructicola. Mycosystema 2022, 41, 1174–1184. [Google Scholar]
  18. Kong, Y.; Yuan, Y.; Yang, M.; Lu, Y.; Liang, X.; Gleason, M.L.; Zhang, R.; Sun, G. CfCpmd1 regulates pathogenicity and sexual development of plus and minus strains in Colletotrichum fructicola causing Glomerella leaf spot on apple in China. Phytopathology 2023, 113, 1985–1993. [Google Scholar] [CrossRef] [Scilit]
  19. Soullier, S.; Jay, P.; Poulat, F.; Vanacker, J.-M.; Berta, P.; Laudet, V. Diversification pattern of the HMG and SOX family members during evolution. J. Mol. Evol. 1999, 48, 517–527. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  20. Lee, S.C.; Corradi, N.; Doan, S.; Dietrich, F.S.; Keeling, P.J.; Heitman, J. Evolution of the sex-related locus and genomic features shared in microsporidia and fungi. PLoS ONE 2010, 5, e10539. [Google Scholar] [CrossRef] [Scilit]
  21. Liang, X.; Cao, M.; Li, S.; Kong, Y.; Rollins, J.A.; Zhang, R.; Sun, G. Highly contiguous genome resource of Colletotrichum fructicola generated using long-read sequencing. MPMI 2020, 33, 790–793. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  22. Liang, X.F.; Yao, L.Q.; Hao, X.J.; Li, B.X.; Sun, G.Y. Molecular dissection of perithecial mating line development in Colletotrichum fructicola, a species with a nontypical mating system featured by plus-to-minus switch and plus-minus mediated sexual enhancement. Appl. Environ. Microbiol. 2021, 87, e00474-21. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Aragona, M.; Valente, M.T. Genetic transformation of the tomato pathogen Pyrenochaeta lycopersici allowed gene knockout using a split-marker approach. Curr. Genet. 2015, 61, 211–220. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Liang, X.; Wei, T.; Cao, M.; Zhang, X.; Liu, W.; Kong, Y.; Zhang, R.; Sun, G. The MAP kinase CfPMK1 is a key regulator of pathogenesis, development, and stress tolerance of Colletotrichum fructicola. Front. Microbiol. 2019, 10, 1070. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Edgerton, C.W. The physiology and development of some anthracnoses. Bot. Gaz. 1908, 45, 367–408. [Google Scholar] [CrossRef] [Scilit]
  26. Bhunjun, C.S.; Phukhamsakda, C.; Jayawardena, R.S.; Jeewon, R.; Promputtha, I.; Hyde, K.D. Investigating species boundaries in Colletotrichum. Fungal Divers. 2021, 107, 107–127. [Google Scholar] [CrossRef] [Scilit]
  27. Sugimoto, A.; Iino, Y.; Maeda, T.; Watanabe, Y.; Yamamoto, M. Schizosaccharomyces pombe ste11+ encodes a transcription factor with an HMG motif that is a critical regulator of sexual development. Genes Dev. 1991, 5, 1990–1999. [Google Scholar] [CrossRef] [Scilit]
  28. Qin, J.; Kang, W.; Leung, B.; McLeod, M. Ste11p, a high-mobility-group box DNA-binding protein, undergoes pheromone- and nutrient-regulated nuclear-cytoplasmic shuttling. Mol. Cell. Biol. 2003, 23, 3253–3264. [Google Scholar] [CrossRef] [Scilit]
  29. Benkhali, J.A.; Coppin, E.; Brun, S.; Peraza-Reyes, L.; Martin, T.; Dixelius, C.; Lazar, N.; van Tilbeurgh, H.; Debuchy, R. A network of HMG-box transcription factors regulates sexual cycle in the fungus Podospora anserina. PLoS Genet. 2013, 9, e1003642. [Google Scholar] [CrossRef] [Scilit]
  30. Kwast, K.E.; Burke, P.V.; Brown, K.; Poyton, R.O. REO1 and ROX1 are alleles of the same gene which encodes a transcriptional repressor of hypoxic genes in Saccharomyces cerevisiae. Curr. Genet. 1997, 32, 377–383. [Google Scholar] [CrossRef] [Scilit]
  31. Kadosh, D.; Johnson, A.D. Rfg1, a protein related to the Saccharomyces cerevisiae hypoxic regulator Rox1, controls filamentous growth and virulence in Candida albicans. Mol. Cell. Biol. 2001, 21, 2496–2505. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. Liu, Z.-M.; Kolattukudy, P.E. Identification of a gene product induced by hard-surface contact of Colletotrichum gloeosporioides conidia as a ubiquitin-conjugating enzyme by yeast complementation. J. Bacteriol. 1998, 180, 3592–3597. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  33. Barhoom, S.; Kupiec, M.; Zhao, X.; Xu, J.-R.; Sharon, A. Functional characterization of CgCTR2, a putative vacuole copper transporter that is involved in germination and pathogenicity in Colletotrichum gloeosporioides. Eukaryot. Cell 2008, 7, 1098–1108. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Figure 1. NJ phylogenetic tree of homolog proteins and sequence comparison of CfHMG among Colletotrichum and related genera. (A) Phylogenetic tree of CfHMG and its homolog proteins in Colletotrichum. Amino acid sequences were analyzed by MEGA 5 using a neighbor-joining bootstrap (1000 replicates). The scale bar corresponds to a genetic distance of 0.10. (B) Sequence comparison of the HMG box from CfHMG, MAT1-2-1, and function-known proteins. The alignment was performed using—ClustalX 2.1 and color scheme provided by Jalview 2.10.5.
Figure 1. NJ phylogenetic tree of homolog proteins and sequence comparison of CfHMG among Colletotrichum and related genera. (A) Phylogenetic tree of CfHMG and its homolog proteins in Colletotrichum. Amino acid sequences were analyzed by MEGA 5 using a neighbor-joining bootstrap (1000 replicates). The scale bar corresponds to a genetic distance of 0.10. (B) Sequence comparison of the HMG box from CfHMG, MAT1-2-1, and function-known proteins. The alignment was performed using—ClustalX 2.1 and color scheme provided by Jalview 2.10.5.
Jof 10 00478 g001
Figure 2. CfHMG deletion mutants showed no differences in vegetative growth and colony morphology for both plus and minus strains. (A) Strategy for generating the CfHMG gene deletion mutants. Black arrows represent primer, and black box (Hp, ph) are two split fragments of the hygromycin phosphotransferase gene. (B) Colony morphology of strains on potato dextrose agar for 7 d at 25 °C. (a): Plus wild type, mutant ΔCfHMG-P, and complementation ΔCfHMG-PC. (b): Minus wild type, mutant ΔCfHMG-M, and complementation ΔCfHMG-MC. (C) Growth rate comparison. The mean and standard deviation were calculated from three biological replicates. Different letters in (C) represent significant differences (p < 0.05) based on one-way ANOVA followed by post-hoc Tukey test.
Figure 2. CfHMG deletion mutants showed no differences in vegetative growth and colony morphology for both plus and minus strains. (A) Strategy for generating the CfHMG gene deletion mutants. Black arrows represent primer, and black box (Hp, ph) are two split fragments of the hygromycin phosphotransferase gene. (B) Colony morphology of strains on potato dextrose agar for 7 d at 25 °C. (a): Plus wild type, mutant ΔCfHMG-P, and complementation ΔCfHMG-PC. (b): Minus wild type, mutant ΔCfHMG-M, and complementation ΔCfHMG-MC. (C) Growth rate comparison. The mean and standard deviation were calculated from three biological replicates. Different letters in (C) represent significant differences (p < 0.05) based on one-way ANOVA followed by post-hoc Tukey test.
Jof 10 00478 g002
Figure 3. CfHMG deletion led to defects in the development of perithecia in minus strains on OA medium. (A) (a): Perithecium formation. Bar = 200 μm; (b): Perithecium size. Bar = 50 μm. (c). Crushed perithecia. Bar = 50 μm. (B) Average diameter comparison of perithecia. (C) The density comparison of perithecia. (D) The percentage of fertile perithecia. Different letters in (BD) represent significant differences (p < 0.05) based on one-way ANOVA followed by post-hoc Tukey test.
Figure 3. CfHMG deletion led to defects in the development of perithecia in minus strains on OA medium. (A) (a): Perithecium formation. Bar = 200 μm; (b): Perithecium size. Bar = 50 μm. (c). Crushed perithecia. Bar = 50 μm. (B) Average diameter comparison of perithecia. (C) The density comparison of perithecia. (D) The percentage of fertile perithecia. Different letters in (BD) represent significant differences (p < 0.05) based on one-way ANOVA followed by post-hoc Tukey test.
Jof 10 00478 g003
Figure 4. CfHMG deletion does not affect the development of perithecia in plus strains. (A) (a): Perithecial cluster. Bar = 50 μm. (b): Asci, ascospores, and perithecia. Bar = 50 μm. (B) Amount of perithecial cluster per plate. (C) Amount of perithecia per perithecial cluster. (D) Average diameter of perithecia. Different letters in (BD) represent significant differences (p < 0.05) based on one-way ANOVA followed by post-hoc Tukey test.
Figure 4. CfHMG deletion does not affect the development of perithecia in plus strains. (A) (a): Perithecial cluster. Bar = 50 μm. (b): Asci, ascospores, and perithecia. Bar = 50 μm. (B) Amount of perithecial cluster per plate. (C) Amount of perithecia per perithecial cluster. (D) Average diameter of perithecia. Different letters in (BD) represent significant differences (p < 0.05) based on one-way ANOVA followed by post-hoc Tukey test.
Jof 10 00478 g004
Figure 5. CfHMG deletion affects mating ability for plus and minus strains. (A) Mating line formation induced by co-culturing with WT(P), WT(M), and relevant mutants on OA. Bar = 1 mm. (B) The comparisons of perithecium density on mating line on OA. (C) Size distribution comparisons of perithecia on mating line formation induced by co-culturing on OA. Different letters in (B) represent significant differences (p < 0.05) based on one-way ANOVA followed by post-hoc Tukey test.
Figure 5. CfHMG deletion affects mating ability for plus and minus strains. (A) Mating line formation induced by co-culturing with WT(P), WT(M), and relevant mutants on OA. Bar = 1 mm. (B) The comparisons of perithecium density on mating line on OA. (C) Size distribution comparisons of perithecia on mating line formation induced by co-culturing on OA. Different letters in (B) represent significant differences (p < 0.05) based on one-way ANOVA followed by post-hoc Tukey test.
Jof 10 00478 g005
Figure 6. Deletion of CfHMG reduced the virulence in the minus strain. (A) Non-wounded inoculation assays of minus strains on apple. (C) Non-wounded inoculation assays of plus strains on apple. (B) Disease index comparison among minus and mutant strains.(D) Disease index comparison among plus and mutant strains. Different letters in (B,D) represent significant differences (p < 0.05) based on one-way ANOVA followed by post-hoc Tukey test.
Figure 6. Deletion of CfHMG reduced the virulence in the minus strain. (A) Non-wounded inoculation assays of minus strains on apple. (C) Non-wounded inoculation assays of plus strains on apple. (B) Disease index comparison among minus and mutant strains.(D) Disease index comparison among plus and mutant strains. Different letters in (B,D) represent significant differences (p < 0.05) based on one-way ANOVA followed by post-hoc Tukey test.
Jof 10 00478 g006
Figure 7. Defects of CfHMG mutants in conidial germination and formation of appressorium and penetration hypha. (A) Conidial germination and formation of appressoria and penetration hypha of indicated strains on cellophane at 12 hpi. Bar =20 μm. (B) The rate of conidial germination. (C) The rate of appressoria formation. (D) The rate of penetration hypha formation. Different letters in (BD) represent significant differences (p < 0.05) based on one-way ANOVA followed by post-hoc Tukey test.
Figure 7. Defects of CfHMG mutants in conidial germination and formation of appressorium and penetration hypha. (A) Conidial germination and formation of appressoria and penetration hypha of indicated strains on cellophane at 12 hpi. Bar =20 μm. (B) The rate of conidial germination. (C) The rate of appressoria formation. (D) The rate of penetration hypha formation. Different letters in (BD) represent significant differences (p < 0.05) based on one-way ANOVA followed by post-hoc Tukey test.
Jof 10 00478 g007
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhang, W.; Liu, W.; Liang, X.; Zhang, R.; Gleason, M.L.; Sun, G. CfHMG Differentially Regulates the Sexual Development and Pathogenicity of Colletotrichum fructicola Plus and Minus Strains. J. Fungi 2024, 10, 478. https://doi.org/10.3390/jof10070478

AMA Style

Zhang W, Liu W, Liang X, Zhang R, Gleason ML, Sun G. CfHMG Differentially Regulates the Sexual Development and Pathogenicity of Colletotrichum fructicola Plus and Minus Strains. Journal of Fungi. 2024; 10(7):478. https://doi.org/10.3390/jof10070478

Chicago/Turabian Style

Zhang, Wei, Wenkui Liu, Xiaofei Liang, Rong Zhang, Mark L. Gleason, and Guangyu Sun. 2024. "CfHMG Differentially Regulates the Sexual Development and Pathogenicity of Colletotrichum fructicola Plus and Minus Strains" Journal of Fungi 10, no. 7: 478. https://doi.org/10.3390/jof10070478

APA Style

Zhang, W., Liu, W., Liang, X., Zhang, R., Gleason, M. L., & Sun, G. (2024). CfHMG Differentially Regulates the Sexual Development and Pathogenicity of Colletotrichum fructicola Plus and Minus Strains. Journal of Fungi, 10(7), 478. https://doi.org/10.3390/jof10070478

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop