Biological Control of Root Rot of Strawberry by Bacillus amyloliquefaciens Strains CMS5 and CMR12
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Pathogen and Plant Materials
2.2. Isolation of Bacteria from Strawberry Rhizosphere Soil
2.3. Screening of Antagonistic Strains
2.4. Identification of Strains CMS5 and CMR12
2.5. Characterization of Antifungal Lipopeptides Substances of Strains CMS5 and CMR12
2.6. Effects of Lipopeptides of Strains CMS5 and CMR12 on the Pathogenic Fungal Mycelial Morphology and Spore Germination
2.7. Determination of Plant Growth-Promoting Traits of Strains CMS5 and CMR12
2.8. Control Effects of Strains CMS5 and CMR12 on Strawberry Root and Defensive Enzyme Activity
2.9. Growth-Promoting Effects of Strains CMS5 and CMR12 on Strawberry Seedlings
2.10. Data Statistics and Analysis
3. Results
3.1. Isolation and Screening of Rhizosphere Soil Bacteria
3.2. Identification of Strains CMS5 and CMR12
3.3. Antifungal Activity of Lipopeptide Substances of Strains CMS5 and CMR12
3.4. Inhibitory Effects of Lipopeptides of Strains CMS5 and CMR12 on the Pathogenic Fungal Mycelial Morphology and Spore Germination
3.5. Plant Growth-Promoting Traits of Strains CMS5 and CMR12
3.6. Biocontrol Efficiency of Strains CMS5 and CMR12 against Strawberry Root Rot
3.7. Effects of Strains CMS5 and CMR12 on the Activity of Strawberry Defense-Related Enzyme Activities
3.8. Growth Promotion Effects of Strains CMS5 and CMR12 on Strawberry Seedlings
4. Discussion
4.1. Significance of Exploring Biocontrol Resources for Plant Disease
4.2. Biocontrol Mechanisms of B. amyloliquefaciens CMS5 and CMR12
4.3. Practical Applications of B. amyloliquefaciens CMS5 and CMR12
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Petrasch, S.; Knapp, S.J.; van Kan, J.A.; Blanco-Ulate, B. Grey mould of strawberry, a devastating disease caused by the ubiquitous necrotrophic fungal pathogen Botrytis cinerea. Mol. Plant Pathol. 2019, 20, 877–892. [Google Scholar] [CrossRef] [PubMed]
- Lazcano, C.; Boyd, E.; Holmes, G.; Hewavitharana, S.; Pasulka, A.; Ivors, K. The rhizosphere microbiome plays a role in the resistance to soil-borne pathogens and nutrient uptake of strawberry cultivars under field conditions. Sci. Rep. 2021, 11, 3188. [Google Scholar] [CrossRef] [PubMed]
- Iqbal, M.; Jamshaid, M.; Zahid, M.A.; Andreasson, E.; Vetukuri, R.A.; Stenberg, J.A. Biological control of strawberry crown rot, root rot and grey mould by the beneficial fungus Aureobasidium pullulans. Bio-Control 2021, 66, 535–545. [Google Scholar] [CrossRef]
- Abdel-Sattar, M.A.; El-Marzoky, H.A.; Mohamed, A.I. Occurrence of soilborne diseases and root knot nematodes in strawberry plants grown on compacted rice straw bales compared with naturally infested soils. J. Plant Prot. Res. 2008, 48, 223–235. [Google Scholar]
- Hu, Y.J.; Yang, H.M.; Jin, J.; Yan, H.H.; Wang, J.P.; Zhang, R.Q. Synergistic activity of antagonistic Trichoderma spp. and Rhizoctonia solani increases disease severity on strawberry petioles. Eur. J. Plant Pathol. 2022, 164, 375–389. [Google Scholar]
- Erper, I.; Ozer, G.; Alkan, M.; Zholdoshbekova, S.; Turkkan, M. First report of Dactylonectria torresensis causing black root rot of strawberries in Kyrgyzstan. J. Plant Pathol. 2020, 103, 379–380. [Google Scholar] [CrossRef]
- Fang, X.L.; Phillips, D.; Li, H.; Sivasithamparam, K.; Barbetti, M.J. Severity of crown and root diseases of strawberry and associated fungal and oomycete pathogens in Western Australia. Australas. Plant Pathol. 2011, 40, 109–119. [Google Scholar] [CrossRef]
- Bahar, M.; Shahab, H. Analysis of lranian isolates of Fusarium solani using morphological, pathogenicity and microsatellite DNA marker characterization. Afr. J. Biotechnol. 2012, 11, 474–482. [Google Scholar]
- Chamorro, M.; Aguado, A.; Santos, B.D.L. First report of root and crown rot caused by Pestalotiopsis clavispora (Neopestalotiopsis clavispora) on strawberry in Spain. Plant Dis. 2015, 100, 7. [Google Scholar] [CrossRef]
- Pastrana, A.M.; Capote, N.; Santos, B.D.L.; Romero, F.; Basallote-Ureba, M.J. First report of Fusarium solani causing crown and root rot on strawberry crops in Southwestern Spain. Plant Dis. 2014, 98, 161. [Google Scholar] [CrossRef]
- Zhang, Y.T.; Yu, H.; Hu, M.H.; Wu, J.Y.; Zhang, C.Q. Fungal pathogens associated with strawberry crown rot disease in China. J. Fungi 2022, 8, 1161. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Y.M.; Li, J.T.; Shi, H.; Liang, C.H.; Wang, Z.G.; Wu, X.H. Species identification of Fusarium spp. causing root rot on strawberry. Acta Phytopathol. Sin. 2024, 54, 451–456. [Google Scholar]
- Ceja-Torres, L.F.; Mora-Aguilera, G.; Teliz, D.; Mora-Aguilera, A.; Sanchez-Garcia, P.; Munoz-Ruiz, C.; Tlapal-Bolanos, B.; De La Torre-Almaraz, R. Fungi prevalence and etiology of strawberry dry wilt under different crop management systems. Agrociencia 2008, 42, 451–461. [Google Scholar]
- Manici, L.M.; Caputo, F.; Baruzzi, G. Additional experiences toelucidate the microbial component of soil suppressiveness towards strawberr black root rot complex. Ann. Appl. Biol. 2005, 146, 421–431. [Google Scholar] [CrossRef]
- Ayoubi, N.; Soleimani, M.J. Morphological and molecular identification of pathogenic Fusarium spp. on strawberry in Iran. Sydowia 2016, 68, 163–171. [Google Scholar]
- De la Lastra, E.; Villarino, M.; Astacio, J.D.; Larena, I.; De Cal, A.; Capote, N. Genetic diversity and vegetative compatibility of Fusarium solani species complex of strawberry in Spain. Phytopathology 2019, 109, 2142–2151. [Google Scholar] [CrossRef]
- Shen, T.; Wang, C.; Yang, H.; Deng, Z.L.; Wang, S.M.; Shen, B.; Shen, Q.R. Identification, solid-state fermentation and biocontrol effects of Streptomyces hygroscopicus B04 on strawberry root rot. Appl. Soil Ecol. 2016, 103, 36–43. [Google Scholar] [CrossRef]
- Liu, Y.; Tian, Y.; Yue, L.; Constantine, U.; Zhao, X.; Zhou, Q.; Wang, Y.; Zhang, Y.B.; Chen, G.F.; Dun, Z.H.; et al. Effectively controlling Fusarium root rot disease of Angelica sinensis and enhancing soil fertility with a novel attapulgite-coated biocontrol agent. Appl. Soil Ecol. 2021, 168, 104121. [Google Scholar] [CrossRef]
- Abd-El-Kareem, F.; Elshahawy, I.E.; Abd-Elgawad, M.M. Local Trichoderma strains as a control strategy of complex black root rot disease of strawberry in Egypt. Bull. Natl. Res. Cent. 2019, 43, 160. [Google Scholar] [CrossRef]
- Abd-El-Kareem, F.; Elshahawy, I.E.; Abd-Elgawad, M.M. Application of Bacillus pumilus isolates for management of black rot disease in strawberry. Egypt. J. Biol. Pest Control 2021, 31, 25. [Google Scholar] [CrossRef]
- Gowtham, H.G.; Murali, M.; Singh, S.B.; Lakshmeesha, T.R.; Murthy, K.N.; Amruthesh, K.N.; Niranjana, S.R. Plant growth promoting rhizobacteria-Bacillus amyloliquefaciens improves plant growth and induces resistance in chilli against anthracnose disease. Biol. Control 2018, 126, 209–217. [Google Scholar] [CrossRef]
- Cui, W.Y.; He, P.J.; Munir, S.; He, P.B.; Li, X.Y.; Li, Y.M.; Wu, J.J.; Wu, Y.X.; Yang, L.J.; He, P.F. Efficacy of plant growth promoting bacteria Bacillus amyloliquefaciens B9601-Y2 for biocontrol of southern corn leaf blight. Biol. Control 2019, 139, 104080. [Google Scholar] [CrossRef]
- Cui, L.; Yang, C.; Wang, Y.; Ma, T.; Cai, F.; Wei, L.; Jin, M.; Osei, R.; Zhang, J.; Tang, M. Potential of an endophytic bacteria Bacillus amyloliquefaciens 3-5 as biocontrol agent against potato scab. Microb. Pathog. 2022, 163, 105382. [Google Scholar] [CrossRef] [PubMed]
- Luo, L.; Zhao, C.; Wang, E.; Raza, A.; Yin, C. Bacillus amyloliquefaciens as an excellent agent for biofertilizer and biocontrol in agriculture: An overview for its mechanisms. Microbiol. Res. 2022, 259, 127016. [Google Scholar] [CrossRef]
- Alila-Kolsi, I.; Ben-Mahmoud, A.; Al-Barazie, R. Bacillus amyloliquefaciens: Harnessing its potential for industrial, medical, and agricultural applications-a comprehensive review. Microorganisms 2023, 11, 2215. [Google Scholar] [CrossRef]
- Chowdhury, S.P.; Hartmann, A.; Gao, X.; Borriss, R. Biocontrol mechanism by root-associated Bacillus amyloliquefaciens FZB42-A Review. Front. Microbiol. 2015, 6, 780. [Google Scholar] [CrossRef]
- Gill, S.S.; Tuteja, N. Reactive oxygen species and antioxidant machinery in abiotic stress tolerance in crop plants. Plant Physiol. Biochem. 2010, 48, 909–930. [Google Scholar] [CrossRef] [PubMed]
- Cun, H.; Munir, S.; He, P.; Wu, Y.; He, P.; Ahmed, A.; Che, H.; Li, J.; He, Y. Diversity of root endophytic bacteria from maize seedling involved in biocontrol and plant growth promotion. Egypt. J. Biol. Pest Control 2022, 32, 129. [Google Scholar] [CrossRef]
- Morocko, I.; Fatehi, J.; Gerhardson, B. Gnomonia fragariae, a cause of strawberry root rot and petiole blight. Eur. J. Plant Pathol. 2006, 114, 235–244. [Google Scholar] [CrossRef]
- Ding, Y.; Liu, F.J.; Yang, J.; Fan, Y.Y.; Yu, L.J.; Li, Z.H.; Jiang, N.; An, J.; Jiao, Z.W.; Wang, C. Isolation and identification of Bacillus mojavensis YL-RY0310 and its biocontrol potential against Penicillium expansum and patulin in apples. Biol. Control 2023, 182, 105239. [Google Scholar] [CrossRef]
- Hong, S.; Kim, T.Y.; Won, S.-J.; Moon, J.-H.; Ajuna, H.B.; Kim, K.Y.; Ahn, Y.S. Control of fungal diseases and fruit yield improvement of strawberry using Bacillus velezensis CE100. Microorganisms 2022, 10, 365. [Google Scholar] [CrossRef] [PubMed]
- Weisburg, W.G.; Barns, S.M.; Pelletier, D.A.; Lane, D.J. 16S ribosomal DNA amplification for phylogenetic study. J. Bacteriol. 1991, 173, 697–703. [Google Scholar] [CrossRef] [PubMed]
- Yamamoto, S.; Harayama, S. PCR amplification and direct sequencing of gyrB genes with universal primers and their application to the detection and taxonomic analysis of Pseudomonas putida strains. Appl. Environ. Microbiol. 1995, 61, 1104–1109. [Google Scholar] [CrossRef] [PubMed]
- Koumoutsi, A.; Chen, X.H.; Henne, A.; Liesegang, H.; Hitzeroth, G.; Franke, P.; Vater, J.; Borriss, R. Structural and functional characterization of gene clusters directing nonribosomal synthesis of bioactive cyclic lipopeptides in Bacillus amyloliquefaciens strain FZB42. J. Bacteriol. 2004, 186, 1084–1096. [Google Scholar] [PubMed]
- Hsieh, F.C.; Lin, T.C.; Meng, M.; Kao, S.S. Comparing methods for identifying Bacillus strains capable of producing the antifungal lipopeptide iturin A. Curr. Microbiol. 2008, 56, 1–5. [Google Scholar] [CrossRef] [PubMed]
- Kim, P.I.; Pyoung, I.L.; Jaewon, R.; Young, H.K.; Youn, T.C. Production of biosurfactant lipopeptides iturin A, fengycin, and surfactin A form Bacillus subtilis CMB32 for control of Colletotrichum gloeosporioides. J. Microbiol. Biotechnol. 2010, 20, 138–145. [Google Scholar] [CrossRef] [PubMed]
- Yang, R.; Ye, W.; Liu, P.; Li, J.; Lu, M.M.; Wang, Z.H.; Shao, D.K. Endophytic Bacillus amyloliquefaciens Mdgb15 is a potential biocontrol agent against tree peony gray mold caused by Botrytis cinerea. Eur. J. Plant Pathol. 2024; in press. [Google Scholar] [CrossRef]
- Pan, H.Y.; Jin, W.Y.; Zhang, X.M.; Song, X.L.; Yan, Y.Z.; Yan, B.; Xue, J. Inhibition of antifungal substances from Bacillus amyloquefaciens B15 against Botrytis Cinerea-the agent of “gray mold” of grape. Acta Microbiol. Sin. 2018, 58, 1245–1254. [Google Scholar]
- Sritongon, N.; Boonlue, S.; Mongkolthanaruk, W.; Jogloy, S.; Riddech, N. The combination of multiple plant growth promotion and hydrolytic enzyme producing rhizobacteria and their effect on Jerusalem artichoke growth improvement. Sci. Rep. 2023, 13, 5917. [Google Scholar] [CrossRef]
- Alexander, D.B.; Zuberer, D.A. Use of chrome azurol S reagents to evaluate siderophore production by rhizosphere bacteria. Biol. Fertil. Soils 1991, 12, 39–45. [Google Scholar] [CrossRef]
- Ahmad, F.; Ahmad, I.; Khan, M.S. Screening of free living rhizospheric bacteria for their multiple plant growth promoting activities. Microbiol. Res. 2008, 163, 173–181. [Google Scholar] [CrossRef] [PubMed]
- Hamdali, H.; Bouizgarne, B.; Hafidi, M.; Lebrihi, A.; Virolle, M.J.; Ouhdouch, Y. Screening for rock phosphate solubilizing Actinomycetes from Moroccan phosphate mines. Appl. Soil Ecol. 2008, 38, 12–19. [Google Scholar] [CrossRef]
- Bhattacharyya, C.; Banerjee, S.; Acharya, U.; Mitra, A.; Mallick, I.; Haldar, A.; Ghosh, A.; Ghosh, A. Evaluation of plant growth promotion properties and induction of antioxidative defense mechanism by tea rhizobacteria of Darjeeling, India. Sci. Rep. 2020, 10, 15536. [Google Scholar] [CrossRef] [PubMed]
- Vestberg, M.; Kukkonen, S.; Saari, K.; Parikka, P.; Huttunen, J.; Tainio, L.; Devos, N.; Weekers, F.; Kevers, C.; Thonart, P.; et al. Microbial inoculation for improving the growth and health of micropropagated strawberry. Appl. Soil Ecol. 2004, 27, 243–258. [Google Scholar] [CrossRef]
- Murage, E.N.; Masuda, M. Response of pepper and eggplant to continuous light in relation to leaf chlorosis and activities of antioxidative enzymes. Sci. Hortic. 1997, 70, 269–279. [Google Scholar] [CrossRef]
- Wang, C.Y. Effect of temperature preconditioning on catalase, peroxidase, and superoxide dismutase in chilled zucchini squash. Postharvest Biol. Technol. 1995, 5, 67–76. [Google Scholar] [CrossRef]
- Zhang, M.; Kong, Z.; Fu, H.; Shu, X.; Xue, Q.; Lai, H.; Guo, Q. Rhizosphere microbial ecological characteristics of strawberry root rot. Front. Microbiol. 2023, 14, 1286740. [Google Scholar] [CrossRef] [PubMed]
- Yadav, D.K.; Devappa, V.; Kashyap, A.S.; Kumar, N.; Rana, V.S.; Sunita, K.; Singh, D. Boosting the biocontrol efficacy of Bacillus amyloliquefaciens DSBA-11 through physical and chemical mutagens to control bacterial wilt disease of tomato caused by Ralstonia solanacearum. Microorganisms 2023, 11, 1790. [Google Scholar] [CrossRef]
- Wu, Y.M.; Chen, X.; Wang, F.; Hsiao, C.Y.; Yang, C.Y.; Lin, S.T.; Wu, L.H.; Chen, Y.K.; Liang, Y.S.; Lin, Y.H. Bacillus amyloliquefaciens strains control strawberry anthracnose through antagonistic activity and plant immune response intensification. Biol. Control 2021, 157, 104592. [Google Scholar]
- Chen, Z.; Huang, J.; Zhao, J.; Hao, Y.S.; Liang, H. Isolation and identification of pathogenic fungi of strawberry root rot and the inhibition of antagonistic bacteria CM3 on these fungi. Biotechnol. Bull. 2018, 34, 135–141. [Google Scholar]
- Van Wees, S.C.; Van der Ent, S.; Pieterse, C.M. Plant immune responses triggered by beneficial microbes. Curr. Opin. Plant Biol. 2008, 11, 443–448. [Google Scholar] [CrossRef]
- Ren, L.; Yuan, Z.; Xie, T.; Wu, D.; Kang, Q.; Li, J.; Li, J. Extraction and characterization of cyclic lipopeptides with antifungal and antioxidant activities from Bacillus amyloliquefaciens. J. Appl. Microbiol. 2022, 133, 3573–3584. [Google Scholar] [CrossRef] [PubMed]
- Liu, L.; Medison, R.G.; Zheng, T.W.; Meng, X.J.; Sun, Z.X.; Zhou, Y. Biocontrol potential of Bacillus amyloliquefaciens YZU-SG146 from Fraxinus hupehensis against Verticillium wilt of cotton. Biol. Control 2023, 183, 105246. [Google Scholar]
- Fan, B.; Wang, C.; Song, X.F.; Ding, X.L.; Wu, L.M.; Wu, H.J.; Gao, X.W.; Borriss, R. Bacillus velezensis FZB42 in 2018: The Gram-Positive model strain for plant growth promotion and biocontrol. Front. Microbiol. 2018, 9, 2491. [Google Scholar] [CrossRef] [PubMed]
- Al-Mutar, D.M.K.; Alzawar, N.S.A.; Noman, M.; Azizullah; Li, D.; Song, F. Suppression of Fusarium wilt in watermelon by Bacillus amyloliquefaciens DHA55 through extracellular production of antifungal lipopeptides. J. Fungi 2023, 9, 336. [Google Scholar] [CrossRef] [PubMed]
- Yang, P.; Yuan, P.; Liu, W.; Zhao, Z.; Bernier, M.C.; Zhang, C.; Adhikari, A.; Opiyo, S.O.; Zhao, L.; Banks, F.; et al. Plant growth promotion and plant disease suppression induced by Bacillus amyloliquefaciens strain GD4a. Plants 2024, 13, 672. [Google Scholar] [CrossRef] [PubMed]
- Kang, B.R.; Park, J.S.; Jung, W.J. Antifungal evaluation of fengycin isoforms isolated from Bacillus amyloliquefaciens PPL against Fusarium oxysporum f. sp. lycopersici. Microb. Pathog. 2020, 149, 104509. [Google Scholar] [PubMed]
- Jiao, R.; Cai, Y.; He, P.; Munir, S.; Li, X.; Wu, Y.; Wang, J.; Xia, M.; He, P.; Wang, G.; et al. Bacillus amyloliquefaciens YN201732 produces lipopeptides with promising biocontrol activity against fungal pathogen Erysiphe cichoracearum. Front. Cell Infect. Microbiol. 2021, 11, 598999. [Google Scholar] [CrossRef] [PubMed]
- Chowdhury, S.P.; Uhl, J.; Grosch, R.; Alquéres, S.; Pittroff, S.; Dietel, K.; Schmitt-Kopplin, P.; Borriss, R.; Hartmann, A. Cyclic lipopeptides of Bacillus amyloliquefaciens subsp. plantarum colonizing the lettuce rhizosphere enhance plant defense responses toward the bottom rot pathogen Rhizoctonia solani. Mol. Plant Microbe. Interact. 2015, 28, 984–995. [Google Scholar]
- Pieterse, C.M.; Zamioudis, C.; Berendsen, R.L.; Weller, D.M.; Van Wees, S.C.; Bakker, P.A. Induced systemic resistance by beneficial microbes. Ann. Rev. Phytopathol. 2014, 52, 347–375. [Google Scholar] [CrossRef]
- Niu, D.D.; Wang, X.J.; Wang, Y.R.; Song, X.O.; Wang, J.S.; Guo, J.H.; Zhao, H.W. Bacillus cereus AR156 activates PAMP-triggered immunity and induces a systemic acquired resistance through a NPR1-and SA-dependent signaling pathway. Biochem. Biophys. Res. Commun. 2016, 469, 120–125. [Google Scholar] [CrossRef] [PubMed]
- Ahmad, R.; Kim, Y.H.; Kim, M.D.; Kwon, S.Y.; Cho, K.; Lee, H.S.; Kwak, S.S. Simultaneous expression of choline oxidase, superoxide dismutase and ascorbate peroxidase in potato plant chloroplasts provides synergistically enhanced protection against various abiotic stresses. Physiol. Plant. 2010, 138, 520–533. [Google Scholar] [CrossRef]
- Prasannath, K. Plant defense-related enzymes against pathogens: A review. Agrieast J. Agric. Sci. 2017, 11, 38–48. [Google Scholar] [CrossRef]
- Batool, T.; Ali, S.; Seleiman, M.F.; Naveed, N.H.; Ali, A.; Ahmed, K.; Abid, M.; Rizwan, M.; Shahid, M.R.; Alotaibi, M.; et al. Plant growth promoting rhizobacteria alleviates drought stress in potato in response to suppressive oxidative stress and antioxidant enzymes activities. Sci. Rep. 2020, 10, 16975. [Google Scholar] [CrossRef] [PubMed]
- Kazerooni, E.A.; Maharachchikumbura, S.S.; Al-Sadi, A.M.; Kang, S.M.; Yun, B.W.; Lee, I.J. Biocontrol potential of Bacillus amyloliquefaciens against Botrytis pelargonii and Alternaria alternata on Capsicum annuum. J. Fungi 2021, 7, 472. [Google Scholar] [CrossRef]
- Pei, D.; Zhang, Q.; Zhu, X.; Zhang, L. Biological control of Verticillium wilt and growth promotion in tomato by Rhizospheric soil-derived Bacillus amyloliquefaciens Oj-2.16. Pathogens 2022, 26, 37. [Google Scholar] [CrossRef]
Gene | Primer | Primer Sequence (5′-3′) | PCR Conditions | Reference |
---|---|---|---|---|
16S rRNA | 27F | AGAGTTTGATCCTGGCTCAG | 94 °C for 5 min (94 °C for 30 s, 55 °C for 30 s, and 72 °C for 1 min) × 35 cycles, 72 °C for 10 min | [32] |
1492R | TACGGCTACCTTGTTACGACTT | |||
gyrB | UP-1S | GAAGTCATCATGACCGTTCTGCA | [33] | |
UP-2Sr | AGCAGGGTACGGATGTGCGAGCC |
Gene | Primer | Primer Sequence (5′-3′) | Lipopeptide | PCR Conditions | Reference |
---|---|---|---|---|---|
fenA | FenAa | AAGAGATTCAGTAAGTGGCCCATCCAG | Fengycin | 94 °C for 5 min (94 °C for 30 s, 55 °C for 30 s, and 72 °C for 1 min) × 35 cycles, 72 °C for 10 min | [34] |
FenAb | CGCCCTTTGGGAAGAGGTGC | ||||
srfAA | Srfkn-1 | AGCCGTCCTGTCTGACGACG | Surfactin | [35] | |
Srfkn-2 | TCTGCTGCCATACCGCATAGTC | ||||
ituD | ItuD-f | ATGAACAATCTTGCCTTTTTA | Iturin | ||
ItuD-r | TTATTTTAAATTCCCCAATT |
Pathogenic Strains | CMS5 | CMR12 | ||
---|---|---|---|---|
Inhibition Zones (mm) | Inhibitory Rate (%) | Inhibition Zones (mm) | Inhibitory Rate (%) | |
F. solani | 5.00 ± 0.00 a | 57.78 ± 0.04 a | 6.00 ± 0.10 a | 65.93 ± 0.01 a |
F. oxysporum | 3.70 ± 0.12 a | 65.92 ± 0.01 b | 4.30 ± 0.06 a | 70.37 ± 0.03 a |
N. clavispora | 2.23 ± 0.06 b | 59.26 ± 0.01 b | 4.00 ± 0.10 a | 61.48 ± 0.01 a |
A. alternata | 10.01 ± 0.12 a | 70.37 ± 0.03 a | 11.3 ± 0.06 a | 71.85 ± 0.01 a |
Strain | Genes | Product Size (bp) | Similar Protein Sequences | Accession Numbers | Identity (%) |
---|---|---|---|---|---|
CMS5 | ituD | 1122 | bacillomycin D biosynthesis malonyl-CoA transacylase BamD (B. amyloliquefaciens) | WP_061860597 | 99% |
fenA | 1365 | non-ribosomal peptide synthetase (B. amyloliquefaciens) | WP_060674287 | 99% | |
srfAA | 1464 | surfactin non-ribosomal peptide synthetase SrfAA (B. amyloliquefaciens) | WP_223255265 | 99% | |
CMR12 | ituD | 1121 | bacillomycin D biosynthesis malonyl-CoA transacylase BamD (B. amyloliquefaciens) | WP_094246888 | 99% |
fenA | 1369 | non-ribosomal peptide synthetase (B. amyloliquefaciens) | WP_243939152 | 99% | |
srfAA | 1463 | surfactin non-ribosomal peptide synthetase SrfAA (B. amyloliquefaciens) | WP_241457877 | 99% |
Treatments | Disease Index | Biocontrol Efficiency (%) |
---|---|---|
T1 (Water-treated) | 0.00 ± 0.00 d | - |
T2 (F. solani-treated) | 83.30 ± 1.66 a | - |
T3 (F. solani+CMS5-treated) | 28.90 ± 1.57 b | 65.30 ± 0.07 b |
T4 (F. solani+CMR12-treated) | 26.70 ± 0.80 b | 67.94 ± 0.10 b |
T5 (F. solani+CMS5+CMR12-treated) | 10.00 ± 1.20 c | 88.00 ± 0.06 a |
Treatments | Plant Height (cm) | Root Length (cm) | Total Fresh Weight (g) |
---|---|---|---|
T1 (water) | 20.86 ± 0.65 b | 16.50 ± 0.36 c | 14.57 ± 1.15 c |
T2 (CMS5) | 28.00 ± 0.78 a | 17.97 ± 0.76 c | 29.12 ± 2.83 b |
T3 (CMR12) | 24.67 ± 2.32 a | 23.47 ± 0.83 a | 28.50 ± 1.69 b |
T4 (CMS5+CMR12) | 26.40 ± 2.94 a | 20.73 ± 4.84 ab | 37.76 ± 4.78 a |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, R.; Liu, P.; Ye, W.; Chen, Y.; Wei, D.; Qiao, C.; Zhou, B.; Xiao, J. Biological Control of Root Rot of Strawberry by Bacillus amyloliquefaciens Strains CMS5 and CMR12. J. Fungi 2024, 10, 410. https://doi.org/10.3390/jof10060410
Yang R, Liu P, Ye W, Chen Y, Wei D, Qiao C, Zhou B, Xiao J. Biological Control of Root Rot of Strawberry by Bacillus amyloliquefaciens Strains CMS5 and CMR12. Journal of Fungi. 2024; 10(6):410. https://doi.org/10.3390/jof10060410
Chicago/Turabian StyleYang, Ruixian, Ping Liu, Wenyu Ye, Yuquan Chen, Daowei Wei, Cuicui Qiao, Bingyi Zhou, and Jingyao Xiao. 2024. "Biological Control of Root Rot of Strawberry by Bacillus amyloliquefaciens Strains CMS5 and CMR12" Journal of Fungi 10, no. 6: 410. https://doi.org/10.3390/jof10060410
APA StyleYang, R., Liu, P., Ye, W., Chen, Y., Wei, D., Qiao, C., Zhou, B., & Xiao, J. (2024). Biological Control of Root Rot of Strawberry by Bacillus amyloliquefaciens Strains CMS5 and CMR12. Journal of Fungi, 10(6), 410. https://doi.org/10.3390/jof10060410