A Novel Strain of Fusarium oxysporum Virus 1 Isolated from Fusarium oxysporum f. sp. niveum Strain X-GS16 Influences Phenotypes of F. oxysporum Strain HB-TS-YT-1hyg
Abstract
:1. Introduction
2. Materials and Methods
2.1. Fungal Strains
2.2. Extraction and Purification of RNA
2.3. Synthesis and Molecular Cloning of Complementary DNA (cDNA)
2.4. Sequence Analysis, Alignment, and Phylogenetic Analysis
2.5. Elimination of FoV1-FON from X-GS16
2.6. Vertical and Horizontal Transmission of FoV1-FON
2.7. Effect of FoV1-FON on Phenotypes of F. oxysporum Strain HB-TS-YT-1hyg
2.8. Pathogenicity Test of HB-TS-YT-1hyg and HB-TS-YT-1hyg-V
2.9. Sensitivity of HB-TS-YT-1hyg and HB-TS-YT-1hyg-V to Difenoconazole, Prochloraz, and Pydiflumetofen
3. Results
3.1. Complete Sequence and Phylogenetic Analysis of FoV1-FON
3.2. Vertical and Horizontal Transmission of FoV1-FON
3.3. Effect of FoV1-FON on Phenotypes of F. oxysporum Strain HB-TS-YT-1hyg
3.4. Effect of FoV1-FON on Virulence of F. oxysporum Strain HB-TS-YT-1hyg
3.5. Effect of FoV1-FON on the Sensitivity of F. oxysporum Strain HB-TS-YT-1hyg to Difenoconazole, Prochloraz, and Pydiflumetofen
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Ghabrial, S.A.; Suzuki, N. Viruses of plant pathogenic fungi. Annu. Rev. Phytopathol. 2009, 47, 353–384. [Google Scholar] [CrossRef] [PubMed]
- Takahashi-Nakaguchi, A.; Shishido, E.; Yahara, M.; Urayama, S.I.; Sakai, K.; Chibana, H.; Kamei, K.; Moriyama, H.; Gonoi, T. Analysis of an intrinsic mycovirus associated with reduced virulence of the human pathogenic fungus Aspergillus fumigatus. Front. Microbiol. 2020, 10, 3045. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Gao, J.; Li, Y. Diversity of mycoviruses in edible fungi. Virus Genes 2022, 58, 377–391. [Google Scholar] [CrossRef] [PubMed]
- Kondo, H.; Botella, L.; Suzuki, N. Mycovirus diversity and evolution revealed/inferred from recent studies. Annu. Rev. Phytopathol. 2022, 60, 307–336. [Google Scholar] [CrossRef] [PubMed]
- Ghabrial, S.A.; Castn, J.R.; Jiang, D.H.; Nibert, M.L.; Suzuki, N. 50-plus years of fungal viruses. Virology 2015, 479–480, 356–368. [Google Scholar] [CrossRef] [PubMed]
- Hyder, R.; Pennanen, T.; Hamberg, L.; Vainio, E.J.; Piri, T.; Hantula, J. Two viruses of heterobasidion confer beneficial, cryptic or detrimental effects to their hosts in different situations. Fungal Ecol. 2013, 6, 387–396. [Google Scholar] [CrossRef]
- Son, M.; Yu, J.; Kim, K.H. Five questions about mycoviruses. PLoS Pathog. 2015, 11, e1005172. [Google Scholar] [CrossRef] [PubMed]
- Kotta-Loizou, I. Mycoviruses and their role in fungal pathogenesis. Curr. Opin. Microbiol. 2021, 63, 10–18. [Google Scholar] [CrossRef] [PubMed]
- Sato, Y.; Suzuki, N. Continued mycovirus discovery expanding our understanding of virus lifestyles, symptom expression, and host defense. Curr. Opin. Microbiol. 2023, 75, 102337. [Google Scholar] [CrossRef] [PubMed]
- Chu, Y.-M.; Jeon, J.-J.; Yea, S.-J.; Kim, Y.-H.; Yun, S.-H.; Lee, Y.-W.; Kim, K.-H. Double-stranded RNA mycovirus from Fusarium graminearum. Appl. Environ. Microbiol. 2002, 68, 2529–2534. [Google Scholar] [CrossRef]
- Chiba, S.; Salaipeth, L.; Lin, Y.H.; Sasaki, A.; Kanematsu, S.; Suzuki, N. A novel bipartite double-stranded RNA mycovirus from the white root rot fungus Rosellinia necatrix: Molecular and biological characterization, taxonomic considerations, and potential for biological control. J. Virol. 2009, 83, 12801–12812. [Google Scholar] [CrossRef] [PubMed]
- Vainio, E.J.; Jurvansuu, J.; Hyder, R.; Kashif, M.; Piri, T.; Tuomivirta, T.; Poimala, A.; Xu, P.; Mäkelä, S.; Nitisa, D.; et al. Heterobasidion partitivirus 13 mediates severe growth debilitation and major alterations in the gene expression of a fungal forest pathogen. J. Virol. 2018, 92, e01744-17. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Li, S.; Liang, Z.; Cai, Q.; Zhou, T.; Zhao, C.; Wu, X. RNA-seq analysis of Rhizoctonia solani AG-4HGI strain BJ-1H infected by a new viral strain of Rhizoctonia solani partitivirus 2 reveals a potential mechanism for hypovirulence. Phytopathology 2022, 112, 1373–1385. [Google Scholar] [CrossRef] [PubMed]
- Liu, H.; Wang, H.; Liao, X.L.; Gao, B.D.; Lu, X.; Sun, D.; Gong, W.; Zhong, J.; Zhu, H.; Pan, X.; et al. Mycoviral gene integration converts a plant pathogenic fungus into a biocontrol agent. Proc. Natl. Acad. Sci. USA 2022, 119, e2214096119. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Wu, C.; Hua, H.; Cai, Q.; Wu, X. Characterization of the first alternavirus identified in Fusarium avenaceum, the causal agent of potato dry rot. Viruses 2023, 15, 145. [Google Scholar] [CrossRef] [PubMed]
- Dean, R.; Van Kan, J.A.; Pretorius, Z.A.; Hammond-Kosack, K.E.; Di Pietro, A.; Spanu, P.D.; Rudd, J.J.; Dickman, M.; Kahmann, R.; Ellis, J.; et al. The top 10 fungal pathogens in molecular plant pathology. Mol. Plant Pathol. 2012, 13, 414–430. [Google Scholar] [CrossRef]
- Lemus-Minor, C.G.; Cañizares, M.C.; Garca-Pedrajas, M.D.; Pérez-Artés, E. Fusarium oxysporum f. sp. dianthi virus 1 accumulation is correlated with changes in virulence and other phenotypic traits of its fungal host. Phytopathology 2018, 108, 957–963. [Google Scholar] [CrossRef] [PubMed]
- Lemus-Minor, C.G.; Cañizares, M.C.; García-Pedrajas, M.D.; Pérez-Artés, E. Horizontal and vertical transmission of the hypovirulence-associated mycovirus Fusarium oxysporum f. sp. dianthi virus 1. Eur. J. Plant Pathol. 2019, 153, 645–650. [Google Scholar] [CrossRef]
- Torres-Trenas, A.; Prieto, P.; Cañizares, M.C.; García-Pedrajas, M.D.; Pérez-Artés, E. Mycovirus Fusarium oxysporum f. sp. dianthi Virus 1 decreases the colonizing efficiency of its fungal host. Front. Cell. Infect. Microbiol. 2019, 9, 51. [Google Scholar] [CrossRef] [PubMed]
- Torres-Trenas, A.; Pérez-Artés, E. Characterization and incidence of the first member of the genus Mitovirus identified in the phytopathogenic species Fusarium oxysporum. Viruses 2020, 12, 279. [Google Scholar] [CrossRef] [PubMed]
- Torres-Trenas, A.; Cañizares, M.C.; García-Pedrajas, M.D.; Pérez-Artés, E. Molecular and biological characterization of the first hypovirus identified in Fusarium oxysporum. Front. Microbiol. 2020, 10, 3131. [Google Scholar] [CrossRef]
- Zhao, Y.; Zhang, Y.; Wan, X.; She, Y.; Li, M.; Xi, H.; Xie, J.; Wen, C. A novel ourmia-like mycovirus confers hypovirulence-associated traits on Fusarium oxysporum. Front. Microbiol. 2020, 11, 569869. [Google Scholar] [CrossRef] [PubMed]
- Sato, Y.; Shamsi, W.; Jamal, A.; Bhatti, M.F.; Kondo, H.; Suzuki, N. Hadaka virus 1: A capsidless eleven-segmented positive-sense single-stranded RNA virus from a phytopathogenic fungus, Fusarium oxysporum. mBio 2020, 11, e00450-20. [Google Scholar] [CrossRef] [PubMed]
- Wen, C.; Wan, X.; Zhang, Y.; Du, H.; Wei, C.; Zhong, R.; Zhang, H.; Shi, Y.; Xie, J.; Fu, Y.; et al. Molecular characterization of the first alternavirus identified in Fusarium oxysporum. Viruses 2021, 13, 2026. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Li, C.; Qiu, R.; Li, X.; Zhao, J.; Bai, J.; Chen, Y.; Li, S. Complete genome sequence of a novel mitovirus from the phytopathogenic fungus Fusarium oxysporum. Arch. Virol. 2021, 166, 3211–3216. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Li, C.; Song, P.; Qiu, R.; Song, R.; Li, X.; Ni, Y.; Zhao, H.; Liu, H.; Li, S. Molecular and biological characterization of the first mymonavirus identified in Fusarium oxysporum. Front. Microbiol. 2022, 13, 870204. [Google Scholar] [CrossRef] [PubMed]
- Ye, Y.; Liu, Y.; Zhang, Y.; Wang, X.; Li, H.; Li, P. Metatranscriptome-based strategy reveals the existence of novel mycoviruses in the plant pathogenic fungus Fusarium oxysporum f. sp. cubense. Front. Microbiol. 2023, 14, 1193714. [Google Scholar] [CrossRef]
- Zhou, X.G.; Everts, K.L.; Bruton, B.D. Race 3, a new and highly virulent race of Fusarium oxysporum f. sp. niveum causing Fusarium wilt in watermelon. Plant Dis. 2010, 94, 92–98. [Google Scholar] [PubMed]
- Keinath, A.P.; DuBose, V.B.; Katawczik, M.M.; Wechter, W.P. Identifying races of Fusarium oxysporum f. sp. niveum in South Carolina recovered from watermelon seedlings, plants, and field soil. Plant Dis. 2020, 104, 2481–2488. [Google Scholar] [CrossRef] [PubMed]
- Rahman, M.Z.; Ahmad, K.; Kutawa, A.B.; Siddiqui, Y.; Saad, N.; Hun, T.G.; Hata, E.M.; Hossain, M.I. Biology, diversity, detection and management of Fusarium oxysporum f. sp. niveum causing vascular wilt disease of watermelon (Citrullus lanatus): A review. Agronomy 2021, 11, 1310. [Google Scholar] [CrossRef]
- Morris, T.J.; Dodds, J.A. Isolation and analysis of double stranded RNA from virus-infected plant and fungal tissue. Phytopathology 1979, 69, 854–858. [Google Scholar] [CrossRef]
- Lyu, R.; Zhang, Y.; Tang, Q.; Li, Y.; Cheng, J.; Fu, Y.; Chen, T.; Jiang, D.; Xie, J. Two alphapartitiviruses co-infecting a single isolate of the plant pathogenic fungus Rhizoctonia solani. Arch. Virol. 2018, 163, 515–520. [Google Scholar] [CrossRef] [PubMed]
- Potgieter, A.C.; Page, N.A.; Liebenberg, J.; Wright, I.M.; Landt, O.; van Dijk, A.A. Improved strategies for sequence-independent amplification and sequencing of viral double-stranded RNA genomes. J. Gen. Virol. 2009, 90, 1423–1432. [Google Scholar] [CrossRef] [PubMed]
- Tamura, K.; Stecher, G.; Peterson, D.; Filipski, A.; Kumar, S. MEGA6: Molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 2013, 30, 2725–2729. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Bian, R.; Liu, Q.; Yang, L.; Pang, T.X.; Salaipeth, L.; Andika, I.B.; Kondo, H.; Sun, L. Identification of a novel hypovirulence-inducing hypovirus from Alternaria alternata. Front. Microbiol. 2019, 10, 1076. [Google Scholar] [CrossRef] [PubMed]
- Liang, Z.J.; Hua, H.; Wu, C.; Zhou, T.; Wu, X. A botybirnavirus isolated from Alternaria tenuissima confers hypervirulence and decreased sensitivity of its host fungus to difenoconazole. Viruses 2022, 14, 2093. [Google Scholar] [CrossRef] [PubMed]
- Sun, Y.; Guo, M.; Wang, J.; Bian, Y.; Xu, Z. Curing two predominant viruses occurring in Lentinula edodes by chemotherapy and mycelial fragmentation methods. J. Virol. Methods 2022, 300, 114370. [Google Scholar] [CrossRef] [PubMed]
- Cao, C.; Li, H.; Jones, M.G.K.; Wylie, S.J. Challenges to elucidating how endornaviruses influence fungal hosts: Creating mycovirus-free isogenic fungal lines and testing them. J. Virol. Methods 2019, 274, 113745. [Google Scholar] [CrossRef] [PubMed]
- Arjona-López, J.M.; Telengech, P.; Suzuki, N.; López-Herrera, C.J. A moderate level of hypovirulence conferred by a hypovirus in the avocado white root rot fungus, Rosellinia necatrix. Fungal Biol. 2021, 125, 69–76. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Zhang, X.; Kennedy, J.F.; Jiang, M.; Cai, Q.; Wu, X. Chitosan induces resistance to tuber rot in stored potato caused by Alternaria tenuissima. Int. J. Biol. Macromol. 2019, 140, 851–857. [Google Scholar] [CrossRef] [PubMed]
- Zhao, C.; Li, S.W.; Ma, Z.; Wang, W.; Gao, L.; Han, C.; Yang, A.; Wu, X. Anastomosis groups and mycovirome of Rhizoctonia isolates causing sugar beet root and crown rot and their sensitivity to flutolanil, thifluzamide, and pencycuron. J. Fungi 2023, 9, 545. [Google Scholar] [CrossRef] [PubMed]
- Depierreux, D.; Vong, M.; Nibert, M.L. Nucleotide sequence of Zygosaccharomyces bailii virus Z: Evidence for +1 programmed ribosomal frameshifting and for assignment to family Amalgaviridae. Virus Res. 2016, 217, 115–124. [Google Scholar] [CrossRef] [PubMed]
- Mahillon, M.; Romay, G.; Liénard, C.; Legrève, A.; Bragard, C. Description of a novel mycovirus in the phytopathogen Fusarium culmorum and a related EVE in the yeast Lipomyces starkeyi. Viruses 2020, 12, 523. [Google Scholar] [CrossRef] [PubMed]
- Kotta-Loizou, I.; Sipkova, J.; Coutts, R.H. Identification and sequence determination of a novel double-stranded RNA mycovirus from the entomopathogenic fungus Beauveria bassiana. Arch. Virol. 2015, 160, 873–875. [Google Scholar] [CrossRef] [PubMed]
- Kotta-Loizou, I.; Coutts, R.H.A. Studies on the virome of the entomopathogenic fungus Beauveria bassiana reveal novel dsRNA elements and mild hypervirulence. PLoS Pathog. 2017, 13, e1006183. [Google Scholar] [CrossRef] [PubMed]
- Huang, Y.P.; Wang, P.; Wu, H.; Yang, C.; Huang, B. Molecular characterization of a novel non-segmented double-stranded RNA mycovirus isolated from Penicillium citrinum strain RCEF7060. Arch. Virol. 2022, 168, 12. [Google Scholar] [CrossRef] [PubMed]
- Campo, S.; Gilbert, K.B.; Carrington, J.C. Small RNA-based antiviral defense in the phytopathogenic fungus Colletotrichum higginsianum. PLoS Pathog. 2016, 12, e1005640. [Google Scholar] [CrossRef] [PubMed]
- Khan, H.A.; Baig, D.I.; Bhatti, M.F. An overview of mycoviral curing strategies used in evaluating fungal host fitness. Mol. Biotechnol. 2023, 65, 1547–1564. [Google Scholar] [CrossRef] [PubMed]
- Tran, T.T.; Li, H.; Nguyen, D.Q.; Jones, M.G.K.; Wylie, S.J. Co-infection with three mycoviruses stimulates growth of a Monilinia fructicola isolate on nutrient medium, but does not induce hypervirulence in a natural host. Viruses 2019, 11, 89. [Google Scholar] [CrossRef] [PubMed]
- Fonseka, D.L.; Gudmestad, N.C. Spatial and temporal sensitivity of Alternaria species associated with potato foliar diseases to demethylation inhibiting and anilino-pyrimidine fungicides. Plant Dis. 2016, 100, 1848–1857. [Google Scholar] [CrossRef] [PubMed]
- Sun, C.X.; Li, F.J.; Wei, M.D.; Xiang, Z.X.; Chen, C.J.; Xu, D.L. Detection and biological characteristics of Alternaria alternata resistant to difenoconazole from Paris polyphylla var. chinensis, an indigenous medicinal herb. Plant Dis. 2021, 105, 1546–1554. [Google Scholar] [CrossRef] [PubMed]
- Xu, X.; Wang, Y.Q.; Lei, T.; Sohail, M.A.; Wang, J.; Wang, H. Synergistic effects of Bacillus amyloliquefaciens SDTB009 and difenoconazole on Fusarium wilt of tomato. Plant Dis. 2022, 106, 2165–2171. [Google Scholar] [CrossRef] [PubMed]
- Acosta-González, U.; Silva-Rojas, H.V.; Fuentes-Aragón, D.; Hernández-Castrejón, J.; Romero-Bautista, A.; Rebollar-Alviter, A. Comparative performance of fungicides and biocontrol products in the management of Fusarium wilt of blackberry. Plant Dis. 2022, 106, 1419–1427. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Zhang, J.; He, Y.; Li, Y.; Deng, H.; Jiang, Y. Evaluation and control of Alternaria tenuissima causing leaf spots in blue honeysuckle in China. Plant Dis. 2023. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Y.; Chi, M.; Sun, H.; Qian, H.; Yang, J.; Huang, J. The FgCYP51B Y123H mutation confers reduced sensitivity to prochloraz and is important for conidiation and ascospore development in Fusarium graminearum. Phytopathology 2021, 111, 1420–1427. [Google Scholar] [CrossRef] [PubMed]
- Förster, H.; Luo, Y.; Hou, L.; Adaskaveg, J.E. Mutations in Sdh gene subunits confer different cross-resistance patterns to SDHI fungicides in Alternaria alternata causing Alternaria leaf spot of almond in California. Plant Dis. 2022, 106, 1911–1918. [Google Scholar] [CrossRef] [PubMed]
- Miller, N.F.; Standish, J.R.; Quesada-Ocampo, L.M. Sensitivity of Fusarium oxysporum f. sp. niveum to prothioconazole and pydiflumetofen in vitro and efficacy for Fusarium wilt management in watermelon. Plant Hlth. Prog. 2020, 21, 13–18. [Google Scholar] [CrossRef]
- Ma, G.; Zhang, X.; Hua, H.; Zhou, T.; Wu, X. Molecular and biological characterization of a novel strain of Alternaria alternata chrysovirus 1 identified from the pathogen Alternaria tenuissima causing watermelon leaf blight. Virus Res. 2020, 280, 197904. [Google Scholar] [CrossRef]
Primer Name | Sequence (5′-3′) |
---|---|
PC3-T7 Loop adapter | p-GGATCCCGGGAATTCGGTAATACGACTCACTATA TTTTTATAGTGAGTCGTATTA-OH |
PC2 | CCGAATTCCCGGGATCC |
FoV1-FON-GAP1-F | AAAAAGAGTAGCACTGGAACGAGA |
FoV1-FON-GAP1-R | CAGGAAATACAGGGAGAGAAAAGA |
FoV1-FON-F | GGCTTACCTCACCTTCTTTTAC |
FoV1-FON-R | TGTTGCCAGACACATCCTTATC |
FoV1-FON-5end-1 | GACGTGACTTATACTCCTGAGCGACCT |
FoV1-FON-5end-2 | AAACGATCTCCACGGGTGACAGC |
FoV1-FON-3end-1 | GAGGTTCGTCTTAGAAGCCTACTGGG |
FoV1-FON-3end-2 | TGGTTCTTTTCTCTCCCTGTATTTC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hua, H.; Zhang, X.; Xia, J.; Wu, X. A Novel Strain of Fusarium oxysporum Virus 1 Isolated from Fusarium oxysporum f. sp. niveum Strain X-GS16 Influences Phenotypes of F. oxysporum Strain HB-TS-YT-1hyg. J. Fungi 2024, 10, 252. https://doi.org/10.3390/jof10040252
Hua H, Zhang X, Xia J, Wu X. A Novel Strain of Fusarium oxysporum Virus 1 Isolated from Fusarium oxysporum f. sp. niveum Strain X-GS16 Influences Phenotypes of F. oxysporum Strain HB-TS-YT-1hyg. Journal of Fungi. 2024; 10(4):252. https://doi.org/10.3390/jof10040252
Chicago/Turabian StyleHua, Huihui, Xinyi Zhang, Jie Xia, and Xuehong Wu. 2024. "A Novel Strain of Fusarium oxysporum Virus 1 Isolated from Fusarium oxysporum f. sp. niveum Strain X-GS16 Influences Phenotypes of F. oxysporum Strain HB-TS-YT-1hyg" Journal of Fungi 10, no. 4: 252. https://doi.org/10.3390/jof10040252