Next Article in Journal
Glucose Catabolite Repression Participates in the Regulation of Sialidase Biosynthesis by Antarctic Strain Penicillium griseofulvum P29
Next Article in Special Issue
Differential Carbon Catabolite Repression and Hemicellulolytic Ability among Pathotypes of Colletotrichum lindemuthianum against Natural Plant Substrates
Previous Article in Journal / Special Issue
Unraveling the Life Cycle of Nyssopsora cedrelae: A Study of Rust Diseases on Aralia elata and Toona sinensis
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Population Genetic Analyses and Trichothecene Genotype Profiling of Fusarium pseudograminearum Causing Wheat Crown Rot in Henan, China

1
Wheat Research Institute, Henan Academy of Agricultural Sciences, Zhengzhou 450002, China
2
Plant Science College, Tibet Agriculture & Animal Husbandry University, Linzhi 860000, China
3
Institute for Agro-Food Standards and Testing Technology, Ministry of Agriculture, Shanghai Academy of Agricultural Sciences, Shanghai 201403, China
*
Authors to whom correspondence should be addressed.
The authors contributed equally to this work.
J. Fungi 2024, 10(4), 240; https://doi.org/10.3390/jof10040240
Submission received: 6 February 2024 / Revised: 20 March 2024 / Accepted: 20 March 2024 / Published: 22 March 2024
(This article belongs to the Special Issue Fungal Plant Pathogens)

Abstract

In China, Fusarium pseudograminearum has emerged as a major pathogen causing Fusarium crown rot (FCR) and caused significant losses. Studies on the pathogen’s properties, especially its mating type and trichothecene chemotypes, are critical with respect to disease epidemiology and food/feed safety. There are currently few available reports on these issues. This study investigated the species composition, mating type idiomorphs, and trichothecene genotypes of Fusarium spp. causing FCR in Henan, China. A significant shift in F. pseudograminearum-induced FCR was found in the present study. Of the 144 purified strains, 143 were F. pseudograminearum, whereas only 1 Fusarium graminearum was identified. Moreover, a significant trichothecene-producing capability of F. pseudograminearum strains from Henan was observed in this work. Among the 143 F. pseudograminearum strains identified, F. pseudograminearum with a 15ADON genotype was found to be predominant (133 isolates), accounting for 92.36% of all strains, followed by F. pseudograminearum with a 3ADON genotype, whereas only one NIV genotype strain was detected. Overall, a relatively well-balanced 1:1 ratio of the F. pseudograminearum population was found in Henan. To the best of our knowledge, this is the first study that has examined the Fusarium populations responsible for FCR across the Henan wheat-growing region.

1. Introduction

Common wheat is the most important winter crop and provides staple grains for about half of human beings worldwide. The sustained high yields of wheat over the past 40 years have resulted in consistent supply–demand equilibrium [1]. However, on average, about 20% of the global wheat production is lost due to diseases and pests annually [2]. Pathogenic fungi represent a significant constraint to wheat production [1]. Fusarium crown rot (FCR) caused by Fusarium species is one such economically important wheat disease. Most recently, Saad et al. [3] examined the impacts of FCR pathogens, Fusarium pseudograminearum, and Fusarium culmorum, on the wheat root system. The results showed that, in the presence of these pathogen infections, the size and biomass of wheat root were significantly reduced, and significant adverse impacts on the architecture of the root system were also revealed [3], which are all important for yield loss.
According to the surveys conducted to date, FCR is caused by several species of the genus Fusarium, with F. pseudograminearum being particularly prevalent. The disease has been documented in many other countries throughout the world since its discovery in Queensland, Australia, in 1951, including Africa, America, Europe, and Asia, with the most severe cases occurring in Australia [4,5,6,7,8,9,10]. In Australia, the primary pathogens associated with this disease include F. pseudograminearum, F. culmorum, and Fusarium acuminatum [11]. Similarly, the cultural practices and environmental conditions in the USA and Canada seem to favor the co-occurrence of F. pseudograminearum and F. culmorum on spring wheat [12,13]. On the other hand, Fusarium avenaceum, F. culmorum, and F. graminearum are the three well-known species associated with FCR in wheat in Spain, and F. pseudograminearum was first found in a commercial field located in Córdoba, Spain, in 2016 and formally reported in 2018 [14].
Worldwide, severe damage to wheat production caused by FCR has been reported during the past two decades. The FCR-induced crop losses in Australia have indicated that the disease can cause an average annual reduction of about 10% in wheat grain yield under natural inoculum levels, which is estimated to be AUD 88 million [15]. On the other hand, the prevalence and epidemic of this disease are largely influenced by climate factors. As reviewed by Scherm et al. [16], drought conditions increase the susceptibility of the plant rather than the virulence of the fungus. Thus, the disease is promoted by hot and dry weather at crop anthesis and maturation [17], and more severe yield losses have been reported in semi-arid wheat-growing regions around the world [11]. In the Pacific Northwest of the USA, FCR caused by F. pseudograminearum is estimated to routinely cause up to 35% yield loss in wheat grain [18].
Fusarium-induced crown rot of wheat is not a new disease in China, while F. pseudograminearum has emerged as a major pathogen causing FCR and poses a serious threat to wheat production. FCR in wheat caused by F. pseudograminearum was first reported by Li et al. [19] in Henan, China, in 2011. The species was subsequently documented in other geographic regions in China, such as Jiangsu [20] and Hebei provinces [21], associated with FCR, along with Fusarium head blight (FHB) of wheat [22], and, occasionally, it was found in other plant hosts [23,24]. Currently, F. pseudograminearum-induced FCR has become more serious in the main wheat-growing region in China and is most severe in Henan province, which has the largest wheat-growing areas and yields in China. The disease has been listed as one of the four major wheat diseases by the Chinese government.
As a member of the genus Fusarium, in addition to causing yield losses, F. pseudograminearum is capable of producing various Fusarium toxins, such as trichothecenes represented as deoxynivalenol (DON) and zearalenone. Grain and straw tissue with high mycotoxin levels cannot be used for food and feed products. Many countries defined strict limits for several mycotoxins, including DON and zearalenone, regarding the commercialization of unprocessed kernels and the food products obtained from different cereals [25]. Of the 44 samples collected from different field sites in Queensland and New South Wales in 2010, DON concentrations in straw from 26 sites exceeded 1 mg/kg, with a percentage of 59% [17]. Similarly to the situation in the Fusarium graminearum species complex (FGSC), the main pathogen of wheat FHB worldwide, three different trichothecene genotypes were identified in F. pseudograminearum species [6,20,26,27], namely, 3-acetyl DON, 15-acetyl DON, and nivalenol (NIV) types. The different toxicological effects observed among the three trichothecene-producing strains make their identification in a given area important in terms of food/feed safety and disease management. Moreover, some mycotoxins produced by Fusarium strains can function as virulence factors during the pathogen infection process, enhancing pathogen virulence or aggressiveness in certain host plants [28,29].
Although several surveys about pathogenic fungi F. pseudograminearum and their induction of FCR have been conducted in Henan, little is known about the F. pseudograminearum’s population genetic structure and distribution, or the prevalence of their trichothecene genotype diversity in wheat in Henan. Xu et al. [30] surveyed the spatial distribution of pathogenic fungi associated with the crown rot of wheat in Henan, and their relationship with climate variables was also discussed. Similarly, Zhou et al. [31] investigated the distribution of the pathogens associated with FCR in the Huanghuai wheat-growing region (including Henan) and examined the pathogenic and genetic diversity within and among the predominant species. However, no information was provided about the mating type idiomorph and toxin potential of F. pseudograminearum populations in all these investigations. Therefore, this study is focused on the mating type idiomorph and mycotoxin genotype distribution of the F. pseudograminearum population in Henan.

2. Materials and Methods

2.1. Sample Collection

Whole wheat straws exhibiting typical symptoms of crown rot from winter wheat fields in the main wheat-growing regions of Henan were collected in 2023 prior to harvest. Wheat samples were collected from 18 locations across the main wheat-growing regions in Henan province (Figure 1). At each of these sites, wheat samples were collected from commercial fields following a previously described strategy [32]. For each site, 10 to 15 whole plants were collected with a minimum distance of 500 m. The samples were collected by uprooting whole plants, including the roots. Geographic data, including the latitude and longitude of individual sampling sites, were recorded with the aid of a Global Positioning System (Kubota, T16). The average temperature, average relative humidity, and total precipitation of different sampling sites for April, May, and June were obtained from the meteorological department (Table 1).

2.2. Fungal Isolation and Culture

Fungal culture isolation was performed as previously described by Khudhair et al. [6], with minor changes. In brief, the symptomatic crown/sub-crown tissues were cut into small segments (about 2 cm in length). The segments were then surface-sterilized (1% sodium hypochlorite, 3 min), rinsed twice with sterile distilled water, transferred onto sterile filter paper, and dried in a biosafety cabinet. The dried sections were placed on potato dextrose agar (PDA) medium supplemented with streptomycin (working solution concentration 0.1 g/L). For each wheat plant, one section was selected for fungal isolation. After 3–5 days of incubation in a constant-temperature incubator at 25 °C, fungal colonies recovered from the sections were subsequently transferred into fresh PDA plates with sterile toothpicks. The resulting fungal colony was subcultured several times on PDA until a pure culture was obtained for individual strains. The single-spore isolation of Fusarium-like colonies was performed as described by Zhang et al. [33]. The resulting fungal strains were routinely grown on PDA plates at 25 °C. For short-term preservation, all strains were grown on PDA stock tubes at 4 °C.

2.3. Genomic DNA Extraction

Fungal strains were inoculated onto fresh PDA plates, and then cultured at 25 °C for 3 days in the dark for mycelia induction. Aerial mycelia were harvested using sterile toothpicks and transferred into 2 mL microcentrifuge tubes containing 650 mL CTAB buffer. A similar protocol, previously published by Wang et al. [34], was followed for DNA extraction, except that a water bath approach (65 °C, 40 min) was added after the homogenization of fungal mycelia. The resultant DNA was suspended in sterile deionized water, quantified with the aid of a spectrophotometer. Partial DNA was selected and diluted into a working concentration (about 20 ng/μL) with water without nuclease. All DNA samples were kept frozen at −20 °C until required for use.

2.4. Fusarium pseudograminearum Confirmation by Specific Primers

All obtained Fusarium strains were initially identified according to the morphological and cultural characteristics, and then confirmed using a molecular assay. To confirm that all 144 purified strains from Henan province were correctly identified as F. pseudograminearum, fungal DNA was subjected to PCR amplification using species-specific primer sets Fp1-1 and Fp1-2 (Table 2) [35]. The PCR amplifications were carried out in a 20 μL volume reaction mixture containing 2 μL 10 × EasyTaq PCR buffer (Transgen Biotech, Beijing, China), 1 μL of template DNA (20 ng), 0.2 μL of each primer (10 μM), and 16.6 μL sterile water. The amplifications were conducted in a T100 Thermal Cycler (Bio-Rad, Hercules, CA, USA) using the following program: initial denaturation at 94 °C for 4 min, followed by 30 cycles of 30 s at 94 °C, 30 s at 60 °C, and 30 s 72 °C, with a final extension at 72 °C for 5 min. Amplicons were separated using agarose gel (1.5%) electrophoresis in TEA buffer, stained with nucleic acid fluorescent stain reagent (Transgen Biotech, Beijing, China), and photographed under UV light. An expected specific fragment of 520 bp would be amplified from the F. pseudograminearum strains. The strains that failed to amplify any fragment with primers Fp1-1 and Fp1-2 were further amplified using primer pair Fg16F/R (Table 2) [36] to identify the species for FGSC. The primers used in this study are listed in Table 2.

2.5. Trichothecene Genotype Determination of Fusarium pseudograminearum

A published PCR assay for the trichothecene genotyping determination of FGSC was used to analyze the only FGSC strain [34]. To determine the trichothecene genotype of each F. pseudograminearum strain, a recently reported trichothecene genotype-specific assay was performed, as described by Deng et al. [37], targeting Tri8 (an essential gene encoding a deacetylase) within the core trichothecene biosynthetic gene cluster. All of the obtained DNA samples were analyzed using three primer sets of 3AT8-1/3AT8-2, 15AT8-1/15AT8-2, and NIVT8-1/NIVT8-2 (Table 2) for 3ADON, 15ADON, and NIV genotype strains, respectively. PCR amplifications were performed in a total reaction volume of 20 μL, as described in Deng et al. [37]. The PCR assay was run in a Bio-Rad T100 thermal cycler using the following program: 2 min initial denaturation at 94 °C, followed by 30 cycles consisting of 30 s at 94 °C, 30 s at 60 °C, and 50 s at 72 °C, with a final elongation at 72 °C for 5 min, and a refrigeration step at 12 °C. Amplicons were separated in 1.2% agarose gels run in a TAE buffer. For these three primer sets, the fragments amplified from 3ADON, 15ADON, and NIV genotype strains are expected to be 424 bp, 827 bp, and 397 bp, respectively, in length.

2.6. Mating Type Idiomorph Determination of Fusarium pseudograminearum

A previously reported PCR approach to the mating-type idiomorph assay was applied for the screening of all F. pseudograminearum strains [38]. Two mating-type primer pairs, fusALPHAfor/rev (expected fragment of 200 bp in size, specific to MAT-1 strains) and fusHMGfor/rev (expected fragment of 260 bp in size, specific to MAT-2 strains) (Table 2), were used for MAT-1 and MAT-2 idiomorphs, respectively. The same 20 μL of the reaction system was used for the amplification of these two mating-type markers, which contained 2 μL 10 × EasyTaq PCR buffer (Transgen Biotech, Beijing, China), 0.2 μL of each primer (10 μM), 1 μL of template DNA (20 ng), and up to 20 μL of sterile water. The thermal cycler program comprised an initial denaturation step at 94 °C for 4 min; followed by 30 cycles with 94 °C for 30 s, 30 s at 60 °C for primer pair fusALPHAfor/rev, or 62 °C for primer pair fusHMGfor/rev, and 72 °C for 20 s; and a 5 min final extension at 72 °C. The amplified DNA fragments were separated using gel electrophoresis in 1.5% agarose gels, stained, and visualized as mentioned above. The mating type ration of each site was analyzed using a chi-square test against an expected ration of 1:1 at a significance level of p = 0.05.

3. Results

3.1. Pathogen Identification

In the current study, a total of 144 Fusarium strains were obtained from FCR symptomatic wheat plants collected from 18 sites in the wheat-growing regions of Henan from commercial fields in 2023. According to the species-specific PCR assay with primer pair Fp-1/2, 143 strains produced a 520 bp fragment, indicative of F. pseudograminearum, accounting for 99.31% of all the obtained strains. The remaining strain, isolated from Zhoukou, was subsequently subjected to PCR assays with primer pair Fg16F/R, a species-specific marker for FGSC strains. The results demonstrated that a 410 bp product was obtained from this strain with the primer set Fg16F/R, indicating that it is FGSC. Thus, combined with morphological and molecular techniques, 1 strain of FGSC and 143 of F. pseudograminearum were identified.

3.2. Trichothecene Genotype Determination

The PCR assays of the only FGSC strain with the primer pair Tri13P1/2 indicated that the strain was typed as a 15ADON genotype. The Tri8-based genotype PCR results revealed the presence of three different patterns of PCR products, representing 3ADON, 15ADON, and NIV genotypes. Of the 143 F. pseudograminearum strains that were assayed, 133 (93.01%) were determined as the 15ADON genotype, and 9 (6.29%) as the 3ADON genotype, while only 1 NIV genotype strain was identified (account for 0.70%) (Table 3). The F. pseudograminearum toxin potential assay results indicated that the 15ADON genotype significantly outnumbered the 3ADON genotype. Thus, 15ADON is the predominant mycotoxin produced by the F. pseudograminearum strains in Henan. Overall, F. pseudograminearum with a 15ADON genotype was found to be predominant (133 isolates), accounting for 92.36% of all 144 detected strains.

3.3. Mating Type Determination

We know that FGSC is homothallic, whereas F. pseudograminearum is presumed to be a heterothallic pathogen, and individuals only have one of the two mating-type idiomorphs in their genomes. Thus, except for the 1 FGSC strain, all 143 F. pseudograminearum strains were analyzed for mating type.
The PCR assay results with the primer sets fusALPHAfor/rev and fusHMGfor/rev showed that each of the F. pseudograminearum strain amplified a single mating type, idiomorph-specific band, either with fusALPHAfor/rev (MAT-1) or fusHMGfor/rev (MAT-2). Both mating types were identified in the F. pseudograminearum population of Henan. The results revealed that, of the 143 F. pseudograminearum strains, 80 strains (55.9%) and 63 strains (44.1%) had MAT-1 and MAT-2 mating types, respectively (Table 4). Considering the 143 F. pseudograminearum strains as a whole, the mating type ratio was not significantly different from 1:1 (p = 0.05).
However, as shown in Table 4, significant deviations from the expected ratio of 1:1 were found for the two mating types within several sampling sites. For example, the Puyang, Xuchang, and Zhumadian populations had a significantly higher proportion of MAT-1, while a much higher proportion of MAT-2 was found in Anyang compared to MAT-1. The χ2 test indicated that the 1:1 mating type ratio could not be rejected at a 95% confidence level for the two mating types in Hebi, Xinxiang, Jiaozuo, Jiyuan, Zhengzhou, Kaifeng, Shangqiu, Zhoukou, Luohe, Pingdingshan, Luoyang, Sanmenxia, Nanyang, and Xinyang (Table 4).

4. Discussion

Wheat production in China and worldwide continuously faces challenges from severe fungal diseases, such as FHB and FCR, caused by fungi belonging to the genus Fusarium. Wheat crown rot occurred relatively late in China, but in recent years, it has expanded dramatically for unknown reasons. A good example is Henan. In China, Henan province has the largest wheat-growing areas and yields. According to national statistical data, in recent years, the proportion of wheat-planting area in Henan province is around 20% of the country, with a stable wheat-planting area of over 56,853 square kilometers throughout the year, and wheat production accounting for one-fourth of the whole country. Comprehensive studies have been conducted on FHB worldwide during the past two decades [39]. Tremendous progress has been made in understanding the population structure, trichothecene genotype and biosynthesis, genetic diversity, etc., of the Fusarium pathogens causing FHB. However, until now, relatively few studies have been reported about the F. pseudograminearum populations causing FCR with respect to these issues, especially in China. The present work aimed to characterize the distribution of mating type idiomorphs and trichothecene genotypes of the F. pseudograminearum population in Henan.
In the 2023 growing season, severe FCR caused by F. pseudograminearum occurred in Henan due to the hot and dry weather that occurred from April to May. The estimated yield losses were as high as 30% in some fields. The current study investigated the pathogen species, mating type, and toxin potential of FCR-causing Fusarium strains collected from the 18 cities of Henan in 2023. All of the isolated strains belonged to the Fusarium genus. Among all these strains, it is obvious that F. pseudograminearum, representing a predominant population of FCR in wheat, accounts for 99.31%, while FGSC is rare (less than 0.70%). According to the newest prediction by the national agricultural technology center, the estimated occurrence area of FCR in China is about 40,000 square kilometers in the coming 2024 growing season. These figures clearly show that, at present, FCR is an economically important wheat disease in Henan.
A previous study by Deng et al. [40] has described the mating-type idiomorphs of F. pseudograminearum strains from eastern China. In Jiangsu, the ratios of the two mating types of the F. pseudograminearum strains deviated significantly from an expected 1:1 ratio, while a relatively more balanced mating type ratio was detected in Shandong [40]. In this study, for the first time, we determined the mating types of F. pseudograminearum strains in Henan. Our results revealed that F. pseudograminearum strains have both mating idiomorphs, which is consistent with previous studies indicating that the pathogen segregates for both MAT-1 and MAT-2 [4,6,7,40,41]. Although significant ratio differences were detected for the two mating types, MAT-1 and MAT-2, between individual sampling sites, a well-balanced 1:1 ratio of the F. pseudograminearum population in Henan was found overall. On the other hand, our findings indicated that, to some extent, F. pseudograminearum in China originated in Henan. In addition, Henan shares a border with Shandong, both of which belong to the North China Plain; hence, they might be regarded as a single agroecological area. The consistence in mating type composition between Henan and Shandong may thus imply that the two provinces have a comparable risk of being invaded by this pathogen, lending weight to the theory that F. pseudograminearum originated in north-central China [40].
In addition to losses in yield and seed quality, food or feed safety is by far the greatest concern, as mycotoxin contamination was introduced by Fusarium species. The genotype structure of the F. pseudograminearum population in a certain area can be useful for a risk assessment of the potential impacts on mycotoxin [42]. In the present study, a high prevalence (93.01%) of the F. pseudograminearum strain with the 15ADON genotype was identified in Henan. This finding is in line with observations in other parts of China (Shandong), where 15ADON is the predominant population [40]. Within the F. pseudograminearum strains, the 3ADON and NIV populations are quite infrequent (6.29% and 0.70%, respectively) in Henan, in contrast to the situation previously reported in Jiangsu [40]. The low frequencies of 3ADON and NIV populations in Henan wheat may suggest a limited impact of 3ADON and NIV in Henan crops, but requires constant monitoring, as a chemotype shift may occur over time [43,44,45]. However, studies conducted in Australia demonstrated that more than 90% of the F. pseudograminearum strains showed the 3ADON genotype, with the 15ADON genotype occasionally detected at a low frequency [6,7]. According to the results by Ward et al. [43,46], Fusarium trichothecene chemotype polymorphism was maintained by multiple speciation events through adaptive evolution, indicating that their chemotype differences may have a significant impact on pathogen fitness [43,46,47,48,49]. It is well known that dynamic changes in species structure and genotype proportion have been observed in the wheat scab pathogen FGSC worldwide [43,45,50]. However, it is still unclear whether similar phenomena will occur in F. pseudograminearum in the future, and continuous monitoring of the pathogen population is required.
Drastic changes occurred in the species composition causing FCR in wheat in Henan in the past two decades. A previous study by Zhang et al. [20] was conducted to explore the Fusarium species causing wheat crown rot in the five major winter wheat-growing provinces (Anhui, Hebei, Henan, Jiangsu, and Shandong) from 2009 to 2013. The results showed that, of the 25 Henan strains, 17 were F. asiaticum, 7 were F. graminearum, and the remaining 1 was identified as F. acuminatum. Of particular note, the only F. pseudograminearum strain that was obtained was isolated from Jiangsu, while this pathogen was absent in Henan in their survey [20]. The results by Zhang et al. [20] clearly showed that F. asiaticum was the main causal agent of wheat crown rot in China, followed by F. graminearum. This is in contrast with our results, which show that F. pseudograminearum acts as the main species associated with FCR in Henan. Such dynamic changes in the species composition of wheat scab pathogen have been well documented worldwide, which may result in natural selection and adaptive evolution in Fusarium populations [43,45,50]. Moreover, according to the results from a range of analytical tools, Chakraborty et al. [51] concluded that, generally, F. pseudograminearum is more aggressive than F. graminearum. This competitive advantage in pathogenicity will inevitably lead to the replacement of F. graminearum by F. pseudograminearum.
Since its first detection in Henan in 2011, with a frequency of 5.97% [19], F. pseudograminearum-induced FCR has become more and more severe in regions of China, with the most severe occurring in Henan, posing a serious threat to wheat production [20]. The distribution frequency of the pathogenic fungi associated with root and crown rot of winter wheat in the North China Plain (including Henan and its neighboring cities of Handan in Hebei and Heze in Shandong) was determined from 2013 to 2016 by Xu et al. [30]. The results showed that F. pseudograminearum was the predominant pathogen recovered from wheat root and stem samples, with isolation frequencies of 14.9% and 27.8%, respectively [30]. Likewise, Zhou et al. [31] investigated the distribution and diversity of the pathogens associated with FCR in the Huanghuai wheat-growing region (Henan, Shandong, Hebei, Shanxi, Shaanxi, Jiangsu, and Anhui) in China from 2013 to 2016. Zhou et al. [31] isolated a large number of Fusarium strains from Henan, totaling 528, with 313 strains identified as F. pseudograminearum. Their results indicated that the isolation frequency of F. pseudograminearum from Henan was 59% [31]. In the present study, a high percentage of F. pseudograminearum (99.31%) was identified in Henan, which is consistent with findings by Zhou et al. [31] and Xu et al. [30]. Conversely, we recovered only one strain of F. graminearum associated with wheat FCR in Henan. Our data are in accordance with the results of Zhang et al. [20], Xu et al. [30], and Zhou et al. [31], showing that Fusarium strains from FGSC are also the causal agents of FCR in Henan, and the pathogens co-exist with F. pseudograminearum in the field, even at low frequency levels. A similar surveillance of Fusarium wheat crown rot pathogens outside Henan was conducted in Jiangsu and Shandong provinces from 2014 to 2016 in China [40]. Of the 617 Fusarium isolates, 372 (60.3%) were identified as F. pseudograminearum [40], which is closer to the results obtained in our study.
According to the previous surveys and the results of the present study, F. pseudograminearum is becoming a predominant causative pathogen of crown rot of wheat in China. The frequency of F. pseudograminearum increased more than 16-fold between 2011 (5.97%) and 2023 (99.31%) in Henan wheat-growing regions. Furthermore, the current increase in FCR incidence and severity in Henan is most likely due to the substantial invasion of F. pseudograminearum populations, and a clear dramatic cline in F. pseudograminearum species can be seen over time. In this study, the much higher frequency of F. pseudograminearum suggests that this pathogen had already become a dominant population in Henan province before this survey.
The recent increase in the incidence and severity of FCR in Henan, and even in China, resulted in many complicating factors. Except for the fast invasion or high frequency of F. pseudograminearum observed in this study, this probably could be explained, at least in part, as follows. First, as reviewed by Scherm et al. [16], climatic conditions play key roles in increasing the prevalence of Fusarium species, which can drastically reverse the previous species distribution. Henan province is located in central eastern China, largely in the warm temperate zone, with the southern section extending into the subtropical zone. This region has a continental monsoon climate, which moves from the northern subtropical to the warm temperate zone. The climate conditions are suitable for the F. pseudograminearum population and may induce disease [30]. A similar correlation to the Henan results was previously reported in the arid zones of the Eastern Australia (Queensland and New South Wales) [52] and the Pacific Northwest of the USA [53,54]. The climatic conditions of the plant sampling sites in our current study are provided in Table 1. Due to the one-year data not being sufficient to discuss the influence of climatic conditions on disease occurrence, no further discussions are made here. However, long-term comprehensive studies should be carried out to reveal their contributions to the disease epidemic with respect to different climatic factors. Second, the previous crop and residue management are key factors in the development of FCR [16]. In order to increase the content of soil organic matter in farmland ecosystems, straw returning is considered an effective form of field management to increase soil fertility and reduce the use of chemical fertilizers, which has been widely used in China in recent years. The agronomic practice, as reported by Backhouse [55] and Deng et al. [40], may increase the preliminary infection source and promote the occurrence of wheat crown rot in Henan, or even more widely in China. Wheat-maize rotation, a very common planting practice in Henan, will also boost the inoculums and, consequently, the chances of increasing FCR severity [16]. As recently reported by Knight and Sutherland [56], Župunski et al. [57], Boamah et al. [58], and Li et al. [59], the impacts of wheat varieties, Fusarium species, and even their potential trichothecene genotypes on disease epidemics cannot be ignored. Third, F. pseudograminearum is heterothallic, and abundant genetic diversity was found in the Henan F. pseudograminearum population [31], which provides a force driving the evolution of the pathogen populations and may play an essential role in disease epidemiology [60]. Fourth, the confirmed diagnosis and isolation of F. pseudograminearum from wheat and other plant hosts clearly indicates a broad host spectrum for the pathogen [21,22,23,24,61], which is also essential for the pathogen’s survival and its ability to adapt to changing environments.

5. Conclusions

In the present study, F. pseudograminearum with a 15ADON genotype was found to be the predominant population for FCR in wheat in Henan. The results show that, overall, the F. pseudograminearum population segregates for MAT-1 and MAT-2 idiomorphs with a 1:1 expected mating type ratio. This is the first survey to identify the F. pseudograminearum mating type and trichothecene genotype in the main wheat-growing regions of Henan. The findings provided here address a significant research issue regarding F. pseudograminearum population genetic analysis and provide valuable data for FCR control. Furthermore, the high frequency of the 15ADON genotype F. pseudograminearum strains also highlighted that much more attention should be paid to the pathogen with respect to food/feed safety issues. Further work is required to obtain a better understanding of the spatial and temporal dynamics, genetic diversity, and management of this pathogen.

Author Contributions

Conceptualization, J.W. and F.S.; methodology, J.W., F.S., J.Z. (Jianzhou Zhang), J.Z. (Jiahui Zhang), C.L., W.W., Y.S. and M.Z.; software, J.Z. (Jiahui Zhang) and M.Z.; validation, J.Z. (Jianzhou Zhang), J.Z. (Jiahui Zhang), C.L. and M.Z.; formal analysis, M.Z.; investigation, J.Z. (Jianzhou Zhang), J.Z. (Jiahui Zhang), C.L. and M.Z.; resources, J.W. and J.Z. (Jianzhou Zhang); data curation, J.W. and F.S.; writing—original draft preparation, J.Z. (Jianzhou Zhang), J.Z. (Jiahui Zhang) and J.W.; writing—review and editing, J.W. and F.S.; visualization, J.Z. (Jiahui Zhang); supervision, J.W. and F.S.; project administration, J.W.; funding acquisition, J.W. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Shanghai Science and Technology Innovation Action Plan (grant numbers 23ZR1455700, 23N31900500) and Innovation Project (grant number 2022ZC03).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

All relevant data generated or analyzed during this study are included in this manuscript.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Figueroa, M.; Hammond-Kosack, K.E.; Solomon, P. A review of wheat disease-a field perspective. Mol. Plant Pathol. 2018, 19, 1523–1536. [Google Scholar] [CrossRef] [Scilit]
  2. Serfling, A.; Kopahnke, D.; Habekuss, A.; Novakazi, F.; Ordon, F. Wheat diseases: An overview. In Achieving Sustainable Cultivation of Wheat; Langridge, P., Ed.; Burleigh Dodds Science Publishing: Cambridge, UK, 2017. [Google Scholar]
  3. Saad, A.; Christopher, J.; Martin, A.; McDonald, S.; Percy, C. Fusarium pseudograminearum and F. culmorum affect the root system architecture of bread wheat. Crop J. 2023, 11, 316–321. [Google Scholar] [CrossRef] [Scilit]
  4. Laraba, I.; Boureghda, H.; Abdallah, N.; Bouaicha, O.; Obanor, F.; Moretti, A.; Geiser, D.M.; Kim, H.; McCormick, S.P.; Proctor, R.H.; et al. Population genetic structure and mycotoxin potential of the wheat crown rot and head blight pathogen Fusarium culmorum in Algeria. Fungal Genet. Biol. 2017, 103, 34–41. [Google Scholar] [CrossRef] [Scilit]
  5. Kazan, K.; Gardiner, D.M. Fusarium crown rot caused by Fusarium pseudograminearum in cereal crops: Recent progress and future prospects. Mol. Plant Pathol. 2018, 19, 1547–1562. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  6. Khudhair, M.; Thatcher, L.F.; Gardiner, D.M.; Kazan, K.; Roper, M.M.; Aitken, E.; Obanor, F. Comparative analysis of genetic structures and aggressiveness of Fusarium pseudograminearum populations from two surveys undertaken in 2008 and 2015 at two sites in the wheat belt of Western Australia. Plant Pathol. 2019, 68, 1337–1349. [Google Scholar] [CrossRef] [Scilit]
  7. Khudhair, M.; Obanor, F.; Kazan, K.; Gardiner, D.M.; Aitken, E.; McKay, A.; Giblot-Ducray, D.; Simpfendorfer, S.; Thatcher, L.F. Genetic diversity of Australian Fusarium pseudograminearum populations causing crown rot in wheat. Eur. J. Plant Pathol. 2021, 159, 741–753. [Google Scholar] [CrossRef] [Scilit]
  8. Bozoğlu, T.; Derviş, S.; Imren, M.; Amer, M.; Özdemir, F.; Paulitz, T.C.; Morgounov, A.; Dababat, A.A.; Özer, G. Fungal pathogens associated with crown and root rot of wheat in central, eastern, and southeastern Kazakhstan. J. Fungi 2022, 8, 417. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  9. Özer, G.; Erper, İ.; Yıldız, Ş.; Bozoğlu, T.; Zholdoshbekova, S.; Alkan, M.; Tekin, F.; Uulu, T.E.; İmren, M.; Dababat, A.A.; et al. Fungal pathogens associated with crown and root rot in wheat-growing areas of Northern Kyrgyzstan. J. Fungi 2023, 9, 124. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  10. Özer, G.; Paulitz, T.C.; İmren, M.; Alkan, M.; Muminjanov, H.; Dababat, A.A. Identity and pathogenicity of fungi associated with crown and root rot of dryland winter wheat in Azerbaijan. Plant Dis. 2020, 104, 2149–2157. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  11. Chakraborty, S.; Liu, C.J.; Mitter, V.; Scott, J.B.; Akinsanmi, O.A.; Ali, S.; Dill-Macky, R.; Nicol, J.; Backhouse, D.; Simpfendorfer, S. Pathogen population structure and epidemiology are keys to wheat crown rot and Fusarium head blight management. Australas. Plant Pathol. 2006, 35, 643–655. [Google Scholar] [CrossRef] [Scilit]
  12. Smiley, R.W.; Gourlie, J.A.; Easley, S.A.; Patterson, L.M. Pathogenicity of fungi associated with the wheat crown rot complex in Oregon and Washington. Plant Dis. 2005, 89, 949–957. [Google Scholar] [CrossRef] [Scilit]
  13. Davis, R.A.; Huggins, D.R.; Cook, J.R.; Paulitz, T.C. Nitrogen and crop rotation effects on fusarium crown rot in no-till spring wheat. Can. J. Plant Pathol. 2009, 31, 456–467. [Google Scholar] [CrossRef] [Scilit]
  14. Agustí-Brisach, C.; Raya-Ortega, M.C.; Trapero, C.; Roca, L.F.; Luque, F.; López-Moral, A.; Fuentes, M.; Trapero, A. First report of Fusarium pseudograminearum causing crown rot of wheat in Europe. Plant Dis. 2018, 102, 1670. [Google Scholar] [CrossRef] [Scilit]
  15. Murray, G.M.; Brennan, J.P. Estimating disease losses to the Australian wheat industry. Australas. Plant Pathol. 2009, 38, 558–570. [Google Scholar] [CrossRef] [Scilit]
  16. Scherm, B.; Balmas, V.; Spanu, F.; Pani, G.; Delogu, G.; Pasquali, M.; Migheli, Q. Fusarium culmorum: Causal agent of foot and root rot and head blight on wheat. Mol. Plant Pathol. 2013, 14, 323–341. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  17. Obanor, F.; Neate, S.; Simpfendorfer, S.; Sabburg, R.; Wilson, P.; Chakraborty, S. Fusarium graminearum and Fusarium pseudograminearum caused the 2010 head blight epidemics in Australia. Plant Pathol. 2013, 62, 79–91. [Google Scholar] [CrossRef] [Scilit]
  18. Smiley, R.W.; Gourlie, J.A.; Easley, S.A.; Patterson, L.M.; Whittaker, R.G. Crop damage estimates for crown rot of wheat and barley in the Pacific Northwest. Plant Dis. 2005, 89, 595–604. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  19. Li, H.L.; Yuan, H.X.; Fu, B.; Xing, X.P.; Sun, B.J.; Tang, W.H. First report of Fusarium pseudograminearum causing crown rot of wheat in Henan, China. Plant Dis. 2012, 96, 1065. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  20. Zhang, X.X.; Sun, H.Y.; Shen, C.M.; Li, W.; Yu, H.S.; Chen, H.G. Survey of Fusarium spp. causing wheat crown rot in major winter wheat growing regions of China. Plant Dis. 2015, 99, 1610–1615. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  21. Ji, L.J.; Kong, L.X.; Li, Q.S.; Wang, L.S.; Chen, D.; Ma, P. First report of Fusarium pseudograminearum causing Fusarium head blight of wheat in Hebei province, China. Plant Dis. 2015, 100, 220. [Google Scholar] [CrossRef] [Scilit]
  22. Xu, F.; Song, Y.L.; Yang, G.Q.; Wang, J.M.; Liu, L.L.; Li, Y.H. First report of Fusarium pseudograminearum from wheat heads with Fusarium head blight in North China Plain. Plant Dis. 2015, 99, 156. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Xu, F.; Song, Y.L.; Wang, J.M.; Liu, L.L.; Zhao, K. First report of Fusarium pseudograminearum causing crown rot on Aegilops tauschii in the North China Plain. Plant Dis. 2018, 102, 1041. [Google Scholar] [CrossRef] [Scilit]
  24. Jiang, H.; Ma, L.G.; Qi, K.; Zhang, Y.L.; Zhang, B.; Ma, G.P.; Qi, J.S. First report of maize seedling blight caused by Fusarium pseudograminearum in China. Plant Dis. 2022, 106, 2519. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Gratz, S.W.; Richardson, A.J.; Duncan, G.; Holtrop, G. Annual variation of dietary deoxynivalenol exposure during years of different Fusarium prevalence: A pilot biomonitoring study. Food Addit. Contam. Part A Chem. Anal. Control Expo. Risk Assess. 2014, 31, 1579–1585. [Google Scholar] [CrossRef] [Scilit]
  26. Obanor, F.; Chakraborty, S. Aetiology and toxigenicity of Fusarium graminearum and Fusarium pseudograminearum causing crown rot and head blight in Australia under natural and artificial infection. Plant Pathol. 2014, 32, 1218–1229. [Google Scholar] [CrossRef] [Scilit]
  27. Monds, R.D.; Cromey, M.G.; Lauren, D.R.; di Menna, M.; Marshall, J. Fusarium graminearum, F. cortaderiae and F. pseudograminearum in New Zealand: Molecular phylogenetic analysis, mycotoxin chemotypes and co-existence of species. Mycol. Res. 2005, 109, 410–420. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  28. Proctor, R.H.; Hohn, T.M.; McCormick, S.P. Reduced virulence of Gibberella zeae caused by disruption of a trichothecene toxin biosynthetic gene. Mol. Plant Microbe Interact. 1995, 8, 593–601. [Google Scholar] [CrossRef] [Scilit]
  29. Jansen, C.; Von Wettstein, D.; Schafer, W.; Kogel, K.H.; Felk, A.; Maier, F.J. Infection patterns in barley and wheat spikes inoculated with wild-type and trichodiene synthase gene disrupted Fusarium graminearum. Proc. Natl. Acad. Sci. USA 2005, 102, 16892–16897. [Google Scholar] [CrossRef] [Scilit]
  30. Xu, F.; Yang, G.; Wang, J.; Song, Y.; Liu, L.; Zhao, K.; Li, Y.; Han, Z. Spatial distribution of root and crown rot fungi associated with winter wheat in the North China Plain and its relationship with climate variables. Front. Microbiol. 2018, 9, 1054. [Google Scholar] [CrossRef] [Scilit]
  31. Zhou, H.; He, X.; Wang, S.; Ma, Q.; Sun, B.; Ding, S.; Chen, L.; Zhang, M.; Li, H. Diversity of the Fusarium pathogens associated with crown rot in the Huanghuai wheat-growing region of China. Environ. Microbiol. 2019, 21, 2740–2754. [Google Scholar] [CrossRef] [Scilit]
  32. Zhang, J.B.; Wang, J.H.; Gong, A.D.; Chen, F.F.; Song, B.; Li, X.; Li, H.P.; Peng, C.H.; Liao, Y.C. Natural occurrence of Fusarium head blight, mycotoxins and mycotoxin-producing isolates of Fusarium in commercial fields of wheat in Hubei. Mycol. Res. 2013, 62, 92–102. [Google Scholar] [CrossRef] [Scilit]
  33. Zhang, J.; Li, H.; Dang, F.; Qu, B.; Xu, Y.; Zhao, C.; Liao, Y. Determination of the trichothecene mycotoxin chemotypes and associated geographical distribution and phylogenetic species of the Fusarium graminearum clade from China. Mycol. Res. 2007, 111, 967–975. [Google Scholar] [CrossRef] [Scilit]
  34. Wang, J.; Li, H.; Qu, B.; Zhang, J.; Huang, T.; Chen, F.; Liao, Y. Development of a generic PCR detection of 3-acetyldeoxynivalenol-, 15-acetyldeoxynivalenol- and nivalenol-chemotypes of Fusarium graminearum clade. Int. J. Mol. Sci. 2008, 9, 2495–2504. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Aoki, T.; O’Donnell, K. Morphological and molecular characterization of F. pseudograminearum sp. nov., formerly recognized as the Group 1 population of Fusarium graminearum. Mycologia 1999, 91, 597–609. [Google Scholar] [CrossRef] [Scilit]
  36. Nicholson, P.; Simpson, D.R.; Weston, G.; Rezanoor, H.N.; Lees, A.K.; Parry, D.W.; Joyce, D. Detection and quantification of Fusarium culmorum and Fusarium graminearum in cereals using PCR assays. Physiol. Mol. Plant Pathol. 1998, 53, 17–37. [Google Scholar] [CrossRef] [Scilit]
  37. Deng, Y.; Liu, Z.; Chen, C.; Sun, H.; Cao, S.; Li, W.; Chen, H. A rapid method for chemotype identification of Fusarium pseudograminearum and its application on the analysis of the isolates from Huanghuai wheat-growing region of China. Acta Phytopathol. Sin. 2023. (In Chinese) [Google Scholar] [CrossRef]
  38. Kerényi, Z.; Moretti, A.; Waalwijk, C.; Oláh, B.; Hornok, L. Mating type sequences in asexually reproducing Fusarium species. Appl. Environ. Microbiol. 2004, 70, 4419–4423. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  39. Wang, J.; Zhao, Z.; Yang, X.; Yang, J.; Gong, A.; Zhang, J.; Chen, L.; Zhou, C. Fusarium graminearum species complex and trichothecene genotype. In Mycotoxins and Food Safety; Sabuncuoglu, S., Ed.; IntechOpen: London, UK, 2019. [Google Scholar]
  40. Deng, Y.Y.; Li, W.; Zhang, P.; Sun, H.Y.; Zhang, X.X.; Zhang, A.X.; Chen, H.G. Fusarium pseudograminearum as an emerging pathogen of crown rot of wheat in eastern China. Plant Pathol. 2020, 69, 240–248. [Google Scholar] [CrossRef] [Scilit]
  41. Bentley, A.R.; Leslie, J.F.; Liew, E.C.; Burgess, L.W.; Summerell, B.A. Genetic structure of Fusarium pseudograminearum populations from the Australian grain belt. Phytopathology 2008, 98, 250–255. [Google Scholar] [CrossRef] [Scilit]
  42. Balmas, V.; Scherm, B.; Marcello, A.; Beyer, M.; Hoffmann, L.; Migheli, Q.; Pasquali, M. Fusarium species and chemotypes associated with Fusarium head blight and Fusarium root rot on wheat in Sardinia. Plant Pathol. 2015, 64, 972–979. [Google Scholar] [CrossRef] [Scilit]
  43. Ward, T.J.; Clear, R.M.; Rooney, A.P.; O’Donnell, K.; Gaba, D.; Patrick, S.; Starkey, D.E.; Gilbert, J.; Geiser, D.M.; Nowicki, T.W. An adaptive evolutionary shift in Fusarium head blight pathogen populations is driving the rapid spread of more toxigenic Fusarium graminearum in North America. Fungal Genet. Biol. 2008, 45, 473–484. [Google Scholar] [CrossRef] [Scilit]
  44. Zhang, H.; Zhang, Z.; van der Lee, T.; Chen, W.Q.; Xu, J.; Xu, J.S.; Yang, L.; Yu, D.; Waalwijk, C.; Feng, J. Population genetic analyses of Fusarium asiaticum populations from barley suggest a recent shift favoring 3ADON producers in Southern China. Phytopathology 2010, 100, 328–336. [Google Scholar] [CrossRef] [Scilit]
  45. Chen, L.; Yang, J.; Wang, H.; Yang, X.; Zhang, C.; Zhao, Z.; Wang, J. NX toxins: New threat posed by Fusarium graminearum species complex. Trends Food Sci. Technol. 2022, 119, 179–191. [Google Scholar] [CrossRef] [Scilit]
  46. Ward, T.J.; Bielawski, J.P.; Kistler, H.C.; Sullivan, E.; O’Donnell, K. Ancestral polymorphism and adaptive evolution in the trichothecene mycotoxin gene cluster of phytopathogenic Fusarium. Proc. Natl. Acad. Sci. USA 2002, 99, 9278–9283. [Google Scholar] [CrossRef] [Scilit]
  47. Liu, Y.Y.; Sun, H.Y.; Li, W.; Xia, Y.L.; Deng, Y.Y.; Zhang, A.X.; Chen, H.G. Fitness of three chemotypes of Fusarium graminearum species complex in major winter wheat-producing areas of China. PLoS ONE 2017, 12, e0174040. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  48. Nicolli, C.P.; Machado, F.J.; Spolti, P.; Del Ponte, E.M. Fitness traits of deoxynivalenol and nivalenolproducing Fusarium graminearum species complex strains from wheat. Plant Dis. 2018, 102, 1341–1347. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  49. Sabburg, R.; Obanor, F.; Aitken, E.; Chakraborty, S. Changing fitness of a necrotrophic plant pathogen under increasing temperature. Glob. Chang. Biol. 2015, 21, 3126–3137. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  50. Zhang, H.; Van der Lee, T.; Waalwijk, C.; Chen, W.; Xu, J.; Xu, J.; Zhang, Y.; Feng, J. Population analysis of the Fusarium graminearum species complex from wheat in China show a shift to more aggressive isolates. PLoS ONE 2012, 7, e31722. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  51. Chakraborty, S.; Obanor, F.; Westecott, R.; Abeywickrama, K. Wheat crown rot pathogen Fusarium graminearum and F. pseudograminearum lacks specialisation. Phytopathology 2010, 100, 1057–1065. [Google Scholar] [CrossRef] [Scilit]
  52. Akinsanmi, O.A.; Mitter, V.; Simpfendorfer, S.; Backhouse, D.; Chakraborty, S. Identity and pathogenicity of Fusarium spp. isolated from wheat fields in Queensland and northern New South Wales. Aust. J. Agric. Res. 2004, 55, 97–107. [Google Scholar] [CrossRef] [Scilit]
  53. Smiley, R.W.; Patterson, L.M. Pathogenic fungi associated with Fusarium foot rot of winter wheat in the semiarid Pacific Northwest. Plant Dis. 1996, 80, 944–949. [Google Scholar] [CrossRef] [Scilit]
  54. Poole, G.J.; Smiley, R.W.; Walker, C.; Huggins, D.; Rupp, R.; Abatzoglou, J.; Garland-Campbell, K.; Paulitz, T.C. Effect of climate on the distribution of Fusarium spp. causing crown rot of wheat in the Pacific Northwest of the United States. Phytopathology 2013, 103, 1130–1140. [Google Scholar] [CrossRef] [Scilit]
  55. Backhouse, D. Forecasting the risk of crown rot between successive wheat crops. Aust. J. Exp. Agric. 2006, 46, 1499. [Google Scholar] [CrossRef] [Scilit]
  56. Knight, N.L.; Sutherland, M.W. Assessment of Fusarium pseudograminearum and F. culmorum biomass in seedlings of potential host cereal species. Plant Dis. 2017, 101, 2116–2122. [Google Scholar] [CrossRef] [Scilit]
  57. Župunski, V.; Jevtić, R.; Lalošević, M.; Mikić, S.; Orbović, B. The applicability of species- and trichothecene-specific primers in monitoring the Fusarium graminearum species complex and its impact on the surveillance of Fusarium head blight in winter wheat in Serbia. Agronomy 2021, 11, 778. [Google Scholar] [CrossRef] [Scilit]
  58. Boamah, S.; Zahang, S.; Xu, B.; Li, T.; Calderón-Urrea, A. Trichoderma longibrachiatum (TG1) enhances wheat seedlings tolerance to salt stress and resistance to Fusarium pseudograminearum in China. Front. Plant Sci. 2021, 12, 741231. [Google Scholar] [CrossRef] [Scilit]
  59. Li, Q.; Hao, X.; Guo, Z.; Qu, K.; Gao, M.; Song, G.; Yin, Z.; Yuan, Y.; Dong, C.; Niu, J.; et al. Screening and resistance locus identification of the mutant fcrZ22 resistant to crown rot caused by Fusarium pseudograminearum. Plant Dis. 2024, 108, 426–433. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  60. McDonald, B.A.; Linde, C. The population genetics of plant pathogens and breeding strategies for durable resistance. Euphytica 2002, 124, 163–180. [Google Scholar] [CrossRef] [Scilit]
  61. Southwell, R.J.; Moore, K.J.; Manning, W.; Hayman, P.T. An outbreak of Fusarium head blight of durum wheat on the Liverpool Plains in northern New South Wales in 1999. Australas. Plant Pathol. 2003, 32, 465–471. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Locations of sampling sites in the 18 cities of Henan (indicated with flags), China, in 2023.
Figure 1. Locations of sampling sites in the 18 cities of Henan (indicated with flags), China, in 2023.
Jof 10 00240 g001
Table 1. Climatic conditions of different sampling sites in Henan from April to June 2023.
Table 1. Climatic conditions of different sampling sites in Henan from April to June 2023.
Sample SiteAprilMayJune
Mean Temperature (°C)Mean Relative Humidity (%)Precipitation (mm)Mean Temperature (°C)Mean Relative Humidity (%)Precipitation (mm)Mean Temperature (°C)Mean Relative Humidity (%)Precipitation (mm)
Anyang15.659.0118.220.567.0133.427.052.026.6
Puyang15.565.0194.020.566.024.227.562.035.7
Hebi15.365.091.020.370.077.327.353.056.0
Xinxiang15.865.076.220.870.095.427.457.011.3
Jiaozuo15.662.0115.921.567.045.927.457.098.5
Jiyuan15.565.056.320.371.0194.326.758.060.9
Zhengzhou16.563.029.921.575.0174.227.568.044.3
Kaifeng16.561.065.821.367.0119.027.360.031.7
Shangqiu15.468.077.720.373.0133.926.166.063.2
Zhoukou16.367.063.220.973.0140.926.667.081.2
Xuchang15.569.054.020.573.0131.026.366.057.2
Luohe16.360.0166.521.572.0111.725.566.053.7
Pingdingshan15.458.0102.720.568.035.726.365.013.7
Luoyang15.659.084.820.169.0123.925.662.051.2
Sanmenxia15.159.047.418.568.0104.925.558.08.8
Nanyang16.667.042.720.773.0122.125.072.0194.1
Zhumadian16.468.0102.220.676.0177.125.770.0213.0
Xinyang16.567.039.520.576.0143.227.571.085.5
Table 2. Primers used in this study.
Table 2. Primers used in this study.
PrimerNucleotide Sequence (5′ to 3′)Reference
Tri13P1CTC(G/C)ACCGCATCGAAGA(G/C)TCTC[34]
Tri13P2GAA(G/C)GTCGCA(A/G)GACCTTGTTTC[34]
Fp1-1CGGGGTAGTTTCACATTTC(C/T)G[35]
Fp1-2GAGAATGTGATGA(C/G)GACAATA[35]
Fg16FCTCCGGATATGTTGCGTCAA[36]
Fg16RGGTAGGTATCCGACATGGCAA[36]
3AT8-1CCTTATGACTCCCCCGATGTCG[37]
3AT8-2TGTTTACCACCAGACCGGAC[37]
15AT8-1AAGCGCGCTCATGTCAGTCCAAGTT[37]
15AT8-2GCCCACCGACAGTATTCCTT[37]
NIVT8-1GTACACCGCGAGCGCTATTTCTTCT[37]
NIVT8-2CGTGAGACCCAACAGCAT[37]
fusALPHAforCGCCCTCT(G/T)AA(C/T)G(C/G)CTTCATG[38]
fusALPHArevGGA(A/G)TA(A/G)AC(C/T)TTAGCAAT(C/T)AGGGC[38]
fusHMGforCGACCTCCCAA(C/T)GC(C/T)TACAT[38]
fusHMGrevTGGGCGGTACTGGTA(A/G)TC(A/G)GG[38]
Table 3. Trichothecene genotypes of Fusarium pseudograminearum strains isolated from Henan, China, in 2023.
Table 3. Trichothecene genotypes of Fusarium pseudograminearum strains isolated from Henan, China, in 2023.
CitySampling SiteStrain NumberNumber of Strains
3ADON15ADONNIV
Anyang35°59′42.702″ N, 114°32′54.676″ E8080
Puyang35°39′27.836″ N, 115°22′20.830″ E8170
Hebi35°42′51.059″ N, 114°19′8.590″ E7070
Xinxiang35°9′28.497″ N, 113°50′0.940″ E5140
Jiaozuo35°5′5.527″ N, 112°49′58.265″ E6150
Jiyuan35°5′10.142″ N, 112°38′18.015″ E11290
Zhengzhou34°25′33.189″ N, 113°38′2.691″ E110110
Kaifeng34°44′36.787″ N, 114°37′56.559″ E10190
Shangqiu34°34′47.536″ N, 115°15′47.639″ E7070
Zhoukou33°42′38.148″ N, 114°32′32.892″ E5050
Xuchang33°54′55.083″ N, 113°51′4.283″ E141130
Luohe33°46′9.229″ N, 113°57′52.073″ E7070
Pingdingshan33°38′31.425″ N, 113°7′24.507″ E9081
Luoyang34°38′4.856″ N, 112°29′5.618″ E5050
Sanmenxia34°43′16.480″ N, 111°45′25.842″ E5050
Nanyang32°55′18.865″ N, 112°23′3.635″ E100100
Zhumadian32°55′33.584″ N, 113°48′8.004″ E8260
Xinyang32°32′12.907″ N, 115°13′54.549″ E7070
Total14391331
Table 4. Mating type data of Fusarium pseudograminearum strains isolated from Henan, China, in 2023.
Table 4. Mating type data of Fusarium pseudograminearum strains isolated from Henan, China, in 2023.
CityStrain NumberNumber and Frequency (%)χ2p-Value
MAT-1MAT-2
Anyang81 (12.5)7 (87.5)4.5000.034 *
Puyang88 (100.0)0 (0)8.0000.005 *
Hebi75 (71.4)2 (28.6)1.2860.257
Xinxiang52 (40.0)3 (60.0)0.2000.655
Jiaozuo62 (33.3)4 (66.7)0.6670.414
Jiyuan114 (36.4)7 (63.6)0.8180.366
Zhengzhou118 (72.7)3 (27.3)2.2730.132
Kaifeng103 (30.0)7 (70.0)1.6000.206
Shangqiu72 (28.6)5 (71.4)1.2860.257
Zhoukou52 (40.0)3 (60.0)0.2000.655
Xuchang1411 (78.6)3 (21.4)4.5710.033 *
Luohe72 (28.6)5 (71.4)1.2860.257
Pingdingshan95 (55.6)4 (44.4)0.1110.739
Luoyang53 (60.0)2 (40.0)0.2000.655
Sanmenxia54 (80.0)1 (20.0)1.8000.180
Nanyang107 (70.0)3 (30.0)1.6000.206
Zhumadian87 (87.5)1 (12.5)4.5000.034 *
Xinyang74 (57.1)3 (42.9)0.1430.705
Total14380 (55.9)63 (44.1)2.0210.155
* A mating type ratio significantly different from 1:1 (p = 0.05).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhang, J.; Zhang, J.; Wang, J.; Zhang, M.; Li, C.; Wang, W.; Suo, Y.; Song, F. Population Genetic Analyses and Trichothecene Genotype Profiling of Fusarium pseudograminearum Causing Wheat Crown Rot in Henan, China. J. Fungi 2024, 10, 240. https://doi.org/10.3390/jof10040240

AMA Style

Zhang J, Zhang J, Wang J, Zhang M, Li C, Wang W, Suo Y, Song F. Population Genetic Analyses and Trichothecene Genotype Profiling of Fusarium pseudograminearum Causing Wheat Crown Rot in Henan, China. Journal of Fungi. 2024; 10(4):240. https://doi.org/10.3390/jof10040240

Chicago/Turabian Style

Zhang, Jianzhou, Jiahui Zhang, Jianhua Wang, Mengyuan Zhang, Chunying Li, Wenyu Wang, Yujuan Suo, and Fengping Song. 2024. "Population Genetic Analyses and Trichothecene Genotype Profiling of Fusarium pseudograminearum Causing Wheat Crown Rot in Henan, China" Journal of Fungi 10, no. 4: 240. https://doi.org/10.3390/jof10040240

APA Style

Zhang, J., Zhang, J., Wang, J., Zhang, M., Li, C., Wang, W., Suo, Y., & Song, F. (2024). Population Genetic Analyses and Trichothecene Genotype Profiling of Fusarium pseudograminearum Causing Wheat Crown Rot in Henan, China. Journal of Fungi, 10(4), 240. https://doi.org/10.3390/jof10040240

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop