Next Article in Journal
Clinical Relevance of Different Loads of Perivascular Spaces According to Their Localization in Patients with a Recent Small Subcortical Infarct
Previous Article in Journal
Diagnostic Methods of Atherosclerotic Plaque and the Assessment of Its Prognostic Significance—A Narrative Review
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
JCDD
Volume 11
Issue 11
10.3390/jcdd11110344
jcdd-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

cpt1b Regulates Cardiomyocyte Proliferation Through Modulation of Glutamine Synthetase in Zebrafish

by
Xiaohan Cheng
,
Jingyi Ju
,
Wenping Huang
,
Zongyi Duan
and
Yanchao Han
*
Institute for Cardiovascular Science and Department of Cardiovascular Surgery of the First Affiliated Hospital of Soochow University, Suzhou Medical College, Soochow University, Suzhou 215000, China
*
Author to whom correspondence should be addressed.
J. Cardiovasc. Dev. Dis. 2024, 11(11), 344; https://doi.org/10.3390/jcdd11110344
Submission received: 13 August 2024 / Revised: 11 October 2024 / Accepted: 14 October 2024 / Published: 1 November 2024
(This article belongs to the Section Cardiac Development and Regeneration)
Browse Figures
Versions Notes

Abstract

Carnitine palmitoyltransferase 1b (Cpt1b) is a crucial rate-limiting enzyme in fatty acid metabolism, but its role and mechanism in early cardiac development remains unclear. Here, we show that cpt1b regulates cardiomyocyte proliferation during zebrafish development. Knocking out entire cpt1b coding sequences leads to impaired cardiomyocyte proliferation, while cardiomyocyte-specific overexpression of cpt1b promotes cardiomyocyte proliferation. RNA sequencing analysis and pharmacological studies identified glutamine synthetase as a key downstream effector of cpt1b in regulating cardiomyocyte proliferation. Our study elucidates a novel mechanism whereby cpt1b promotes zebrafish cardiomyocyte proliferation through glutamine synthetase, which provides new perspectives on the significance of fatty acid metabolism in heart development and the interplay between fatty acid and amino acid metabolic pathways.

1. Introduction

Cardiomyocyte proliferation is essential for heart development and regeneration. In the zebrafish embryos, cardiac progenitor cells converge at the midline and subsequently undergo asymmetric movements, culminating in the formation of a tubular heart, which then undergoes cardiac looping and jogging movements to give rise to the distinct heart chambers [1,2,3]. Concurrent with the widespread migration and morphogenesis, massive new cardiomyocytes are generated from progenitor cells and/or existing cardiomyocytes, facilitating the rapid growth and expansion of the heart chambers [4,5].
The regulation of cardiomyocyte proliferation is a complex process involving multiple signaling pathways and molecular mechanisms. Recent studies have highlighted the importance of metabolic regulation in cardiomyocyte proliferation [6,7,8,9]. Fatty acid metabolism, particularly the β-oxidation pathway, plays a critical role in energy production and cellular growth during development and tissue proliferation. Carnitine palmitoyltransferase 1 (CPT1), a rate-limiting enzyme instrumental in facilitating fatty acid transport into the mitochondria, thereby fueling β-oxidation, is a crucial regulator of this process [10]. The CPT1 family comprises three major tissue-specific isoforms: CPT1A, CPT1B, and CPT1C [11,12,13,14], among which CPT1B is the most abundant in the heart and skeletal muscle [15,16,17]. In neonatal and adult mouse hearts, inhibition of Cpt1b has been shown to stimulate the proliferation of cardiomyocytes, while concurrently impeding their maturation [18,19]. However, a recent study has unveiled that fatty acid oxidation and cpt1b play an indispensable role in cardiomyocyte proliferation during zebrafish ventricle regeneration [20]. Furthermore, knocking out cpt1b in zebrafish has been found to augment glucose utilization and protein deposition in the liver and muscle [21]. Despite these findings, the precise role of cpt1b in early heart development and cardiomyocyte proliferation remains obscure, necessitating further investigation to elucidate its mechanisms of action.
Glutamine, a non-essential amino acid, serves as a critical precursor for biosynthesis and energy production, playing a pivotal role in maintaining tissue growth and homeostasis [22,23,24]. The enzymatic synthesis of glutamine within cells is catalyzed by glutamine synthetase (GS), also known as glutamate-ammonia ligase (GLUL) [25]. Comprehensive studies have shown that GLUL can modulate cancer cell proliferation and tumor growth under diverse conditions, either dependent on or independent of glutamine synthesis and metabolism [26,27,28]. However, the function of GLUL in cardiac development and cardiomyocyte proliferation is still largely unknown.
In this study, we generated a cpt1b knockout and a cardiac-specific cpt1b overexpressing transgenic zebrafish line to elucidate the impact of cpt1b on cardiomyocyte proliferation in zebrafish embryos. We further employed RNA sequencing and pharmacological approaches to unravel the role of glutamine biosynthesis and Glul genes in this process.

2. Materials and Methods

2.1. Zebrafish Husbandry

Wild-type and transgenic zebrafish of the AB strain were used in this study. They were maintained in a dedicated zebrafish breeding unit (ESEN Science & Technology, Beijing, China) with a daily light cycle of 14 h of light and 10 h of darkness. The zebrafish were fed with Artemia twice daily. The water temperature was approximately 28 °C, with a pH of around 7.2, and conductivity of approximately 500 µS/cm. Embryos were obtained through natural mating and cultured at 28.5 °C. The knock-in, transgenic and knockout strains used in this study were pcnamGFP,pd392 [29], Tg(myl7:H2A-mCherry)sd12 [30], and Tg(myl7:cpt1b-TBFP)hs3 (this study) and cpt1bhs4 (this study).

2.2. Generation of cpt1b Knockout Zebrafish

The cpt1b knockout allele was generated using CRISPR/Cas9-mediated genomic editing technology. Briefly, guide RNAs targeting the 5’ UTR (5′-TGCTTTAAGCCTGTATAATGG-3′) and 3’ UTR (5′-TGAAGCTTCTTGGTTTACGG-3′) of the cpt1b gene were generated and co-injected with Cas9 protein into one-cell stage zebrafish embryos as described [31]. Injected embryos were raised to adulthood and screened for germline transmission with PCR, followed by Sanger sequencing of amplicons from F1 animals to confirm the mutation. The cpt1b knockout used in this study was genotyped with the following primers which can produce amplicons of 398 bp or 278 bp for wild-type or knockout alleles, respectively:
cpt1b-1f: 5′-AGATCTTTCCACTGTTGCCATT-3′;
cpt1b-2f: 5′-TGCAGCAACATCAACGCAGTC-3′;
cpt1b-2r: 5′-ATTCGCTAGGCTTGTTACTTGC-3′.

2.3. Generation of Tg(myl7:cpt1b-TBFP) Transgenic Zebrafish

To generate the Tg(myl7:cpt1b-TBFP) transgenic line, the 2.7 kb cpt1b coding sequences were amplified from a zebrafish cDNA library and inserted into a Tol2/I-SceI vector containing a 0.9 kb myl7 promoter sequence and a P2A-TBFP coding sequence using Golden Gate cloning [31]. The plasmid was then purified, linearized with I-SceI meganuclease (R0694S, New England BioLabs, Ipswich, MA, USA), and microinjected into one-cell stage zebrafish embryos. Stable transgenic founders were identified by screening zebrafish embryos that exhibited cardiac blue fluorescence under a Zeiss Axio Zoom V16 stereomicroscope (Oberkochen, Germany).

2.4. In Situ Hybridization

To generate the cpt1b probe template, a partial cpt1b coding sequence was amplified from a zebrafish cDNA library with primers cpt1b fwd GAAGCACATGGATACGATCC, rev GTGTCAATGAGATTGAGCTG. The resulting amplicon was cloned into a customized vector and subsequently used as a template to transcribe a Digoxigenin-labeled RNA probe in vitro. In situ hybridization and imaging were performed as previously described [32].

2.5. Cryosection

Adult zebrafish were anesthetized with a 0.2 mg/mL tricaine solution (T0941-25G, Tokyo Chemical Industry, Tokyo, Japan), and the hearts were excised and fixed in 4% paraformaldehyde (PFA, P6148, Sigma-Aldrich, St. Louis, MO, USA) overnight at 4 °C. Subsequently, the hearts were immersed in a 30% sucrose solution (A502792-0500, Sangon Biotech, Shanghai, China) and embedded in an OCT (optimal cutting temperature) compound (4583, Sakura Finetek, Tokyo, Japan). The heart blocks were mounted on a cryostat and sectioned into 10 µm thick slices with a microtome (CM1950, Leica Biosystems, Wetzlar, Germany) and the slides were dried on a hot surface at 42 °C for a duration of 2 h.

2.6. Drug Treatment

L-methionine sulfoximide (MSO, M5379, Sigma-Aldrich, St. Louis, MO, USA) was dissolved in reverse osmosis water to a final concentration of 250 mM and stored at −20 °C. Zebrafish embryos were screened based on fluorescence expression and subsequently treated with egg water either with or without 250 µM MSO at 3 dpf (days post fertilization). Twenty-four hours later, the embryos were rinsed and fixed with 4% PFA overnight at 4 °C.

2.7. Cardiomyocyte Proliferation Assay

Embryonic zebrafish hearts were carefully excised using fine-tip tweezers and subsequently mounted on the bottom of glass-bottomed Petri dishes containing 0.8% low-melting-point agarose (A600015, Sangon Biotech, Shanghai, China). Confocal microscopic images were acquired using a Zeiss LSM 880 inverted confocal microscope and Zen 3.1 software. Cardiomyocytes were quantified using ImageJ software (version 1.54f). The cardiomyocyte proliferation index was calculated by dividing the number of Pcna+/mCherry+ cells by the total number of mCherry+ cells.

2.8. Quantification of Adult Zebrafish Ventricular Area

Adult zebrafish were anesthetized using tricaine and the hearts were excised and briefly fixed in 4% PFA. Subsequently, the hearts were imaged under a Zeiss stereo microscope and ventricular areas were measured using Zen 3.1 software.

2.9. RNA Sequencing

Total RNA was extracted from a pool of ten adult zebrafish hearts for each biological replicate. Library preparation, RNA sequencing and bioinformatic analysis were performed at Gene Denovo Biotechnology (Guangzhou, China). Briefly, RNA quality was assessed on an Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA). Then, the cDNA libraries were constructed using NEBNext Ultra RNA Library Prep Kit for Illumina (7530, New England Biolabs, Ipswich, MA, USA), and were sequenced using an Illumina Novaseq6000 platform (San Diego, CA, USA). Differential gene analysis was performed using DESeq2 software (version 1.24.0) [33] with |log2(fold change)| ≥ 1 and p-value < 0.05 serving as the criteria to identify differentially expressed genes.

2.10. Quantitative RT-PCR

Total RNA was extracted from 30 zebrafish embryos or 4–8 adult zebrafish hearts per biological replicate using Trizol (R0016, Beyotime Biotechnology, Shanghai, China). Subsequently, 0.5 μg total RNA was reversed transcribed using HiScript II Q RT SuperMix (R223-01, Vazyme, Nanjing, China) for qPCR. The primers used were listed as follows (5’-3’):
cpt1b: fwd: CTCCCCAACAGCAGCTCAAT, rev: AAGCGGAAAGAATCCGTCTCA;
glula: fwd: CACTAAGGAAATGCGGGAAG, rev: AGTGAGTCGACGAGCATTGT;
glulb: fwd: CACCAACTTCAGCACCAAGG, rev: TTGTCCAGCCCTCCTTTAGG;
rpl4: fwd: GGCCAGGGTGCTTTCGGAAA, rev: TTGGCCATGACAAGGGATGG.
qPCR was performed using AceQ Universal SYBR qPCR Master Mix (Q511-02, Vazyme, China) on an ABI StepOnePlus Real-Time PCR System. Gene expression was quantified using the ΔΔCT method with rpl4 as an internal control. At least three independent biological replicates were performed for each experiment.

2.11. Statistical Analysis

All data are presented as mean ± standard deviation (SD). Statistical analyses were performed using Student’s t-test and/or one-way analysis of variance (ANOVA) unless otherwise stated.

3. Results

3.1. Loss of cpt1b Function Inhibits Cardiomyocyte Proliferation in Zebrafish Embryos

To circumvent the potential genetic compensation and/or cryptic downstream translational initiation events [34,35], we utilized the CRISPR/Cas9 genomic editing system to generate a complete knockout of the coding region of the cpt1b gene (Figure 1A). Since the two guide RNAs target the 5’ untranslated region (UTR) and 3’ UTR, respectively, the resultant knockout lacks the entire cpt1b coding sequences (Figure 1B,C). Consistent with the design, when detected with in situ hybridization using a riboprobe spanning exons 10 to 16 of cpt1b gene, cpt1b expression was detected in the heart, liver, and muscle tissues of wild-type (WT) embryos but were completely absent in the knockout embryos (Figure 1D). Subsequently, we quantified the expression level of cpt1b coding sequences using reverse transcription quantitative polymerase chain reaction (RT-qPCR). As shown in Figure 1E, the expression level of cpt1b coding sequences in heterozygous embryos (cpt1b+/−) was significantly downregulated, reaching 47% of that in wild-type embryos, whereas the expression of cpt1b in homozygous embryos (cpt1b−/−) was virtually abolished, plummeting to a mere 0.06% of the wild-type level. Similarly, in adult hearts, the expression levels of cpt1b coding sequences of cpt1b+/− and cpt1b−/− zebrafish were also markedly decreased to 37% and 0.01% of the wild-type level, respectively (Figure 1F). These data collectively demonstrate that the cpt1b knockout constitutes a null mutation, devoid of functional coding sequences, thereby providing a valuable tool for investigating the consequences of cpt1b loss in subsequent studies.
To investigate the effects of cpt1b deficiency on cardiomyocyte proliferation during zebrafish development, we crossed the cpt1b knockout zebrafish with a double-transgenic zebrafish line, Tg(pcnamGFP;myl7:H2A-mCherry), which features a cardiac-specific myl7 promoter-driven expression of nuclear H2A-mCherry fusion protein in cardiomyocytes. Additionally, this line harbors a monomeric green fluorescent protein (mGFP) knock-in at the C-terminal of the proliferating cell nuclear antigen (pcna) gene, resulting in a fusion of mGFP to the endogenous Pcna protein to label the nuclei of cycling cells with green fluorescence. Consequently, the dual-fluorescence labeling enables the real-time, in vivo monitoring of cardiomyocyte proliferation (Figure 1G). Subsequently, the hearts were excised at 4 dpf and imaged under confocal laser microscope. In the hearts of wild-type (cpt1b+/+) zebrafish, approximately 24% of cardiomyocytes were Pcna-positive, whereas in the hearts of cpt1b−/− zebrafish embryos, only 18% of cardiomyocytes were Pcna-positive (Figure 1G,H). Consequently, the ventricles of adult cpt1b knockout zebrafish exhibited a marked 23% reduction in size compared to those of their wild-type siblings (Figure 1I). These data suggest that the cpt1b mutation exerts a significant inhibitory effect on cardiomyocyte proliferation during zebrafish heart development.

3.2. Overexpression of cpt1b Promotes Cardiomyocyte Proliferation in Zebrafish Embryos

To investigate the impact of elevated cpt1b expression on cardiomyocyte proliferation, we generated a transgenic zebrafish line, hereafter referred to as Tg(myl7:cpt1b-TBFP) or cpt1bOE for short, which overexpresses cpt1b specifically in cardiomyocytes by employing the cardiac-specific myl7 promoter to drive the expression of the zebrafish cpt1b gene and mTagBFP2, a monomeric blue fluorescent protein, separated by the self-cleaving peptide P2A (Figure 2A), which can be screened by blue fluorescence in the heart (Figure 2B). Whole-mount in situ hybridization revealed that the expression of cpt1b was significantly increased in the hearts of cpt1bOE embryos, without affecting its expression in other tissues and organs, compared to their wild-type siblings at 3 dpf (Figure 2C). Furthermore, the expression of the cpt1b gene was also significantly increased in the cardiomyocytes of adult cpt1bOE zebrafish hearts (Figure 2D), exhibiting a remarkable 11-fold increase compared to their WT siblings (Figure 2E). These results demonstrate that cpt1b expression is significantly upregulated in the cardiomyocytes of Tg(myl7:cpt1b-TBFP) transgenic zebrafish.
We then crossed the Tg(myl7:cpt1b-TBFP) zebrafish with the Tg(pcnamGFP;myl7:H2A-mCherry) zebrafish to investigate the impact of cpt1b overexpression on cardiomyocyte proliferation. Confocal microscopic imaging and quantification revealed that the proportion of Pcna-positive cardiomyocytes in the cpt1bOE hearts was significantly elevated, exhibiting a 20% increase compared to their WT sibling hearts (Figure 2F,G). Notably, the ventricular areas of adult cpt1bOE zebrafish were increased by 27% compared to those of their wild-type counterparts (Figure 2H). Collectively, these findings suggest that cardiomyocyte-specific cpt1b overexpression can enhance cardiomyocyte proliferation during zebrafish heart development.

3.3. Glul Mediates cpt1b-Induced Cardiomyocyte Proliferation in Zebrafish

To decipher the transcriptomic adaptations in the hearts with modified cpt1b expression and to uncover the potential molecular mechanisms underlying cpt1b-regulated cardiomyocyte proliferation, we performed RNA sequencing on hearts isolated from adult cpt1b-knockout (cpt1b−/−) and cpt1b-overexpressing (cpt1bOE) zebrafish alongside their corresponding wild-type siblings. Primary analysis disclosed a total of 997 upregulated and 3245 downregulated genes in the hearts of cpt1b−/− zebrafish, whereas 417 genes were upregulated and 129 genes were downregulated in the cpt1bOE hearts. Subsequent conjoint analysis identified 171 genes that exhibited a reciprocal expression pattern, being upregulated in cpt1b−/− hearts and downregulated in cpt1bOE hearts, or vice versa (Figure 3A, Supplementary Table S1).
Gene Ontology (GO) enrichment analysis revealed that these genes are predominantly implicated in biological processes such as glutamine biosynthesis, adult heart development, small molecule metabolism, cell cycle DNA replication, and myofilament sliding (Figure 3B). Notably, glutamine biosynthesis emerged as the most prominently enriched process. Given that the zebrafish genome possesses three glutamine synthesis genes, and two of them, glula and glulb, were upregulated in cpt1bOE hearts and downregulated in cpt1b−/− hearts (Figure 3A), we hypothesized that they may play a crucial role in mediating cpt1b-induced cardiomyocyte proliferation in zebrafish. To test this hypothesis, we conducted RT-qPCR to validate their expression in the hearts. In accordance with the RNA sequencing results, RT-qPCR analysis confirmed that the expression of glula and glulb was significantly downregulated, by 69% and 53%, respectively, in cpt1b−/− hearts, whereas their expression was markedly increased, by 2.5-fold and 54%, respectively, in the cpt1bOE hearts relative to their wild-type counterparts (Figure 3C,D). These data demonstrate that the expression of glula and glulb is indeed subject to regulation by cpt1b levels, suggesting a critical role for cpt1b in modulating the expression of glutamine synthetase genes, which may, in turn, influence cardiomyocyte proliferation.
L-methionine sulfoximine (MSO), a glutamate analog, irreversibly binds to the active site of glutamine synthetase, thereby inhibiting its enzymatic activity [36]. To further elucidate the potential role of Glul in regulating cardiomyocyte proliferation in zebrafish, we collected double- or triple-transgenic embryos from the cross between Tg(myl7:cpt1b-TBFP) and Tg(pcnamGFP;myl7:H2A-mCherry) zebrafish, and treated them either with or without 250 µM MSO at 3 dpf. After 24 h of treatment, the embryos were fixed and their hearts were carefully dissected and subsequently imaged using a confocal laser microscope to assess cardiomyocyte proliferation. In wild-type embryos lacking cpt1b overexpression, the proportion of Pcna-positive cardiomyocytes in MSO-treated hearts was statistically indistinguishable from that observed in vehicle-treated hearts. In contrast, the proportion of Pcna-positive cardiomyocytes in cpt1bOE embryos without MSO treatment exhibited a marked 23% increase compared to wild-type hearts. However, MSO treatment dramatically reduced the proportion of Pcna-positive cardiomyocytes in cpt1bOE embryos by 18% relative to vehicle treatment (Figure 3E), demonstrating that inhibiting Glul can effectively mitigate the cardiomyocyte proliferation induced by cpt1b overexpression. Taken together, these data suggest that Glul may play a pivotal role in modulating the effects of cpt1b on cardiomyocyte proliferation, potentially uncovering a novel metabolic regulatory axis in cardiac development.

4. Discussion

The present study demonstrates that cpt1b plays a critical role in regulating cardiomyocyte proliferation during zebrafish heart development. Our findings show that loss of cpt1b function leads to impaired cardiomyocyte proliferation, whereas cardiomyocyte-specific overexpression of cpt1b promotes cardiomyocyte proliferation. Notably, we identified glutamine synthetase (Glul) as a key downstream effector of cpt1b in regulating cardiomyocyte proliferation.
Cardiomyocyte proliferation is essential for heart development and regeneration after injury. Numerous studies have demonstrated that metabolic pathways are involved in the regulation of cell proliferation in the context of heart regeneration [6,7,37,38,39]. Nevertheless, the explorations of their roles in early cardiac development remain relatively scarce. The present study offers new insights into the role of Cpt1b in early cardiac development and extends its function in regulating cellular proliferation, although additional proliferation assays at later timepoints are necessary to fully understand the influence of Cpt1b on cardiomyocyte proliferation. Consistent with our findings, a recent study discovered that fatty acid oxidation and cpt1b are vital for cardiomyocyte proliferation during zebrafish heart regeneration, which involved NF-κB signaling and increased inflammatory response [20]. Conversely, other studies show that inhibition of fatty acid oxidation and/or Cpt1b can enhance cardiomyocyte proliferation and heart regeneration in mice [18,19]. Adding to the complexity, while mouse Cpt1b knockout results in lethality [40], our findings, along with another study [21], demonstrate that zebrafish cpt1b mutants are viable. The disparities in cardiomyocyte proliferation and organismal viability between zebrafish and mice suggest that the function of Cpt1b and/or fatty acid oxidation in cardiomyocyte proliferation may be intricate and species- and/or context-dependent.
The catabolism of fatty acids and glutamine generates substrates that converge on the Krebs cycle at disparate points, indicating potential interaction and synergy between these two metabolic pathways in the regulation of tissue growth and homeostasis [41,42,43,44]. Indeed, CPT1 and glutaminase (GLS)-mediated Angiopoietin-like protein (ANGPTL4)-induced energy metabolism and cell proliferation in non-small cell lung cancer (NSCLC) cells [45], whereas the simultaneous inhibition of CPT1 and GLS enhanced the suppression of proliferation and migration of CB-839-resistant breast cancer cells [46]. In Cpt1b-deficient mouse cardiomyocytes, a substantial increase in α-ketoglutarate, an intermediate in glutamine catabolism, was observed, whereas the levels of glutamine and glutamate were not affected [19]. Our RNA sequencing analysis suggests that cpt1b can regulate glutamine biosynthesis by modulating glutamine synthetase expression, implying a potential direct interaction between fatty acid oxidation and glutamine synthesis that extends beyond the confines of the Krebs cycle. Notwithstanding this finding, further investigations are necessary to elucidate the precise details and underlying mechanisms of the direct interaction between fatty acid and glutamine metabolism.
In conclusion, this study uncovers a novel mechanism whereby cpt1b facilitates zebrafish cardiomyocyte proliferation through the modulation of glul expression, which sheds new light on the intricate metabolic regulation of cardiac development, homeostasis, and regeneration and provides potential therapeutic targets for the development of innovative, metabolism-based interventions for heart diseases.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/jcdd11110344/s1, Table S1: Results of differentially expressed gene analysis of cpt1b knockout and overexpressing hearts compared to their wild-type siblings.

Author Contributions

X.C. and Y.H., conceptual and design of this study. X.C., J.J., W.H. and Z.D. collected the data and/or performed the statistical analysis. X.C. and Y.H., manuscript preparation. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by the National Natural Science Foundation of China (32070825), the Jiangsu Double Innovation Talent Program (JSSCRC2021567), the Natural Science Foundation of Jiangsu Province (BK20200865), the Jiangsu Cardiovascular Medicine Innovation Center (CXZX202210) and a project funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions.

Institutional Review Board Statement

The animal use and procedures were conducted in full accordance with the Animal Care and Use Committee (code 202004A135, 29 April 2020) of Soochow University.

Informed Consent Statement

Not applicable.

Data Availability Statement

The raw sequence data generated in this study have been deposited to the Genome Sequence Archive [47] in China National Center for Bioinformation under the accession number CRA019362.

Acknowledgments

We thank Peidong Han (Zhejiang University) for sharing the Tg(myl7:H2A-mCherry) fish and our laboratory members for critical comments and discussions.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Bakkers, J.; Verhoeven, M.C.; Abdelilah-Seyfried, S. Shaping the zebrafish heart: From left-right axis specification to epithelial tissue morphogenesis. Dev. Biol. 2009, 330, 213–220. [Google Scholar] [CrossRef] [PubMed]
  2. Staudt, D.; Stainier, D. Uncovering the molecular and cellular mechanisms of heart development using the zebrafish. Annu. Rev. Genet. 2012, 46, 397–418. [Google Scholar] [CrossRef] [PubMed]
  3. Tessadori, F.; Tsingos, E.; Colizzi, E.S.; Kruse, F.; van den Brink, S.C.; van den Boogaard, M.; Christoffels, V.M.; Merks, R.M.; Bakkers, J. Twisting of the zebrafish heart tube during cardiac looping is a tbx5-dependent and tissue-intrinsic process. Elife 2021, 10, e61733. [Google Scholar] [CrossRef] [PubMed]
  4. Lombardo, V.A.; Heise, M.; Moghtadaei, M.; Bornhorst, D.; Manner, J.; Abdelilah-Seyfried, S. Morphogenetic control of zebrafish cardiac looping by Bmp signaling. Development 2019, 146, dev180091. [Google Scholar] [CrossRef]
  5. Budine, T.E.; de Sena-Tomas, C.; Williams, M.L.K.; Sepich, D.S.; Targoff, K.L.; Solnica-Krezel, L. Gon4l/Udu regulates cardiomyocyte proliferation and maintenance of ventricular chamber identity during zebrafish development. Dev. Biol. 2020, 462, 223–234. [Google Scholar] [CrossRef]
  6. Honkoop, H.; de Bakker, D.E.; Aharonov, A.; Kruse, F.; Shakked, A.; Nguyen, P.D.; de Heus, C.; Garric, L.; Muraro, M.J.; Shoffner, A.; et al. Single-cell analysis uncovers that metabolic reprogramming by ErbB2 signaling is essential for cardiomyocyte proliferation in the regenerating heart. Elife 2019, 8, e50163. [Google Scholar] [CrossRef]
  7. Fukuda, R.; Marin-Juez, R.; El-Sammak, H.; Beisaw, A.; Ramadass, R.; Kuenne, C.; Guenther, S.; Konzer, A.; Bhagwat, A.M.; Graumann, J.; et al. Stimulation of glycolysis promotes cardiomyocyte proliferation after injury in adult zebrafish. EMBO Rep. 2020, 21, e49752. [Google Scholar] [CrossRef]
  8. Du, J.; Zheng, L.; Gao, P.; Yang, H.; Yang, W.J.; Guo, F.; Liang, R.; Feng, M.; Wang, Z.; Zhang, Z.; et al. A small-molecule cocktail promotes mammalian cardiomyocyte proliferation and heart regeneration. Cell Stem Cell 2022, 29, 545–558.e13. [Google Scholar] [CrossRef]
  9. Gao, F.; Liang, T.; Lu, Y.W.; Pu, L.; Fu, X.; Dong, X.; Hong, T.; Zhang, F.; Liu, N.; Zhou, Y.; et al. Reduced Mitochondrial Protein Translation Promotes Cardiomyocyte Proliferation and Heart Regeneration. Circulation 2023, 148, 1887–1906. [Google Scholar] [CrossRef]
  10. Schlaepfer, I.R.; Joshi, M. CPT1A-mediated Fat Oxidation, Mechanisms, and Therapeutic Potential. Endocrinology 2020, 161, bqz046. [Google Scholar] [CrossRef]
  11. Bonnefont, J.P.; Djouadi, F.; Prip-Buus, C.; Gobin, S.; Munnich, A.; Bastin, J. Carnitine palmitoyltransferases 1 and 2: Biochemical, molecular and medical aspects. Mol. Asp. Med. 2004, 25, 495–520. [Google Scholar] [CrossRef] [PubMed]
  12. Jogl, G.; Tong, L. Crystal structure of carnitine acetyltransferase and implications for the catalytic mechanism and fatty acid transport. Cell 2003, 112, 113–122. [Google Scholar] [CrossRef] [PubMed]
  13. McGarry, J.D.; Brown, N.F. The mitochondrial carnitine palmitoyltransferase system. From concept to molecular analysis. Eur. J. Biochem. 1997, 244, 1–14. [Google Scholar] [CrossRef] [PubMed]
  14. Sierra, A.Y.; Gratacos, E.; Carrasco, P.; Clotet, J.; Urena, J.; Serra, D.; Asins, G.; Hegardt, F.G.; Casals, N. CPT1c is localized in endoplasmic reticulum of neurons and has carnitine palmitoyltransferase activity. J. Biol. Chem. 2008, 283, 6878–6885. [Google Scholar] [CrossRef] [PubMed]
  15. Wu, D.; Jian, C.; Peng, Q.; Hou, T.; Wu, K.; Shang, B.; Zhao, M.; Wang, Y.; Zheng, W.; Ma, Q.; et al. Prohibitin 2 deficiency impairs cardiac fatty acid oxidation and causes heart failure. Cell Death Dis. 2020, 11, 181. [Google Scholar] [CrossRef]
  16. Maples, J.M.; Brault, J.J.; Witczak, C.A.; Park, S.; Hubal, M.J.; Weber, T.M.; Houmard, J.A.; Shewchuk, B.M. Differential epigenetic and transcriptional response of the skeletal muscle carnitine palmitoyltransferase 1B (CPT1B) gene to lipid exposure with obesity. Am. J. Physiol. Endocrinol. Metab. 2015, 309, E345–E356. [Google Scholar] [CrossRef]
  17. Angelini, A.; Saha, P.K.; Jain, A.; Jung, S.Y.; Mynatt, R.L.; Pi, X.; Xie, L. PHDs/CPT1B/VDAC1 axis regulates long-chain fatty acid oxidation in cardiomyocytes. Cell Rep. 2021, 37, 109767. [Google Scholar] [CrossRef]
  18. Cao, T.; Liccardo, D.; LaCanna, R.; Zhang, X.; Lu, R.; Finck, B.N.; Leigh, T.; Chen, X.; Drosatos, K.; Tian, Y. Fatty Acid Oxidation Promotes Cardiomyocyte Proliferation Rate but Does Not Change Cardiomyocyte Number in Infant Mice. Front. Cell Dev. Biol. 2019, 7, 42. [Google Scholar] [CrossRef]
  19. Li, X.; Wu, F.; Gunther, S.; Looso, M.; Kuenne, C.; Zhang, T.; Wiesnet, M.; Klatt, S.; Zukunft, S.; Fleming, I.; et al. Inhibition of fatty acid oxidation enables heart regeneration in adult mice. Nature 2023, 622, 619–626. [Google Scholar] [CrossRef]
  20. Zhao, Y.; Lv, H.; Yu, C.; Liang, J.; Yu, H.; Du, Z.; Zhang, R. Systemic inhibition of mitochondrial fatty acid beta-oxidation impedes zebrafish ventricle regeneration. Biochim. Biophys. Acta Mol. Basis Dis. 2024, 1870, 167442. [Google Scholar] [CrossRef]
  21. Li, L.Y.; Li, J.M.; Ning, L.J.; Lu, D.L.; Luo, Y.; Ma, Q.; Limbu, S.M.; Li, D.L.; Chen, L.Q.; Lodhi, I.J.; et al. Mitochondrial Fatty Acid beta-Oxidation Inhibition Promotes Glucose Utilization and Protein Deposition through Energy Homeostasis Remodeling in Fish. J. Nutr. 2020, 150, 2322–2335. [Google Scholar] [CrossRef] [PubMed]
  22. Jin, J.; Byun, J.K.; Choi, Y.K.; Park, K.G. Targeting glutamine metabolism as a therapeutic strategy for cancer. Exp. Mol. Med. 2023, 55, 706–715. [Google Scholar] [CrossRef]
  23. Cox, A.G.; Hwang, K.L.; Brown, K.K.; Evason, K.; Beltz, S.; Tsomides, A.; O’Connor, K.; Galli, G.G.; Yimlamai, D.; Chhangawala, S.; et al. Yap reprograms glutamine metabolism to increase nucleotide biosynthesis and enable liver growth. Nat. Cell Biol. 2016, 18, 886–896. [Google Scholar] [CrossRef] [PubMed]
  24. Shang, M.; Cappellesso, F.; Amorim, R.; Serneels, J.; Virga, F.; Eelen, G.; Carobbio, S.; Rincon, M.Y.; Maechler, P.; De Bock, K.; et al. Macrophage -derived glutamine boosts satellite cells and muscle regeneration. Nature 2020, 587, 626–631. [Google Scholar] [CrossRef] [PubMed]
  25. Beaudin, S.; Welsh, J. 1,25-Dihydroxyvitamin D Regulation of Glutamine Synthetase and Glutamine Metabolism in Human Mammary Epithelial Cells. Endocrinology 2017, 158, 4174–4188. [Google Scholar] [CrossRef]
  26. Wang, Y.; Fan, S.; Lu, J.; Zhang, Z.; Wu, D.; Wu, Z.; Zheng, Y. GLUL Promotes Cell Proliferation in Breast Cancer. J. Cell Biochem. 2017, 118, 2018–2025. [Google Scholar] [CrossRef]
  27. Tardito, S.; Oudin, A.; Ahmed, S.U.; Fack, F.; Keunen, O.; Zheng, L.; Miletic, H.; Sakariassen, P.O.; Weinstock, A.; Wagner, A.; et al. Glutamine synthetase activity fuels nucleotide biosynthesis and supports growth of glutamine-restricted glioblastoma. Nat. Cell Biol. 2015, 17, 1556–1568. [Google Scholar] [CrossRef]
  28. Issaq, S.H.; Mendoza, A.; Fox, S.D.; Helman, L.J. Glutamine synthetase is necessary for sarcoma adaptation to glutamine deprivation and tumor growth. Oncogenesis 2019, 8, 20. [Google Scholar] [CrossRef]
  29. Becker, C.J.; Cigliola, V.; Gillotay, P.; Rich, A.; De Simone, A.; Han, Y.; Di Talia, S.; Poss, K.D. In toto imaging of glial JNK signaling during larval zebrafish spinal cord regeneration. Development 2023, 150, dev202076. [Google Scholar] [CrossRef]
  30. Han, P.; Bloomekatz, J.; Ren, J.; Zhang, R.; Grinstein, J.D.; Zhao, L.; Burns, C.G.; Burns, C.E.; Anderson, R.M.; Chi, N.C. Coordinating cardiomyocyte interactions to direct ventricular chamber morphogenesis. Nature 2016, 534, 700–704. [Google Scholar] [CrossRef]
  31. Han, Y.; Chen, A.; Umansky, K.B.; Oonk, K.A.; Choi, W.Y.; Dickson, A.L.; Ou, J.; Cigliola, V.; Yifa, O.; Cao, J.; et al. Vitamin D Stimulates Cardiomyocyte Proliferation and Controls Organ Size and Regeneration in Zebrafish. Dev. Cell 2019, 48, 853–863.e855. [Google Scholar] [CrossRef] [PubMed]
  32. Thisse, C.; Thisse, B. High-resolution in situ hybridization to whole-mount zebrafish embryos. Nat. Protoc. 2008, 3, 59–69. [Google Scholar] [CrossRef] [PubMed]
  33. Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef] [PubMed]
  34. Rossi, A.; Kontarakis, Z.; Gerri, C.; Nolte, H.; Holper, S.; Kruger, M.; Stainier, D.Y. Genetic compensation induced by deleterious mutations but not gene knockdowns. Nature 2015, 524, 230–233. [Google Scholar] [CrossRef] [PubMed]
  35. Ma, Z.; Zhu, P.; Shi, H.; Guo, L.; Zhang, Q.; Chen, Y.; Chen, S.; Zhang, Z.; Peng, J.; Chen, J. PTC-bearing mRNA elicits a genetic compensation response via Upf3a and COMPASS components. Nature 2019, 568, 259–263. [Google Scholar] [CrossRef]
  36. Rowe, W.B.; Meister, A. Identification of L-methionine-S-sulfoximine as the convulsant isomer of methionine sulfoximine. Proc. Natl. Acad. Sci. USA 1970, 66, 500–506. [Google Scholar] [CrossRef]
  37. Bae, J.; Salamon, R.J.; Brandt, E.B.; Paltzer, W.G.; Zhang, Z.; Britt, E.C.; Hacker, T.A.; Fan, J.; Mahmoud, A.I. Malonate Promotes Adult Cardiomyocyte Proliferation and Heart Regeneration. Circulation 2021, 143, 1973–1986. [Google Scholar] [CrossRef]
  38. Graham, N.; Huang, G.N. Endocrine Influence on Cardiac Metabolism in Development and Regeneration. Endocrinology 2021, 162, bqab081. [Google Scholar] [CrossRef]
  39. Fajardo, V.M.; Feng, I.; Chen, B.Y.; Perez-Ramirez, C.A.; Shi, B.; Clark, P.; Tian, R.; Lien, C.L.; Pellegrini, M.; Christofk, H.; et al. GLUT1 overexpression enhances glucose metabolism and promotes neonatal heart regeneration. Sci. Rep. 2021, 11, 8669. [Google Scholar] [CrossRef]
  40. Ji, S.; You, Y.; Kerner, J.; Hoppel, C.L.; Schoeb, T.R.; Chick, W.S.; Hamm, D.A.; Sharer, J.D.; Wood, P.A. Homozygous carnitine palmitoyltransferase 1b (muscle isoform) deficiency is lethal in the mouse. Mol. Genet. Metab. 2008, 93, 314–322. [Google Scholar] [CrossRef]
  41. Dankel, S.N.; Kalleklev, T.L.; Tungland, S.L.; Stafsnes, M.H.; Bruheim, P.; Aloysius, T.A.; Lindquist, C.; Skorve, J.; Nygard, O.K.; Madsen, L.; et al. Changes in Plasma Pyruvate and TCA Cycle Metabolites upon Increased Hepatic Fatty Acid Oxidation and Ketogenesis in Male Wistar Rats. Int. J. Mol. Sci. 2023, 24, 15536. [Google Scholar] [CrossRef] [PubMed]
  42. Drury, J.; Geisen, M.E.; Tessmann, J.W.; Rychahou, P.G.; Kelson, C.O.; He, D.; Wang, C.; Evers, B.M.; Zaytseva, Y.Y. Overexpression of Fatty Acid Synthase Upregulates Glutamine-Fructose-6-Phosphate Transaminase 1 and O-Linked N-Acetylglucosamine Transferase to Increase O-GlcNAc Protein Glycosylation and Promote Colorectal Cancer Growth. Int. J. Mol. Sci. 2024, 25, 4883. [Google Scholar] [CrossRef] [PubMed]
  43. Xiao, D.; Zeng, L.; Yao, K.; Kong, X.; Wu, G.; Yin, Y. The glutamine-alpha-ketoglutarate (AKG) metabolism and its nutritional implications. Amino Acids 2016, 48, 2067–2080. [Google Scholar] [CrossRef] [PubMed]
  44. Zhang, R.; Lu, W.; Tu, L.; Lin, Y.; Sun, J.; Chen, B.; Luan, T. Perfluorooctanoic acid-induced metabolic disorder via enhancing metabolism of glutamine and fatty acids in human intestinal cells. Environ. Pollut. 2023, 338, 122684. [Google Scholar] [CrossRef] [PubMed]
  45. Xiao, S.; Nai-Dong, W.; Jin-Xiang, Y.; Long, T.; Xiu-Rong, L.; Hong, G.; Jie-Cheng, Y.; Fei, Z. ANGPTL4 regulate glutamine metabolism and fatty acid oxidation in nonsmall cell lung cancer cells. J. Cell Mol. Med. 2022, 26, 1876–1885. [Google Scholar] [CrossRef]
  46. Reis, L.M.D.; Adamoski, D.; Ornitz Oliveira Souza, R.; Rodrigues Ascencao, C.F.; Sousa de Oliveira, K.R.; Correa-da-Silva, F.; Malta de Sa Patroni, F.; Meira Dias, M.; Consonni, S.R.; Mendes de Moraes-Vieira, P.M.; et al. Dual inhibition of glutaminase and carnitine palmitoyltransferase decreases growth and migration of glutaminase inhibition-resistant triple-negative breast cancer cells. J. Biol. Chem. 2019, 294, 9342–9357. [Google Scholar] [CrossRef]
  47. Chen, T.; Chen, X.; Zhang, S.; Zhu, J.; Tang, B.; Wang, A.; Dong, L.; Zhang, Z.; Yu, C.; Sun, Y.; et al. The Genome Sequence Archive Family: Toward Explosive Data Growth and Diverse Data Types. Genom. Proteom. Bioinform. 2021, 19, 578–583. [Google Scholar] [CrossRef]
Jcdd 11 00344 g001
Figure 1. Loss of cpt1b function inhibits cardiomyocyte proliferation in zebrafish embryos. (A) A schematic representation of the design for generating the cpt1b knockout zebrafish. (B) A representative agarose gel electrophoresis image for the genotyping of cpt1b+/+, cpt1b+/−, and cpt1b−/− zebrafish. (C) Genomic sequences of wild-type (WT) and cpt1b knockout zebrafish around cpt1b guide RNA target sites. The guide RNA target sequences are denoted by red letters, with the protospacer adjacent motif (PAM) sequences underscored, and the coding sequences are represented by capital letters. (D) Whole-mount in situ hybridization analysis of cpt1b expression in cpt1b+/+ and cpt1−/− zebrafish embryos at 4 dpf. The black triangle indicates muscle, the yellow triangle indicates liver, and the red triangle indicates heart. Scale bar: 500 μm. (E) Quantitative RT-PCR analysis of cpt1b mRNA expression in 4 dpf cpt1b+/+, cpt1b+/−, and cpt1b−/− embryos. (F) Quantitative RT-PCR analysis of cpt1b mRNA expression in the hearts of adult cpt1b+/+, cpt1b+/−, and cpt1b−/− zebrafish. ** p < 0.01, *** p < 0.001. (G) Representative maximum intensity projection confocal images of dissected hearts from 4 dpf Tg(pcnamGFP;myl7:H2A-mCherry;cpt1b+/+) and Tg(pcnamGFP;myl7:H2A-mCherry;cpt1b−/−) zebrafish. Enlarged single optical section images of the boxed regions are shown on the right. White triangles indicate proliferating cardiomyocytes. Scale bar: 50 µm. (H) Quantitative analysis of proliferating cardiomyocytes in G. n = 9–20. ** p < 0.01. (I) Quantification of ventricular areas of adult cpt1b+/+ and cpt1b−/− zebrafish. n = 9–10. *** p < 0.001.
Figure 1. Loss of cpt1b function inhibits cardiomyocyte proliferation in zebrafish embryos. (A) A schematic representation of the design for generating the cpt1b knockout zebrafish. (B) A representative agarose gel electrophoresis image for the genotyping of cpt1b+/+, cpt1b+/−, and cpt1b−/− zebrafish. (C) Genomic sequences of wild-type (WT) and cpt1b knockout zebrafish around cpt1b guide RNA target sites. The guide RNA target sequences are denoted by red letters, with the protospacer adjacent motif (PAM) sequences underscored, and the coding sequences are represented by capital letters. (D) Whole-mount in situ hybridization analysis of cpt1b expression in cpt1b+/+ and cpt1−/− zebrafish embryos at 4 dpf. The black triangle indicates muscle, the yellow triangle indicates liver, and the red triangle indicates heart. Scale bar: 500 μm. (E) Quantitative RT-PCR analysis of cpt1b mRNA expression in 4 dpf cpt1b+/+, cpt1b+/−, and cpt1b−/− embryos. (F) Quantitative RT-PCR analysis of cpt1b mRNA expression in the hearts of adult cpt1b+/+, cpt1b+/−, and cpt1b−/− zebrafish. ** p < 0.01, *** p < 0.001. (G) Representative maximum intensity projection confocal images of dissected hearts from 4 dpf Tg(pcnamGFP;myl7:H2A-mCherry;cpt1b+/+) and Tg(pcnamGFP;myl7:H2A-mCherry;cpt1b−/−) zebrafish. Enlarged single optical section images of the boxed regions are shown on the right. White triangles indicate proliferating cardiomyocytes. Scale bar: 50 µm. (H) Quantitative analysis of proliferating cardiomyocytes in G. n = 9–20. ** p < 0.01. (I) Quantification of ventricular areas of adult cpt1b+/+ and cpt1b−/− zebrafish. n = 9–10. *** p < 0.001.
Jcdd 11 00344 g001
Jcdd 11 00344 g002
Figure 2. Overexpression of cpt1b promotes cardiomyocyte proliferation in zebrafish embryos. (A) A schematic representation of the Tg(myl7:cpt1b-TBFP) construct. (B) A stereo fluorescence image of a 3 dpf wild-type sibling and Tg(myl7:cpt1b-TBFP) embryos. The triangles indicate the embryonic hearts. Scale bar: 200 µm. (C) Whole-mount in situ hybridization analysis of cpt1b expression with WT and cpt1bOE zebrafish embryos at 3 dpf. The red boxes demarcate enlarged ventral views of the hearts (red triangles). Scale bar: 500 µm. (D) In situ hybridization analysis of cpt1b expression in cryosections of adult WT and cpt1bOE zebrafish hearts. The red boxes show enlarged views of the denoted regions. Scale bar: 50 µm. (E) Quantitative RT-PCR analysis of cpt1b expression in the hearts of adult WT and cpt1bOE zebrafish. *** p < 0.001. (F) Representative maximum intensity projection confocal images of dissected hearts from 3 dpf Tg(pcnamGFP;myl7:H2A-mCherry) and Tg(pcnamGFP;myl7:H2A-mCherry;myl7:cpt1b-TBFP) embryos. Enlarged single optical section images of the boxed regions are shown on the right. White triangles indicate proliferating cardiomyocytes. Scale bar: 50 µm. (G) Quantitative analysis of proliferating cardiomyocytes in F. * p < 0.05. n = 14–17. (H) Quantification of ventricular areas of adult wild-type and cpt1bOE zebrafish. n = 9–10. ** p < 0.01.
Figure 2. Overexpression of cpt1b promotes cardiomyocyte proliferation in zebrafish embryos. (A) A schematic representation of the Tg(myl7:cpt1b-TBFP) construct. (B) A stereo fluorescence image of a 3 dpf wild-type sibling and Tg(myl7:cpt1b-TBFP) embryos. The triangles indicate the embryonic hearts. Scale bar: 200 µm. (C) Whole-mount in situ hybridization analysis of cpt1b expression with WT and cpt1bOE zebrafish embryos at 3 dpf. The red boxes demarcate enlarged ventral views of the hearts (red triangles). Scale bar: 500 µm. (D) In situ hybridization analysis of cpt1b expression in cryosections of adult WT and cpt1bOE zebrafish hearts. The red boxes show enlarged views of the denoted regions. Scale bar: 50 µm. (E) Quantitative RT-PCR analysis of cpt1b expression in the hearts of adult WT and cpt1bOE zebrafish. *** p < 0.001. (F) Representative maximum intensity projection confocal images of dissected hearts from 3 dpf Tg(pcnamGFP;myl7:H2A-mCherry) and Tg(pcnamGFP;myl7:H2A-mCherry;myl7:cpt1b-TBFP) embryos. Enlarged single optical section images of the boxed regions are shown on the right. White triangles indicate proliferating cardiomyocytes. Scale bar: 50 µm. (G) Quantitative analysis of proliferating cardiomyocytes in F. * p < 0.05. n = 14–17. (H) Quantification of ventricular areas of adult wild-type and cpt1bOE zebrafish. n = 9–10. ** p < 0.01.
Jcdd 11 00344 g002
Jcdd 11 00344 g003
Figure 3. Transcriptomic analysis reveals the potential contribution of Glul in cpt1b-regulated cardiomyocyte proliferation in zebrafish. (A) Nine-quadrant plot illustrating the log2(fold change) of recovered genes in the cpt1b−/− vs. cpt1b+/+ analysis and cpt1bOE vs. WT analysis. Red dots denote genes that were significantly upregulated in cpt1b−/− hearts and concomitantly downregulated in cpt1bOE hearts, blue dots represent genes that were downregulated in cpt1b−/− hearts and upregulated in cpt1bOE hearts, and pink dots highlight the two glutamine synthetase genes. (B) Gene Ontology enrichment analysis of 154 differentially expressed genes revealed significant enrichment of biological processes. The y-axis represents the enriched biological processes, and the x-axis represents the negative logarithm of the p-value. (C) Quantitative RT-PCR analysis of glula and glulb expression in cpt1b+/+ and cpt1b−/− hearts. (D) Quantitative RT-PCR analysis of glula and glulb expression in WT and cpt1bOE hearts. (E) Quantitative analysis of Pcna-positive cardiomyocytes in 4 dpf WT and cpt1bOE zebrafish embryos treated with either vehicle (Ctrl) or 250 µM MSO. n = 10–13. ** p < 0.01, *** p < 0.001, and ns indicates p > 0.05.
Figure 3. Transcriptomic analysis reveals the potential contribution of Glul in cpt1b-regulated cardiomyocyte proliferation in zebrafish. (A) Nine-quadrant plot illustrating the log2(fold change) of recovered genes in the cpt1b−/− vs. cpt1b+/+ analysis and cpt1bOE vs. WT analysis. Red dots denote genes that were significantly upregulated in cpt1b−/− hearts and concomitantly downregulated in cpt1bOE hearts, blue dots represent genes that were downregulated in cpt1b−/− hearts and upregulated in cpt1bOE hearts, and pink dots highlight the two glutamine synthetase genes. (B) Gene Ontology enrichment analysis of 154 differentially expressed genes revealed significant enrichment of biological processes. The y-axis represents the enriched biological processes, and the x-axis represents the negative logarithm of the p-value. (C) Quantitative RT-PCR analysis of glula and glulb expression in cpt1b+/+ and cpt1b−/− hearts. (D) Quantitative RT-PCR analysis of glula and glulb expression in WT and cpt1bOE hearts. (E) Quantitative analysis of Pcna-positive cardiomyocytes in 4 dpf WT and cpt1bOE zebrafish embryos treated with either vehicle (Ctrl) or 250 µM MSO. n = 10–13. ** p < 0.01, *** p < 0.001, and ns indicates p > 0.05.
Jcdd 11 00344 g003
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Cheng, X.; Ju, J.; Huang, W.; Duan, Z.; Han, Y. cpt1b Regulates Cardiomyocyte Proliferation Through Modulation of Glutamine Synthetase in Zebrafish. J. Cardiovasc. Dev. Dis. 2024, 11, 344. https://doi.org/10.3390/jcdd11110344

AMA Style

Cheng X, Ju J, Huang W, Duan Z, Han Y. cpt1b Regulates Cardiomyocyte Proliferation Through Modulation of Glutamine Synthetase in Zebrafish. Journal of Cardiovascular Development and Disease. 2024; 11(11):344. https://doi.org/10.3390/jcdd11110344

Chicago/Turabian Style

Cheng, Xiaohan, Jingyi Ju, Wenping Huang, Zongyi Duan, and Yanchao Han. 2024. "cpt1b Regulates Cardiomyocyte Proliferation Through Modulation of Glutamine Synthetase in Zebrafish" Journal of Cardiovascular Development and Disease 11, no. 11: 344. https://doi.org/10.3390/jcdd11110344

APA Style

Cheng, X., Ju, J., Huang, W., Duan, Z., & Han, Y. (2024). cpt1b Regulates Cardiomyocyte Proliferation Through Modulation of Glutamine Synthetase in Zebrafish. Journal of Cardiovascular Development and Disease, 11(11), 344. https://doi.org/10.3390/jcdd11110344

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop