Antimicrobial Resistance and Virulence Genes in Escherichia coli Isolated from Raptors in Central Italy
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Sampling
2.2. Escherichia coli Isolation
2.3. Antimicrobial Susceptibility Tests
2.4. Molecular Analyses
2.4.1. Genotypic Resistance
| Target Gene | Primer | Sequence 5′ → 3′ | Annealing Temp. (°C) | Amplicon Size (bp) | References |
|---|---|---|---|---|---|
| blaTEM | MultiTSO-T_for | CATTTCCGTGTCGCCCTTATTC | 60 | 800 | [36] |
| MultiTSO-T_rev | CGTTCATCCATAGTTGCCTGAC | ||||
| blaSHV | SHV-F | TTCGCCTGTGTATTATCTCCCTG | 50 | 854 | [37] |
| SHV-R | TTAGCGTTGCCAGTGYTCG | ||||
| blaCTX-M | CTX-F | ATGTGCAGYACCAGTAARGTKATGGC | 60 | 593 | |
| CTX-R | TGGGTRAARTARGTSACCAGAAYCAGCGG | ||||
| blaCMY-1 group | CMY1-F | GTGGTGGATGCCAGCATCC | 58 | 915 | |
| CMY1-R | GGTCGAGCCGGTCTTGTTGAA | ||||
| blaCMY-2 group | CMY2-F | GCACTTAGCCACCTATACGGCAG | 58 | 758 | |
| CMY2-R | GCTTTTCAAGAATGCGCCAGG | ||||
| blaNDM | NDM-F | GGTTTGGCGATCTGGTTTTC | 52 | 621 | [38] |
| NDM-R | CGGAATGGCTCATCACGATC | ||||
| blaKPC | KPC-F | CGTCTAGTTCTGCTGTCTTG | 52 | 798 | |
| KPC-R | CTTGTCATCCTTGTTAGGCG | ||||
| blaOXA-48 | OXA-F | GCGTGGTTAAGGATGAACAC | 52 | 438 | |
| OXA-R | CATCAAGTTCAACCCAACCG | ||||
| blaIMP | IMP-F | GGAATAGAGTGGCTTAAYTCTC | 52 | 232 | |
| IMP-R | GGTTTAAYAAAACAACCACC | ||||
| blaVIM | VIM-F | GATGGTGTTTGGTCGCATA | 52 | 390 | |
| VIM-R | CGAATGCGCAGCACCAG | ||||
| tetA | tetAF | GCTACATCCTGCTTGCCTTC | 64 | 210 | [39] |
| tetAR | CATAGATCGCCGTGAAGAGG | ||||
| tetB | tetBF | TTGGTTAGGGGCAAGTTTTG | 64 | 659 | |
| tetBR | GTAATGGGCCAATAACACCG | ||||
| cat1 | CATI-F | AGTTGCTCAATGTACCTATAACC | 58 | 547 | [40] |
| CATI-R | TTGTAATTCATTAAGCATTCTGCC | ||||
| cmlA | cmlA-F | CCGCCACGGTGTTGTTGTTATC | 58 | 698 | |
| cmlA-R | CACCTTGCCTGCCCATCATTAG |
2.4.2. Virulence Factors
| Pathotype | Gene | Primer | Sequence 5′ → 3′ | Annealing Temp. (°C) | Amplicon Size (bp) | References |
|---|---|---|---|---|---|---|
| STEC/ EHEC | stx1 | stx1F | ATAAATCGCCATTCGTTGACTAC | 60 | 180 | [41] |
| stx1R | GAACGCCCACTGAGATCATC | |||||
| stx2 | stx2F | GGCACTGTCTGAAACTGCTCC | 60 | 255 | ||
| stx2R | TCGCCAGTTATCTGACATTCTG | |||||
| hlyA | hlyAF | GCATCATCAAGCGTACGTTCC | 60 | 534 | ||
| hlyAR | AATGAGCCAAGCTGGTTAAGCT | |||||
| EHEC/ EPEC | eaeA | eaeAF | GACCCGGCACAAGCATAAGC | 60 | 384 | |
| eaeAR | CCACCTGCAGCAACAAGAGG | |||||
| EPEC | escV | MP3-escV-F | ATTCTGGCTCTCTTCTTCTTTATGGCTG | 63 | 544 | [42] |
| MP3-escV-R | CGTCCCCTTTTACAAACTTCATCGC | |||||
| bfpB | MP3-bfpB-F | GACACCTCATTGCTGAAGTCG | 63 | 910 | ||
| MP3-bfpB-R | CCAGAACACCTCCGTTATGC | |||||
| ent | ent-F | TGGGCTAAAAGAAGACACACTG | 63 | 629 | ||
| ent-R | CAAGCATCCTGATTATCTCACC | |||||
| ETEC | elt | MP2-LT-F | GAACAGGAGGTTTCTGCGTTAGGTG | 63 | 655 | |
| MP2-LT-R | CTTTCAATGGCTTTTTTTTGGGAGTC | |||||
| estIa | MP4-STIa-F | CCTCTTTTAGYCAGACARCTGAATCASTTG | 63 | 157 | ||
| MP4-STIa-R | CAGGCAGGATTACAACAAAGTTCACAG | |||||
| estIb | MP2-STI-F | TGTCTTTTTCACCTTTCGCTC | 63 | 171 | ||
| MP2-STI-R | CGGTACAAGCAGGATTACAACAC | |||||
| EIEC | invE | MP2-invE-F | CGATAGATGGCGAGAAATTATATCCCG | 63 | 766 | |
| MP2-invE-R | CGATCAAGAATCCCTAACAGAAGAATCAC | |||||
| EAEC | astA | MP-astA-F | TGCCATCAACACAGTATATCCG | 63 | 102 | |
| MP2-astA-R | ACGGCTTTGTAGTCCTTCCAT | |||||
| aggR | MP2-aggR-F | ACGCAGAGTTGCCTGATAAAG | 63 | 400 | ||
| MP2-aggR-R | AATACAGAATCGTCAGCATCAGC | |||||
| pic | MP2-pic-F | AGCCGTTTCCGCAGAAGCC | 63 | 1111 | ||
| MP2-pic-R | AAATGTCAGTGAACCGACGATTGG | |||||
| NTEC | cnf1 | Cnf1F | GGGGGAAGTACAGAAGAATTA | 55 | 1111 | [43] |
| Cnf1R | TTGCCGTCCACTCTCTCACCAGT | |||||
| cnf2 | Cnf2F | TATCATACGGCAGGAGGAAGCACC | 55 | 1240 | ||
| Cnf2R | GTCACAATAGACAATAATTTTCCG | |||||
| cdt-I | Cdt1F | CAATAGTCGCCCACAGGA | 56 | 412 | ||
| Cdt1R | ATAATCAAGAACACCACCAC | |||||
| cdt-II | Cdt2F | GAAAATAAATGGAATATAAATGTCCG | 56 | 558 | ||
| Cdt2R | TTTGTGTTGCCGCCGCTGGTGAAA | |||||
| cdt-III | Cdt3F | GAAAATAAATGGAATATAAATGTCCG | 56 | 558 | ||
| Cdt3R | TTTGTGTCGGTGCAGCAGGGAAAA | |||||
| cdt-IV | Cdt4F | CCTGATGGTTCAGGAGGCTGGTTC | 56 | 350 | ||
| Cdt4R | TTGCTCCAGAATCTATACCT |
3. Results
3.1. Escherichia coli Isolation
3.2. Antimicrobial Susceptibility Tests
3.3. Genotypic Resistance
3.4. Virulence Factors
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Gordon, D.M. The ecology of Escherichia coli. In Escherichia coli: Pathotypes and Principles of Pathogenesis: Second Edition; Elsevier Inc.: Amsterdam, The Netherlands, 2013; pp. 3–20. ISBN 9780123970480. [Google Scholar]
- Pakbin, B.; Brück, W.M.; Rossen, J.W.A. Virulence factors of enteric pathogenic Escherichia coli: A Review. Int. J. Mol. Sci. 2021, 22, 9922. [Google Scholar] [CrossRef]
- Pokharel, P.; Dhakal, S.; Dozois, C.M. The diversity of Escherichia coli pathotypes and vaccination strategies against this versatile bacterial pathogen. Microorganisms 2023, 11, 344. [Google Scholar] [CrossRef]
- Gomes, T.A.T.; Elias, W.P.; Scaletsky, I.C.A.; Guth, B.E.C.; Rodrigues, J.F.; Piazza, R.M.F.; Ferreira, L.C.S.; Martinez, M.B. Diarrheagenic Escherichia coli. Braz. J. Microbiol. 2016, 47, 3–30. [Google Scholar] [CrossRef] [PubMed]
- De Rycke, J.; Milon, A.; Oswald, E. Necrotoxic Escherichia coli (NTEC): Two emerging categories of human and animal pathogens. Vet. Res. 1999, 30, 221–233. [Google Scholar]
- Mainil, J.G.; Jacquemin, E.; Oswald, E. Prevalence and identity of cdt-related sequences in necrotoxigenic Escherichia coli. Vet. Microbiol. 2003, 94, 159–165. [Google Scholar] [CrossRef]
- Poirel, L.; Madec, J.-Y.; Lupo, A.; Schink, A.-K.; Kieffer, N.; Nordmann, P.; Schwarz, S. Antimicrobial resistance in Escherichia coli. Microbiol. Spectr. 2018, 6, 10–1128. [Google Scholar] [CrossRef]
- Costa, D.; Poeta, P.; Sáenz, Y.; Vinué, L.; Coelho, A.C.; Matos, M.; Rojo-Bezares, B.; Rodrigues, J.; Torres, C. Mechanisms of antibiotic resistance in Escherichia coli isolates recovered from wild animals. Microb. Drug Resist. 2008, 14, 71–77. [Google Scholar] [CrossRef]
- Paitan, Y. Current trends in antimicrobial resistance of Escherichia coli. In Current Topics in Microbiology and Immunology; Springer: Berlin/Heidelberg, Germany, 2018; Volume 416, pp. 181–211. [Google Scholar]
- Nang, S.C.; Li, J.; Velkov, T. The rise and spread of mcr plasmid-mediated polymyxin resistance. Crit. Rev. Microbiol. 2019, 45, 131–161. [Google Scholar] [CrossRef]
- EFSA (European Food Safety Authority); ECDC (European Centre for Disease Prevention and Control). The European Union Summary Report on Antimicrobial Resistance in zoonotic and indicator bacteria from humans, animals and food in 2023–2024. EFSA J. 2026, 24, e8583. [Google Scholar] [PubMed]
- Silva, A.; Silva, V.; Tavares, T.; López, M.; Rojo-Bezares, B.; Pereira, J.E.; Falco, V.; Valentão, P.; Igrejas, G.; Sáenz, Y.; et al. Rabbits as a reservoir of multidrug-resistant Escherichia coli: Clonal lineages and public health impact. Antibiotics 2024, 13, 376. [Google Scholar] [CrossRef] [PubMed]
- Adorján, A.; Makrai, L.; Mag, T.; Jánosi, S.; Könyves, L.; Tóth, I. High Frequency of multidrug-resistant (MDR) atypical Enteropathogenic Escherichia coli (aEPEC) in broilers in Hungary. Front. Vet. Sci. 2020, 7, 511. [Google Scholar] [CrossRef]
- Al-Marri, T.; Al-Marri, A.; Al-Zanbaqi, R.; Al Ajmi, A.; Fayez, M. Multidrug resistance, biofilm formation, and virulence genes of Escherichia coli from backyard poultry farms. Vet. World 2021, 14, 2869. [Google Scholar] [CrossRef] [PubMed]
- Literak, I.; Dolejska, M.; Radimersky, T.; Klimes, J.; Friedman, M.; Aarestrup, F.M.; Hasman, H.; Cizek, A. Antimicrobial-resistant faecal Escherichia coli in wild mammals in central Europe: Multiresistant Escherichia coli producing extended-spectrum beta-lactamases in wild boars. J. Appl. Microbiol. 2010, 108, 1702–1711. [Google Scholar] [CrossRef] [PubMed]
- Barth, S.A.; Blome, S.; Cornelis, D.; Pietschmann, J.; Laval, M.; Maestrini, O.; Geue, L.; Charrier, F.; Etter, E.; Menge, C.; et al. Faecal Escherichia coli as biological indicator of spatial interaction between domestic pigs and wild boar (Sus scrofa) in Corsica. Transbound. Emerg. Dis. 2018, 65, 746–757. [Google Scholar] [CrossRef] [PubMed]
- Vittecoq, M.; Godreuil, S.; Prugnolle, F.; Durand, P.; Brazier, L.; Renaud, N.; Arnal, A.; Aberkane, S.; Jean-Pierre, H.; Gauthier-Clerc, M.; et al. Antimicrobial resistance in wildlife. J. Appl. Ecol. 2016, 53, 519–529. [Google Scholar] [CrossRef]
- Radhouani, H.; Poeta, P.; Gonçalves, A.; Pacheco, R.; Sargo, R.; Igrejas, G. Wild birds as biological indicators of environmental pollution: Antimicrobial resistance patterns of Escherichia coli and enterococci isolated from common buzzards (Buteo buteo). J. Med. Microbiol. 2012, 61, 837–843. [Google Scholar] [CrossRef]
- Prandi, I.; Bellato, A.; Nebbia, P.; Stella, M.C.; Ala, U.; von Degerfeld, M.M.; Quaranta, G.; Robino, P. Antibiotic resistant Escherichia coli in wild birds hospitalised in a wildlife rescue centre. Comp. Immunol. Microbiol. Infect. Dis. 2023, 93, 101945. [Google Scholar] [CrossRef]
- Cagnoli, G.; Bertelloni, F.; Ceccherelli, R.; Ebani, V.V. Antimicrobial resistance and pathotypes of Escherichia coli isolates from yellow-legged seagulls (Larus michahellis) in Central Italy. Animals 2024, 14, 3048. [Google Scholar] [CrossRef]
- Handrova, L.; Kmet, V. Antibiotic resistance and virulence factors of Escherichia coli from eagles and goshawks. J. Environ. Sci. Health Part B 2019, 54, 605–614. [Google Scholar] [CrossRef]
- Hathcock, T.; Poudel, A.; Kang, Y.; Butaye, P.; Raiford, D.; Mobley, T.; Wang, C.; Bellah, J. Multidrug-Resistant Escherichia coli and tetracycline-resistant Enterococcus faecalis in wild raptors of Alabama and Georgia, USA. J. Wildl. Dis. 2019, 55, 482–487. [Google Scholar]
- Guenther, S.; Aschenbrenner, K.; Stamm, I.; Bethe, A.; Semmler, T.; Stubbe, A.; Stubbe, M.; Batsajkhan, N.; Glupczynski, Y.; Wieler, L.H.; et al. Comparable High Rates of Extended-Spectrum-Beta-Lactamase-Producing Escherichia coli in Birds of Prey from Germany and Mongolia. PLoS ONE 2012, 7, e53039. [Google Scholar] [CrossRef]
- Tarabai, H.; Krejci, S.; Karyakin, I.; Bitar, I.; Literak, I.; Dolejska, M. Clinically relevant antibiotic resistance in Escherichia coli from black kites in southwestern Siberia: A genetic and phenotypic investigation. mSphere 2023, 8, e00099-23. [Google Scholar] [CrossRef]
- Tarabai, H.; Valcek, A.; Jamborova, I.; Vazhov, S.V.; Karyakin, I.V.; Raab, R.; Literak, I.; Dolejska, M. Plasmid-mediated mcr-1 colistin resistance in Escherichia coli from a black kite in Russia. Antimicrob. Agents Chemother. 2019, 63, e01266-19. [Google Scholar] [CrossRef] [PubMed]
- Skarżyńska, M.; Zaja̧c, M.; Bomba, A.; Bocian, Ł.; Kozdruń, W.; Polak, M.; Wia̧cek, J.; Wasyl, D. Antimicrobial resistance glides in the sky—Free-living birds as a reservoir of resistant Escherichia coli with zoonotic potential. Front. Microbiol. 2021, 12, 656223. [Google Scholar] [CrossRef]
- Bertelloni, F.; Lunardo, E.; Rocchigiani, G.; Ceccherelli, R.; Ebani, V. Occurrence of Escherichia coli virulence genes in feces of wild birds from Central Italy. Asian Pac. J. Trop. Med. 2019, 12, 142–146. [Google Scholar] [CrossRef]
- Hughes, L.A.; Bennett, M.; Coffey, P.; Elliott, J.; Jones, T.R.; Jones, R.C.; Lahuerta-Marin, A.; McNiffe, K.; Norman, D.; Williams, N.J.; et al. Risk factors for the occurrence of Escherichia coli virulence genes eae, stx1 and stx2 in wild bird populations. Epidemiol. Infect. 2009, 137, 1574–1582. [Google Scholar] [CrossRef] [PubMed]
- Musa, L.; Stefanetti, V.; Casagrande Proietti, P.; Grilli, G.; Gobbi, M.; Toppi, V.; Brustenga, L.; Magistrali, C.F.; Franciosini, M.P. Antimicrobial susceptibility of commensal E. coli isolated from wild birds in Umbria (Central Italy). Animals 2023, 13, 1776. [Google Scholar] [CrossRef]
- Chen, J.; Griffiths, M.W. PCR differentiation of Escherichia coli from other Gram-negative bacteria using primers derived from the nucleotide sequences flanking the gene encoding the universal stress protein. Lett. Appl. Microbiol. 1998, 27, 369–371. [Google Scholar] [CrossRef]
- CLSI M02; Performance Standards for Antimicrobial Disk Susceptibility Tests. Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2018.
- CLSI M100; M100 Performance Standards for Antimicrobial Susceptibility Testing A CLSI Supplement for Global Application. Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2023.
- CLSI M07; Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria That Grow Aerobically. Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2018.
- Magiorakos, A.P.; Srinivasan, A.; Carey, R.B.; Carmeli, Y.; Falagas, M.E.; Giske, C.G.; Harbarth, S.; Hindler, J.F.; Kahlmeter, G.; Olsson-Liljequist, B.; et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect. 2012, 18, 268–281. [Google Scholar] [CrossRef]
- Hall, T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar]
- Dallenne, C.; Da Costa, A.; Decré, D.; Favier, C.; Arlet, G. Development of a set of multiplex PCR assays for the detection of genes encoding important β-lactamases in Enterobacteriaceae. J. Antimicrob. Chemother. 2010, 65, 490–495. [Google Scholar] [CrossRef]
- Hasman, H.; Mevius, D.; Veldman, K.; Olesen, I.; Aarestrup, F.M. β-Lactamases among extended-spectrum β-lactamase (ESBL)-resistant Salmonella from poultry, poultry products and human patients in The Netherlands. J. Antimicrob. Chemother. 2005, 56, 115–121. [Google Scholar] [CrossRef]
- Poirel, L.; Walsh, T.R.; Cuvillier, V.; Nordmann, P. Multiplex PCR for detection of acquired carbapenemase genes. Diagn. Microbiol. Infect. Dis. 2011, 70, 119–123. [Google Scholar] [CrossRef]
- Dahshan, H.; Shahada, F.; Chuma, T.; Moriki, H.; Okamoto, K. Genetic analysis of multidrug-resistant Salmonella enterica serovars Stanley and Typhimurium from cattle. Vet. Microbiol. 2010, 145, 76–83. [Google Scholar] [CrossRef]
- Van, T.T.H.; Chin, J.; Chapman, T.; Tran, L.T.; Coloe, P.J. Safety of raw meat and shellfish in Vietnam: An analysis of Escherichia coli isolations for antibiotic resistance and virulence genes. Int. J. Food Microbiol. 2008, 124, 217–223. [Google Scholar] [CrossRef]
- Paton, A.W.; Paton, J.C. Detection and Characterization of Shiga Toxigenic Escherichia coli by Using Multiplex PCR Assays for stx1, stx2, eaeA, Enterohemorrhagic E. coli hlyA, rfbO111, and rfbO157. J. Clin. Microbiol. 1998, 36, 598. [Google Scholar] [CrossRef] [PubMed]
- Müller, D.; Greune, L.; Heusipp, G.; Karch, H.; Fruth, A.; Tschäpe, H.; Schmidt, M.A. Identification of unconventional intestinal pathogenic Escherichia coli isolates expressing intermediate virulence factor profiles by using a novel single-step multiplex PCR. Appl. Environ. Microbiol. 2007, 73, 3380–3390. [Google Scholar] [CrossRef]
- Borriello, G.; Lucibelli, M.G.; De Carlo, E.; Auriemma, C.; Cozza, D.; Ascione, G.; Scognamiglio, F.; Iovane, G.; Galiero, G. Characterization of enterotoxigenic E. coli (ETEC), Shiga-toxin producing E. coli (STEC) and necrotoxigenic E. coli (NTEC) isolated from diarrhoeic Mediterranean water buffalo calves (Bubalus bubalis). Res. Vet. Sci. 2012, 93, 18. [Google Scholar] [CrossRef] [PubMed]
- Gargiulo, A.; Fioretti, A.; Russo, T.P.; Varriale, L.; Rampa, L.; Paone, S.; De Luca Bossa, L.M.; Raia, P.; Dipineto, L. Occurrence of enteropathogenic bacteria in birds of prey in Italy. Lett. Appl. Microbiol. 2018, 66, 202–206. [Google Scholar] [CrossRef] [PubMed]
- Rossi, G.; Terracciano, G.; Gherardi, R.; Galosi, L.; Perrucci, S. Parasites, bacteria, and associated pathological changes in the digestive system of diurnal and nocturnal raptors in Central Italy. Pathogens 2021, 10, 1567. [Google Scholar] [CrossRef]
- Livermore, D.M.; Canton, R.; Gniadkowski, M.; Nordmann, P.; Rossolini, G.M.; Arlet, G.; Ayala, J.; Coque, T.M.; Kern-Zdanowicz, I.; Luzzaro, F.; et al. CTX-M: Changing the face of ESBLs in Europe. J. Antimicrob. Chemother. 2007, 59, 165–174. [Google Scholar] [CrossRef] [PubMed]
- Stahl, L.M.; Kadletz, S.; Olson, J.B. Patterns of antibiotic resistance in Southeastern US raptors before and after rehabilitation. Comp. Immunol. Microbiol. Infect. Dis. 2025, 123, 102388. [Google Scholar] [CrossRef]
- Bush, K.; Bradford, P.A. Epidemiology of β-Lactamase-producing pathogens. Clin. Microbiol. Rev. 2020, 33, 10–1128. [Google Scholar] [CrossRef]
- Singh, S.; Kriti, M.; K.S, A.; Sharma, P.; Pal, N.; Sarma, D.K.; Tiwari, R.; Kumar, M. A one health approach addressing poultry-associated antimicrobial resistance: Human, animal and environmental perspectives. Microbe 2025, 7, 100309. [Google Scholar] [CrossRef]
- Valkama, J.; Korpimäki, E.; Arroyo, B.; Beja, P.; Bretagnolle, V.; Bro, E.; Kenward, R.; Mañosa, S.; Redpath, S.M.; Thirgood, S.; et al. Birds of prey as limiting factors of gamebird populations in Europe: A review. Biol. Rev. Camb. Philos. Soc. 2005, 80, 171–203. [Google Scholar] [CrossRef] [PubMed]
- WHO (World Health Organization). WHO’s List of Medically Important Antimicrobials: A Risk Management Tool for Mitigating Antimicrobial Resistance Due to Non-Human Use; World Health Organization: Geneva, Switzerland, 2024. [Google Scholar]
- Grabowski, Ł.; Gaffke, L.; Pierzynowska, K.; Cyske, Z.; Choszcz, M.; Węgrzyn, G.; Węgrzyn, A. Enrofloxacin—The ruthless killer of eukaryotic cells or the last hope in the fight against bacterial infections? Int. J. Mol. Sci. 2022, 23, 3648. [Google Scholar] [CrossRef]
- Kobayashi, H.; Kanazaki, M.; Hata, E.; Kubo, M. Prevalence and characteristics of eae- and stx-positive strains of Escherichia coli from wild birds in the immediate environment of Tokyo Bay. Appl. Environ. Microbiol. 2008, 75, 292. [Google Scholar] [CrossRef]
- Sanches, L.A.; Gomes, M.D.S.; Teixeira, R.H.F.; Cunha, M.P.V.; Oliveira, M.G.X.D.; Vieira, M.A.M.; Gomes, T.A.T.; Knobl, T. Captive wild birds as reservoirs of enteropathogenic E. coli (EPEC) and shiga-toxin producing E. coli (STEC). Braz. J. Microbiol. 2017, 48, 760. [Google Scholar] [CrossRef]
- Alonso, C.A.; Mora, A.; Díaz, D.; Blanco, M.; González-Barrio, D.; Ruiz-Fons, F.; Simón, C.; Blanco, J.; Torres, C. Occurrence and characterization of stx and/or eae-positive Escherichia coli isolated from wildlife, including a typical EPEC strain from a wild boar. Vet. Microbiol. 2017, 207, 69–73. [Google Scholar] [CrossRef] [PubMed]
- Kashima, K.; Sato, M.; Osaka, Y.; Sakakida, N.; Kando, S.; Ohtsuka, K.; Doi, R.; Chiba, Y.; Takase, S.; Fujiwara, A.; et al. An outbreak of food poisoning due to Escherichia coli serotype O7:H4 carrying astA for enteroaggregative E. coli heat-stable enterotoxin1 (EAST1). Epidemiol. Infect. 2021, 149, e244. [Google Scholar] [CrossRef]
| Common Name | Scientific Name | Number of Tested Animals | Isolated E. coli |
|---|---|---|---|
| Eurasian buzzard | Buteo buteo | 13 | 12 |
| Common kestrel | Falco tinnunculus | 10 | 10 |
| Little owl | Athene noctua | 10 | 9 |
| Peregrine falcon | Falco peregrinus | 9 | 7 |
| Barn owl | Tyto alba | 7 | 5 |
| Tawny owl | Strix aluco | 7 | 5 |
| Scops owl | Otus scops | 3 | 1 |
| Black kite | Milvus migrans | 2 | 2 |
| Sparrowhawk | Accipiter nisus | 2 | 2 |
| Honey buzzard | Pernis apivorus | 1 | 1 |
| Total | 64 | 54 | |
| Antimicrobials | Resistant | Intermediate | Susceptible | ||||
|---|---|---|---|---|---|---|---|
| Class | Antimicrobial | Number of Isolates | % | Number of Isolates | % | Number of Isolates | % |
| Penicillins | Ampicillin | 22 | 40.74 | 7 | 12.96 | 25 | 46.30 |
| Amoxicillin-clavulanate | 8 | 14.81 | 11 | 20.37 | 35 | 64.81 | |
| Cephalosporins | Cefoxitin | 11 | 20.37 | 4 | 7.41 | 39 | 72.22 |
| Cefotaxime | 9 | 16.67 | 12 | 22.22 | 33 | 61.11 | |
| Ceftiofur | 8 | 14.81 | 5 | 9.26 | 41 | 75.93 | |
| Carbapenems | Imipenem | 3 | 5.56 | 7 | 12.96 | 44 | 81.48 |
| Ertapenem | 4 | 7.41 | 1 | 1.85 | 49 | 90.74 | |
| Monobactams | Aztreonam | 8 | 14.81 | 2 | 3.70 | 44 | 81.48 |
| Phenicols | Chloramphenicol | 8 | 14.81 | 0 | 0.00 | 46 | 85.19 |
| Tetracyclines | Tetracycline | 14 | 25.93 | 1 | 1.85 | 39 | 72.22 |
| Fluoroquinolones | Enrofloxacin | 17 | 31.48 | 5 | 9.26 | 32 | 59.26 |
| Ciprofloxacin | 17 | 31.48 | 2 | 3.70 | 35 | 64.81 | |
| Aminoglycosides | Gentamicin | 7 | 12.96 | 0 | 0.00 | 47 | 87.04 |
| Amikacin | 1 | 1.85 | 2 | 3.70 | 51 | 94.44 | |
| Sulfonamides | Trimethoprim-sulfamethoxazole | 10 | 18.52 | 0 | 0.00 | 44 | 81.48 |
| Polymyxins | Colistin | 0 | 0.00 | 0 | 0.00 | 54 | 100.00 |
| Strain Number | Bird Species (Number of Isolates) | Antimicrobial Resistance Profile | Resistance Genes | Virulence Genes |
|---|---|---|---|---|
| 15, 16, 20, 21, 59, 125, 144, 145, 146, 150, 157, 158, 160, 161 | Peregrine falcon (3) Eurasian buzzard (2) Common kestrel (1) Little owl (2) Barn owl (2) Scops owl (1) Tawny owl (2) Black kite (1) | not resistant to all molecules | ||
| 14, 24, 25, 26, 34, 90, 126, 136, 159 | Eurasian buzzard (4) Common kestrel (3) Little owl (2) | not resistant to all molecules | astA | |
| 127 | Eurasian buzzard (1) | not resistant to all molecules | astA, eaeA, escV | |
| 17 | Eurasian buzzard (1) | SXT | astA | |
| 18 | Little owl (1) | SXT | astA | |
| 23 | Little owl (1) | AMP, AMC, FOX | ||
| 27 | Little owl (1) | ATM | ||
| 58 | Common kestrel (1) | AMP | blaTEM | |
| 143 | Barn owl (1) | AMP | ||
| 147 | Tawny owl (1) | IPM, ETP | astA | |
| 153 | Honey buzzard (1) | FOX | ||
| 163 | Common kestrel (1) | TE | tet(A) | astA |
| 164 | Sparrow hawk (1) | TE | tet(A) |
| Strain Number | Bird Species (Number of Isolates) | Antimicrobial Resistance Profile | Resistance Genes | Virulence Genes |
|---|---|---|---|---|
| 22 | Little owl (1) | AMP, AMC, FOX, ENR | ||
| 30 | Eurasian buzzard (1) | AMP, TE, ENR, CIP, SXT | blaTEM, tet(B) | astA |
| 45 | Eurasian buzzard (1) | AMP, C, TE, ENR, CIP, SXT | blaTEM, tet(A), cmIa | |
| 46 | Peregrine falcon (1) | AMP, C, TE, ENR, CIP | blaTEM, tet(A), cmIa | |
| 47 | Peregrine falcon (1) | C, TE, ENR, CIP, CN, SXT | tet(B) | |
| 137 | Common kestrel (1) | AMP, AMC, FOX, ENR, CIP | blaCMY2 | |
| 138 | Common kestrel (1) | AMP, TE, ENR, CIP | blaTEM | |
| 142 | Eurasian buzzard (1) | AMP, AMC, FOX, CTX, TE, ENR, CIP | blaCMY2, blaTEM, tet(A) | |
| 148 | Tawny owl (1) | AMP, C, TE | blaTEM, tet(A) | |
| 149 | Tawny owl (1) | AMP, AMC, FOX, CTX, FUR, IPM, ETP, ATM, CIP | ||
| 151 | Black kite (1) | AMP, CTX, FUR, ATM, ENR, CIP, CN | blaCTX-M | |
| 152 | Sparrowhawk (1) | AMP, FOX, FUR, C, ENR, CIP | blaTEM | |
| 154 | Common kestrel (1) | AMP, FOX, IPM, TE, ENR, CIP, SXT | blaTEM, blaCTX-M, tet(A) | astA |
| 155 | Eurasian buzzard (1) | AMP, CTX, FUR, ETP, ATM, ENR, CIP, CN | ||
| 156 | Barn owl (1) | AMP, AMC, CTX, SXT | blaTEM | |
| 162 | Peregrine falcon (1) | AMP, ENR, CIP, CN | blaTEM | |
| 31 | Barn owl (1) | AMP, CTX, FUR, ATM, C, TE, ENR, CIP, SXT | blaSHV, blaTEM, tet(B), cat1 | |
| 139 | Common kestrel (1) | AMP, FOX, CTX, FUR, ETP, ATM, TE, ENR, CIP, CN, AK | blaTEM, tet(B) | |
| 140 | Peregrine falcon (1) | AMP, AMC, FOX, CTX, FUR, ATM, C, TE, ENR, CIP, CN, SXT | blaCMY2, blaCTX-M, tet(A) | |
| 141 | Little owl (1) | AMP, AMC, FOX, CTX, FUR, ATM, C, TE, ENR, CIP, CN, SXT | blaCTX-M, tet(A) |
| Species | Analyzed Strains | Virulence Genes | Resistance Genes | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| eaeA | escV | astA | blaCMY2 | blaSHV | blaCTX-M | blaTEM | tet(A) | tet(B) | cat1 | cmIa | ||
| Eurasian buzzard | 12 | 1 | 1 | 7 | 1 | 0 | 0 | 3 | 2 | 1 | 0 | 1 |
| Common kestrel | 10 | 0 | 0 | 5 | 1 | 0 | 1 | 4 | 2 | 1 | 0 | 0 |
| Little owl | 9 | 0 | 0 | 3 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 0 |
| Peregrine falcon | 7 | 0 | 0 | 0 | 1 | 0 | 1 | 2 | 2 | 1 | 0 | 1 |
| Barn owl | 5 | 0 | 0 | 0 | 0 | 1 | 0 | 2 | 0 | 1 | 1 | 0 |
| Tawny owl | 5 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 0 |
| Scops owl | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| Black kite | 2 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 |
| Sparrowhawk | 2 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 0 |
| Honey buzzard | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| Total | 54 | 1 | 1 | 16 | 3 | 1 | 4 | 13 | 9 | 4 | 1 | 2 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Cagnoli, G.; Bertelloni, F.; Di Paolo, A.; Ceccherelli, R.; Ebani, V.V. Antimicrobial Resistance and Virulence Genes in Escherichia coli Isolated from Raptors in Central Italy. Vet. Sci. 2026, 13, 342. https://doi.org/10.3390/vetsci13040342
Cagnoli G, Bertelloni F, Di Paolo A, Ceccherelli R, Ebani VV. Antimicrobial Resistance and Virulence Genes in Escherichia coli Isolated from Raptors in Central Italy. Veterinary Sciences. 2026; 13(4):342. https://doi.org/10.3390/vetsci13040342
Chicago/Turabian StyleCagnoli, Giulia, Fabrizio Bertelloni, Alessia Di Paolo, Renato Ceccherelli, and Valentina Virginia Ebani. 2026. "Antimicrobial Resistance and Virulence Genes in Escherichia coli Isolated from Raptors in Central Italy" Veterinary Sciences 13, no. 4: 342. https://doi.org/10.3390/vetsci13040342
APA StyleCagnoli, G., Bertelloni, F., Di Paolo, A., Ceccherelli, R., & Ebani, V. V. (2026). Antimicrobial Resistance and Virulence Genes in Escherichia coli Isolated from Raptors in Central Italy. Veterinary Sciences, 13(4), 342. https://doi.org/10.3390/vetsci13040342

