Next Article in Journal
One Health Insights into Pulmonary Hypertension: Bridging Human and Canine Medicine
Previous Article in Journal
Integrated Hunting Strategies for African Swine Fever Control in Wild Boar: A Comparative Review of Experiences in European Continent
Previous Article in Special Issue
Zoonotic Tuberculosis as a One Health Challenge: Global Evidence, Transmission Dynamics, and Policy Gaps in Indonesia
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Antimicrobial Resistance and Virulence Genes in Escherichia coli Isolated from Raptors in Central Italy

by
Giulia Cagnoli
1,
Fabrizio Bertelloni
1,*,
Alessia Di Paolo
1,
Renato Ceccherelli
2 and
Valentina Virginia Ebani
1,3
1
Department of Veterinary Science, University of Pisa, Viale delle Piagge 2, 56124 Pisa, Italy
2
LIPU Bird Life Italia, via Pasubio 3 bis, 43122 Parma, Italy
3
Centre for Climate Change Impact, University of Pisa, Via Del Borghetto 80, 56124 Pisa, Italy
*
Author to whom correspondence should be addressed.
Vet. Sci. 2026, 13(4), 342; https://doi.org/10.3390/vetsci13040342
Submission received: 11 March 2026 / Revised: 27 March 2026 / Accepted: 30 March 2026 / Published: 31 March 2026

Simple Summary

Wildlife is increasingly recognized as both a potential reservoir and vector for various pathogens, as well as a valuable bioindicator of environmental health. Raptors, in particular, serve as ecological sentinels due to their position as apex or mesopredators. By preying on small mammals, birds, reptiles, and invertebrates, or scavenging on carcasses and anthropogenic waste, they integrate exposure across multiple trophic levels and habitats. This makes them highly relevant for One Health surveillance initiatives. In this study, we observed that a high proportion of Escherichia coli (E. coli) isolates from raptors exhibit resistance to critical antimicrobials such as beta-lactams and fluoroquinolones. Furthermore, approximately one-third of these isolates were multidrug-resistant. These findings underscore the role of raptors as bioindicators, reflecting the circulating antimicrobial resistance (AMR) within their ecosystems. Conversely, only a limited number of E. coli strains belonging to major gastrointestinal pathogenic types were detected, indicating either limited circulation of these strains or a low prevalence of carriers among the raptor population. This work reinforces the importance of raptors as bioindicators, owing to their behavior and diet. Understanding the prevalence of antimicrobial-resistant and virulent E. coli in raptors is not only relevant to veterinary and ecological health but also has direct implications for human health.

Abstract

Wildlife can serve as a potential reservoir and spreader of resistant and pathogenic bacteria. Raptors, occupying the ecological position of apex or mesopredators, integrate exposure across different habitats and therefore serve as bioindicators of environmental dissemination of pathogens. In this study, we isolated 54 Escherichia coli (E. coli) strains from feces sampled from 64 raptors admitted to a wildlife rescue center in Central Italy. Phenotypic antimicrobial susceptibility testing was conducted, followed by molecular screening for resistance genes. Additionally, the presence of intestinal E. coli pathotypes, including STEC, EHEC, EPEC, ETEC, EAEC, EIEC, and NTEC, was evaluated through virulence gene analysis. Results indicated notable resistance to commonly used antimicrobials, with the highest percentages observed for ampicillin (40.74%), fluoroquinolones (31.48%), and tetracycline (25.93%). Molecular analysis of phenotypically resistant isolates identified the presence of several resistance genes, including blaTEM (13 isolates), blaCTX-M (4 isolates), blaCMY-2 (3 isolates), blaSHV (1 isolate), tet(A) (9 isolates), tet(B) (4 isolates), cat1 (1 isolate), and cmlA (2 isolates). Furthermore, 29.63% of isolates were classified as multidrug-resistant (MDR) and 7.41% as extensively drug-resistant (XDR). Regarding virulence profiles, one isolate harboring eaeA, escV, and astA genes was classified as atypical EPEC, while 27.78% isolates had only the astA gene, preventing precise pathotype assignment. These findings highlight the circulation of antimicrobial-resistant and potentially pathogenic E. coli strains within raptor populations in Central Italy, emphasizing the zoonotic potential and reaffirming the role of raptors as bioindicators within a One Health approach.

1. Introduction

Escherichia coli (E. coli) is an ubiquitous commensal Gram-negative bacterium that inhabits the intestinal tract of humans and animals [1]. While generally harmless, certain strains possess pathogenic potential and can cause diseases in both humans and animals. Several pathogenic strains, known as Intestinal Pathogenic E. coli (InPEC), follow the fecal-oral transmission route, leading to various intestinal disorders [2]. InPECs are highly diverse and represent a significant cause of diarrhea in mammals worldwide [3]. Based on the mechanism of pathogenicity, InPEC can be classified into several pathotypes: Enteropathogenic Escherichia coli (EPEC), Shiga Toxin-producing E. coli (STEC), Enterohemorrhagic E. coli (EHEC), Enterotoxigenic E. coli (ETEC), Enteroinvasive E. coli (EIEC), Enteroaggregative E. coli (EAEC), and Necrotoxic E. coli (NTEC) [2,4,5,6].
E. coli inherently lacks intrinsic resistance to antimicrobials; however, it readily acquires resistance through various mechanisms. This property is largely attributed to its genomic plasticity, capacity to share mobile genetic elements such as plasmids and transposons, and its widespread presence across diverse hosts and environments [7,8]. The primary driver of antimicrobial resistance is the acquisition and accumulation of mobile resistance genes. In recent years, a significant concern has emerged regarding Enterobacteriaceae, particularly E. coli, with the rise and dissemination of resistance genes targeting key antibiotic classes [7]. Notably, the spread of beta-lactamase genes such as blaTEM and blaCTX-M confers resistance to penicillins and cephalosporins, and blaNDM and blaOXA genes that are associated with carbapenem resistance [9]. The emergence and dissemination of mobile colistin resistance (mcr) genes are especially alarming, given that colistin is often considered a last-resort antimicrobial [10]. Additionally, the extensive overuse of tetracycline, especially in the past, has led to the widespread distribution of tetracycline resistance genes (tet) among E. coli [7].
The most recent surveillance report of the European Food Safety Authority (EFSA) and the European Centre for Disease Prevention and Control (ECDC) on antimicrobial resistance (AMR) in Europe underscores the ongoing rise in resistance among zoonotic and indicator E. coli strains, particularly against β-lactams and fluoroquinolones [11]. Moreover, there is an increasing dissemination of strains exhibiting resistance to multiple antimicrobials. The global emergence of multidrug-resistant (MDR) bacteria presents a significant public health challenge, as it severely restricts available therapeutic options [12,13,14,15].
It is widely acknowledged that the health of humans, animals, and the environment is deeply interconnected. From this perspective, wildlife not only serves as reservoirs and vectors for pathogens and antimicrobial-resistant bacteria, but also plays a crucial role as bioindicators of environmental health. By monitoring wildlife populations, we can gain valuable insights into the presence and circulation of contaminants and infectious agents within a given geographic area, thereby reflecting the impacts of human activities on the ecosystem [16,17,18].
Birds, especially synanthropic and semi-synanthropic species, can serve as valuable bioindicators for antimicrobial-resistant and zoonotic microorganisms. Due to their habitats, behaviors, and diets, these birds are frequently exposed to antimicrobials, their residues, and resistant and pathogenic bacteria, making them effective sentinels for monitoring environmental and public health risks [19,20].
Raptors serve as valuable ecological sentinels due to their role as apex or mesopredators. By preying on a diverse range of small mammals, birds, reptiles, and invertebrates, as well as scavenging on carcasses and anthropogenic waste, they integrate exposure across multiple trophic levels and habitat types [21,22,23]. Scientific evidence indicates that carnivorous and omnivorous species are generally at greater risk of harboring antimicrobial-resistant and pathogenic bacteria due to their diets. Additionally, top predators, which forage over extensive geographic areas, face increased risks of exposure and accumulation of these bacteria. Among avian species, raptors and gulls are particularly vulnerable to such risks, given their feeding behaviors and ecological niches [17].
Previous studies have documented the presence of E. coli strains in raptors that exhibit resistance to critical antimicrobials used in human therapy, such as cephalosporins or colistin, associated with the acquisition of mobile resistance genes [23,24,25,26]. Additionally, pathogenic E. coli have been identified in raptors, indicating their role as potential reservoirs and vectors for the dissemination of virulent strains [27,28]. However, data on the occurrence of AMR and pathogenic E. coli in raptors from Italy remain scarce. One investigation in northwest Italy reported that 40% and 13% of E. coli isolates from raptors and other wild animals were multidrug-resistant (MDR) and extended-spectrum beta-lactamase (ESBL)-producing. However, this study primarily focused on examining the impact of hospitalization in rescue centers on antimicrobial resistance development and relied solely on phenotypic testing [19]. Another study conducted in central Italy evaluated E. coli isolates from raptors and other wild birds admitted to rescue centers, revealing a high prevalence of resistance to ampicillin (85%) and other beta-lactams, as well as ciprofloxacin (18%). ESBL-producing isolates were identified in 8% of samples, and MDR strains accounted for 17%. Similar to the first, this research assessed antimicrobial resistance exclusively through phenotypic methods [29]. In contrast, our working group investigated the presence of STEC-associated genes in the feces of various wild bird species. Using a culture-independent approach, stx1, stx2, eaeA, and hylA genes were detected in the intestine of a single little owl [27].
The aim of this study was to isolate and characterize E. coli from raptors admitted to a wildlife rescue center in Central Italy. We evaluated antimicrobial resistance using both phenotypic and genotypic approaches, and assessed the presence of virulence factors associated with major InPEC pathotypes through molecular techniques.

2. Materials and Methods

2.1. Sampling

During 2023 and 2024, a total of 64 fecal samples were collected from raptors (one sample per animal) belonging to 10 different species. All birds were admitted to a wildlife rescue center in Central Italy. The sampled species included 13 Eurasian buzzards (Buteo buteo), 10 common kestrels (Falco tinnunculus), 10 little owls (Athene noctua), 9 peregrine falcons (Falco peregrinus), 7 barn owls (Tyto alba), 7 tawny owls (Strix aluco), 3 scops owls (Otus scops), 2 black kites (Milvus migrans), 2 sparrowhawks (Accipiter nisus), and 1 honey buzzard (Pernis apivorus). The raptors were admitted primarily due to trauma and housed individually in single cages. Fecal samples were collected non-invasively from the bottom of each cage, as soon as possible after the birds’ arrival at the rescue center, and only from raptors not yet receiving antibiotic treatments. No ethical approval was required, as no biological material was collected directly from the birds. Each sample was placed in a sterile plastic tube and transferred within 3 h, kept in a cool bag at 4 °C, to the Avian Pathology Laboratories of the Department of Veterinary Sciences, University of Pisa, for bacteriological examination.

2.2. Escherichia coli Isolation

Fecal samples were initially pre-enriched in buffered peptone water (BPW; Oxoid Ltd., Basingstoke, UK) at a 1:10 dilution and incubated at 37 °C for 24 h. Following enrichment, a loopful of cultures was streaked onto selective Tryptone Bile X-GLUC (TBX) agar (Biolife, Milan, Italy) and incubated at 42 °C for 24 h. From each TBX plate, a presumptive E. coli colony was selected and streaked onto Tryptic Soy Agar (TSA; Biolife) to obtain pure isolates. Confirmation of E. coli was achieved through a species-specific PCR targeting the uspA gene. The primers used were Up (5′-CCGATACGCTGCCAATCAGT-3′) and Down (5′-ACGCAGACCGTAGGCCAGAT-3′), which amplified an 884 bp fragment of the gene. The PCR was performed with an annealing temperature of 70 °C; E. coli ATCC 25922 served as the positive control, while sterile distilled water was used as the negative control in all PCR reactions [30]. Confirmed E. coli strains were preserved in Brain–Heart Infusion (BHI) broth (Oxoid Ltd.) supplemented with 30% glycerol and stored at −80 °C for downstream analyses.

2.3. Antimicrobial Susceptibility Tests

The antimicrobial susceptibility profile of all E. coli isolates was determined using the Kirby–Bauer disk diffusion method [31]. A total of 15 antimicrobials spanning nine different classes were tested. The disks (Oxoid Ltd.) used included: ampicillin (10 µg), amoxicillin–clavulanate (20/10 µg), cefoxitin (30 µg), cefotaxime (30 µg), ceftiofur (30 µg), imipenem (10 µg), ertapenem (10 µg), aztreonam (30 µg), chloramphenicol (30 µg), tetracycline (30 µg), enrofloxacin (5 µg), ciprofloxacin (5 µg), gentamicin (10 µg), amikacin (30 µg), and trimethoprim–sulfamethoxazole (1.25/23.75 µg). Zone diameters were interpreted in accordance with Clinical and Laboratory Standards Institute (CLSI) guidelines [32]. E. coli ATCC 25922 was used as a quality control strain in all tests [32].
Colistin resistance was evaluated via the broth microdilution method as recommended by CLSI [33]. Colistin sulfate (CARLO ERBA Reagents, Cornaredo, Italy) was prepared in two-fold serial dilutions ranging from 256 to 0.5 µg/mL in cation-adjusted Mueller–Hinton (MH) broth (Oxoid Ltd.). Isolates with minimum inhibitory concentrations (MIC) > 2 µg/mL were classified as resistant [32]. E. coli ATCC 25922 was used as a quality control strain for the colistin MIC test [32].
Based on their antimicrobial resistance patterns, isolates were categorized following the definitions established by Magiorakos et al. [34]. Briefly, strains resistant to at least one antimicrobial in three or more antimicrobial classes were classified as multidrug-resistant (MDR); strains resistant to at least one antimicrobial in all but two or fewer antimicrobial classes were classified as extensively drug-resistant (XDR); and strains resistant to all antimicrobials across all antimicrobial classes were classified as pandrug-resistant (PDR).

2.4. Molecular Analyses

DNA was extracted from fresh E. coli cultures grown on TSA using the Quick-DNA Miniprep Plus Kit (Zymo Research, Irvine, CA, USA), following the manufacturer’s instructions. PCR assays were conducted on a SimpliAmp™ Thermal Cycler (Applied Biosystems, Waltham, MA, USA). PCR reactions were performed in a total volume of 25 μL, comprising 12.5 μL of DreamTaq Hot Start Master Mix (Life Technologies Italia, Milan, Italy), 0.1 μM of each primer, 3 μL of extracted DNA, and nuclease-free water to reach the final volume. The cycling conditions were as follows: an initial denaturation at 95 °C for 10 min; 35 amplification cycles consisting of denaturation at 95 °C for 1 min, annealing at temperatures specified in Table 1 and Table 2 for 1 min, and extension at 72 °C for 2 min; followed by a final extension step at 72 °C for 10 min. Each PCR reaction included sterile water as a negative control and DNA from previously characterized E. coli strains positive for the target genes as positive controls. PCR products were separated by electrophoresis on a 1.5% agarose gel at 100 V for 45 min, with a 100 bp DNA ladder (Solis BioDyne, Tartu, Estonia) serving as a molecular size marker. Gels were stained with ethidium bromide and visualized under UV illumination.
Positive PCR amplicons were purified and submitted to BMR Genomics (Padova, Italy) for bidirectional sequencing to confirm their identity. Sequence data were analyzed using BioEdit [35], and results were compared to online BLAST databases (Accessed on 10 April 2025).

2.4.1. Genotypic Resistance

The isolates exhibiting resistance plus intermediate susceptibility to penicillins (ampicillin and/or amoxicillin-clavulanate) and/or cephalosporins (cefoxitin, cefotaxime, and/or ceftiofur) were subjected to molecular analyses to identify the presence of β-lactamases-encoding genes, including blaTEM, blaSHV, and blaCTX-M. Additionally, these strains were screened for the presence of blaCMY1 and blaCMY2 genes, responsible for AmpC β-lactamases production. Strains exhibiting resistance plus intermediate susceptibility to carbapenems (imipenem and/or ertapenem) were tested for carbapenemase genes, including blaNDM, blaVIM, blaIMP, blaKPC, and blaOXA-48 genes. Furthermore, isolates resistant or intermediate to chloramphenicol and tetracyclines were analyzed for the presence of cat1 and cmIA genes, and tet(A) and tet(B) genes, respectively. Primers sequences and PCR conditions are detailed in Table 1.
Table 1. Primers and PCR conditions adopted for the detection of the investigated resistance genes.
Table 1. Primers and PCR conditions adopted for the detection of the investigated resistance genes.
Target
Gene
PrimerSequence 5′ → 3′Annealing
Temp. (°C)
Amplicon
Size (bp)
References
blaTEMMultiTSO-T_forCATTTCCGTGTCGCCCTTATTC60800[36]
MultiTSO-T_revCGTTCATCCATAGTTGCCTGAC
blaSHVSHV-FTTCGCCTGTGTATTATCTCCCTG50854[37]
SHV-RTTAGCGTTGCCAGTGYTCG
blaCTX-MCTX-FATGTGCAGYACCAGTAARGTKATGGC60593
CTX-RTGGGTRAARTARGTSACCAGAAYCAGCGG
blaCMY-1 groupCMY1-FGTGGTGGATGCCAGCATCC58915
CMY1-RGGTCGAGCCGGTCTTGTTGAA
blaCMY-2 groupCMY2-FGCACTTAGCCACCTATACGGCAG58758
CMY2-RGCTTTTCAAGAATGCGCCAGG
blaNDMNDM-FGGTTTGGCGATCTGGTTTTC52621[38]
NDM-RCGGAATGGCTCATCACGATC
blaKPCKPC-FCGTCTAGTTCTGCTGTCTTG52798
KPC-RCTTGTCATCCTTGTTAGGCG
blaOXA-48OXA-FGCGTGGTTAAGGATGAACAC52438
OXA-RCATCAAGTTCAACCCAACCG
blaIMPIMP-FGGAATAGAGTGGCTTAAYTCTC52232
IMP-RGGTTTAAYAAAACAACCACC
blaVIMVIM-FGATGGTGTTTGGTCGCATA52390
VIM-RCGAATGCGCAGCACCAG
tetAtetAFGCTACATCCTGCTTGCCTTC64210[39]
tetARCATAGATCGCCGTGAAGAGG
tetBtetBFTTGGTTAGGGGCAAGTTTTG64659
tetBRGTAATGGGCCAATAACACCG
cat1CATI-FAGTTGCTCAATGTACCTATAACC58547[40]
CATI-RTTGTAATTCATTAAGCATTCTGCC
cmlAcmlA-FCCGCCACGGTGTTGTTGTTATC58698
cmlA-RCACCTTGCCTGCCCATCATTAG

2.4.2. Virulence Factors

All E. coli strains were screened for the presence of 20 virulence genes associated with 7 distinct pathotypes: STEC, EHEC, EPEC, ETEC, EAEC, EIEC, and NTEC (Table 2). Specifically, the genes included stx1 and stx2, which are characteristic markers of the STEC pathotype, along with the hlyA gene commonly found in EHEC strains. The eaeA gene shared by both EHEC and EPEC was also assessed. For EPEC, we targeted escV, bfpB, and ent genes; for ETEC, elt, estIa, and estIb; for EAEC, astA, aggR, and pic; for EIEC, invE; for NTEC, cnf1, cnf2, cdt-I, cdt-II, cdt-III, and cdt-IV.
Table 2. Primers and PCR conditions used for the detection of virulence genes.
Table 2. Primers and PCR conditions used for the detection of virulence genes.
PathotypeGenePrimerSequence 5′ → 3′Annealing
Temp. (°C)
Amplicon
Size (bp)
References
STEC/
EHEC
stx1stx1FATAAATCGCCATTCGTTGACTAC60180[41]
stx1RGAACGCCCACTGAGATCATC
stx2stx2FGGCACTGTCTGAAACTGCTCC60255
stx2RTCGCCAGTTATCTGACATTCTG
hlyAhlyAFGCATCATCAAGCGTACGTTCC60534
hlyARAATGAGCCAAGCTGGTTAAGCT
EHEC/
EPEC
eaeAeaeAFGACCCGGCACAAGCATAAGC60384
eaeARCCACCTGCAGCAACAAGAGG
EPECescVMP3-escV-FATTCTGGCTCTCTTCTTCTTTATGGCTG63544[42]
MP3-escV-RCGTCCCCTTTTACAAACTTCATCGC
bfpBMP3-bfpB-FGACACCTCATTGCTGAAGTCG63910
MP3-bfpB-RCCAGAACACCTCCGTTATGC
entent-FTGGGCTAAAAGAAGACACACTG63629
ent-RCAAGCATCCTGATTATCTCACC
ETECeltMP2-LT-FGAACAGGAGGTTTCTGCGTTAGGTG63655
MP2-LT-RCTTTCAATGGCTTTTTTTTGGGAGTC
estIaMP4-STIa-FCCTCTTTTAGYCAGACARCTGAATCASTTG63157
MP4-STIa-RCAGGCAGGATTACAACAAAGTTCACAG
estIbMP2-STI-FTGTCTTTTTCACCTTTCGCTC63171
MP2-STI-RCGGTACAAGCAGGATTACAACAC
EIECinvEMP2-invE-FCGATAGATGGCGAGAAATTATATCCCG63766
MP2-invE-RCGATCAAGAATCCCTAACAGAAGAATCAC
EAECastAMP-astA-FTGCCATCAACACAGTATATCCG63102
MP2-astA-RACGGCTTTGTAGTCCTTCCAT
aggRMP2-aggR-FACGCAGAGTTGCCTGATAAAG63400
MP2-aggR-RAATACAGAATCGTCAGCATCAGC
picMP2-pic-FAGCCGTTTCCGCAGAAGCC631111
MP2-pic-RAAATGTCAGTGAACCGACGATTGG
NTECcnf1Cnf1FGGGGGAAGTACAGAAGAATTA551111[43]
Cnf1RTTGCCGTCCACTCTCTCACCAGT
cnf2Cnf2FTATCATACGGCAGGAGGAAGCACC551240
Cnf2RGTCACAATAGACAATAATTTTCCG
cdt-ICdt1FCAATAGTCGCCCACAGGA56412
Cdt1RATAATCAAGAACACCACCAC
cdt-IICdt2FGAAAATAAATGGAATATAAATGTCCG56558
Cdt2RTTTGTGTTGCCGCCGCTGGTGAAA
cdt-IIICdt3FGAAAATAAATGGAATATAAATGTCCG56558
Cdt3RTTTGTGTCGGTGCAGCAGGGAAAA
cdt-IVCdt4FCCTGATGGTTCAGGAGGCTGGTTC56350
Cdt4RTTGCTCCAGAATCTATACCT
Legend: EPEC: Enteropathogenic Escherichia coli, STEC: Shiga Toxin-producing E. coli, EHEC: Enterohemorrhagic E. coli, ETEC: Enterotoxigenic E. coli, EIEC: Enteroinvasive E. coli, EAEC: Enteroaggregative E. coli, NTEC: Necrotoxic E. coli.

3. Results

3.1. Escherichia coli Isolation

Escherichia coli strains were isolated from 54 (84.37%) out of 64 fecal samples examined. From each positive sample, a single E. coli isolate was selected for subsequent analyses. Confirmation of the strains as E. coli was achieved through PCR detection of the uspA gene. Table 3 summarizes the number of isolates obtained for each raptor species.

3.2. Antimicrobial Susceptibility Tests

Antimicrobial susceptibility testing was conducted on all 54 E. coli isolates, with the detailed results presented in Table 4. Most isolates demonstrated resistance to at least one antimicrobial agent. The highest resistance rates were observed for ampicillin, with 22/54 isolates (40.74%) resistant; enrofloxacin and ciprofloxacin, each with 17/54 (31.48%) resistant isolates; and tetracycline, with 14/54 isolates (25.93%) resistant.
Conversely, the highest susceptibility rates were noted for colistin, with all 54 isolates (100%) susceptible; followed by amikacin, with 51/54 isolates (94.44%) susceptible; ertapenem, with 49/54 isolates (90.74%) susceptible; gentamicin, with 47/54 isolates (87.04%) susceptible; chloramphenicol, with 46/54 isolates (85.19%) susceptible; and imipenem, aztreonam and trimethoprim-sulfamethoxazole, each with 44/54 isolates (81.48%) susceptible.
Based on the results of the antimicrobial susceptibility tests, the antimicrobial resistance profiles of the 54 isolates were characterized (Table 5 and Table 6). Of these, 16/54 (29.63%) isolates were classified as MDR, including 4 from buzzard, 3 from kestrel, 3 from peregrine falcon, 2 from tawny owl, 1 from little owl, 1 from barn owl, 1 from black kite, and 1 from sparrowhawk. Additionally, 4/54 (7.41%) isolates were identified as XDR, with one isolate each from a kestrel, a little owl, a peregrine falcon, and a barn owl. The remaining 34/54 (62.96%) isolates did not fall into any resistance category; among these, 24/54 (44.44%) isolates showed no resistance to any of the tested antimicrobials, whereas 10 (18.52%) exhibited resistance to at least 1 antimicrobial agent.

3.3. Genotypic Resistance

Molecular analyses were performed on 36/54 (66.67%) isolates that exhibited phenotypic resistance or intermediate susceptibility to penicillins and/or cephalosporins. Among these, 17/36 (47.22%) isolates tested positive for one or more resistance genes. Specifically, the blaTEM gene was detected in 13/36 (36.11%) isolates, the blaCTX-M gene in 4/36 (11.11%) isolates, the blaCMY-2 gene in 3/36 (8.33%) isolates, and the blaSHV gene in 1/36 (2.78%) isolates.
The blaCMY-1 gene was not identified in any of the tested strains. Notably, some isolates harbored multiple resistance genes: one was positive for both blaCMY2 and blaTEM, another for blaTEM and blaCTX-M, one for blaSHV and blaTEM, and another for blaCMY2 and blaCTX-M.
Regarding carbapenem-resistant (5/54, 9.25%) or intermediate (8/54, 14.81%) isolates, none tested positive for carbapenemase genes blaNDM, blaKPC, blaVIM, blaIMP, or blaOXA-48.
In the case of tetracycline-resistant isolates, 13/14 (92.86%) carried tet genes. Specifically, 9/14 (64.29%) isolates harbored the tet(A) gene, and 4/14 (28.57%) isolates carried the tet(B) gene. No isolates harbored both genes simultaneously. The single isolate with intermediate susceptibility in the disk diffusion test was negative for both tet(A) and tet(B).
Among the eight chloramphenicol-resistant isolates (8/54, 14.81%), one carried the cat1 gene, and two carried the cmlA gene; none exhibited both genes concurrently.
Table 5 and Table 6 summarize the resistance gene profiles of the tested E. coli isolates, while Table 7 reports the distribution of antimicrobial resistance genes across raptor species.

3.4. Virulence Factors

Among the virulence factors analyzed, only astA, eaeA, and escV genes were detected (Table 5, Table 6 and Table 7). Notably, 15/54 (27.78%) isolates carried only the astA gene. Additionally, 1/54 (1.85%) isolates tested positive for astA, eaeA, and escV genes, and were classified as atypical EPEC (aEPEC).
Consequently, the following E. coli pathotypes were not identified in this study: STEC, EHEC, ETEC, EIEC, EAEC, and NTEC.
Table 5 and Table 6 summarize the virulent gene profiles of the tested E. coli isolates, while Table 7 reports the distribution of virulent genes across raptor species.

4. Discussion

Raptors are apex predators and mesopredators that forage across urban, rural, and natural environments, making them valuable bioindicators and sentinels of ecosystem health [44,45]. However, their scavenging behavior and position in the food chain also predispose them to accumulate pathogens and resistant bacteria, potentially turning them into reservoirs and vectors for the dissemination of these agents [23,26].
In the present study, E. coli isolated from raptors were characterized to assess their antimicrobial resistance and virulent traits. The examined birds showed no signs of intestinal or extraintestinal infection consistent with colibacillosis or other infectious disease; thus, they can be considered healthy from a clinical perspective. Consequently, the E. coli isolates obtained can be considered likely commensal bacteria, constituting part of the normal intestinal flora of their hosts. As previously reported, all samples were obtained from birds admitted to a rescue center. Fecal samples were collected promptly upon admission and prior to any medical treatment, ensuring that the center’s housing conditions and medical interventions did not influence the birds’ intestinal microflora. Therefore, it can be reasonably assumed that the bacterial strains recovered and analyzed most accurately represent the birds’ prior environmental exposures. In particular, the analyzed strains accurately represent the microbial exposure encountered by birds in their natural habitats. As such, they provide a comprehensive snapshot of ecosystem pollution, highlighting the presence of antimicrobial residues, resistant bacteria, and pathogenic organisms.
The initial focus of this study was to assess the antimicrobial resistance profile of the isolated E. coli strains. Notably, the highest resistance rates were observed against β-lactams, fluoroquinolones, and tetracycline.
For β-lactams, particularly, 40.74% of isolates exhibited resistance to ampicillin. Resistance to cephalosporins ranged from approximately 15 to 20%. Notably, only a few strains showed resistance to carbapenems. β-lactam antibiotics, including penicillins, cephalosporins, and carbapenems, remain cornerstone drugs in both human and veterinary medicine. However, their widespread overuse and misuse have contributed significantly to the proliferation of resistance [19,46]. Therefore, our results are not unexpected; in fact, with some exceptions, the resistance rates observed in our investigation are generally comparable to or lower than those reported in other studies involving raptors. For instance, only one study from the U.S.A. reported a lower percentage of β-lactams resistant E. coli, with a resistance rate of 12% to ampicillin in isolates from raptors [22]. Conversely, a research from Portugal on common buzzards found that 61.1% of E. coli isolates were resistant to ampicillin, and 44.4% showed resistance to cefoxitin [18]. Similarly, a study in Central Italy on wild birds reported that 85% of E. coli isolates were resistant to ampicillin, with about 10% resistant to other β-lactams tested; among the 59 strains from raptors, resistance levels were comparable [29]. Additionally, a study on black kites in southwestern Siberia found that 76% of E. coli isolates were resistant to ampicillin and 43% to cefotaxime [47].
Approximately 47.22% of the phenotypically β-lactams resistant E. coli tested positive for resistance genes. Notably, all genotypically positive strains exhibited resistance to at least ampicillin. The most frequently detected gene was blaTEM, identified in 36.11% of the resistant isolates. This finding aligns with the historical prominence of blaTEM as the first ESBL gene to emerge and disseminate globally. Similar patterns have been observed in previous studies in E. coli isolates from raptors, which also reported a high prevalence of blaTEM [18,22]. Other bla genes were detected at low frequencies or not at all in this study. This is consistent with their relative rarity, except for blaCTX-M, which has recently increased in prevalence. Currently, blaCTX-M is considered the most widespread ESBL gene and a major contributor to β-lactams resistance worldwide [48].
The emergence of Extended Spectrum Beta-Lactamase (ESBL)-producing Enterobacteriaceae represents a growing global health concern, especially given the widespread use of beta-lactam antibiotics and the critical role of some as last-resort treatments. The relatively high detection rate of bla genes in wild raptors observed during this survey underscores the extensive dissemination of these resistance determinants across different environments. This finding highlights the potential for environmental pathways and ecological niches that may serve as reservoirs for these resistance genes and that can facilitate their spread.
Approximately 25% of the tested E. coli isolates exhibited resistance to tetracyclines. These findings align with the widespread use of these antimicrobials in animals, especially livestock, which has been shown to contribute significantly to the emergence and dissemination of resistance [49]. Consequently, our results are consistent with existing knowledge. However, the prevalence of tetracycline resistance in E. coli isolated from raptors varies considerably across different studies in the literature. For instance, a study conducted in Portugal focusing solely on common buzzards reported a high resistance rate of 75% [18]. In contrast, research from central Italy examining multiple raptor species documented a much lower resistance rate of approximately 8.47% [29]. Similarly, a study from the United States found that tetracycline was the most frequently detected resistance among E. coli from raptors, with about 16% isolates resistant [22]. These disparities likely reflect differences in geographic regions, level of anthropogenic influences, and the habitat preferences of the birds, particularly their exposure to human-related environments. Additionally, variation may be influenced by the specific raptor species examined, especially considering differences in their typical prey, which can impact the resistance gene profiles they acquire [50]. In our study, all but one of the tetracycline-resistant E. coli isolates tested positive for the targeted tet genes. Notably, we observed a higher positivity rate for tet(A) compared to tet(B). These two genes were selected based on their frequent detection in tetracycline-resistant E. coli [7], and our findings support this pattern. Limited literature is available regarding tetracycline resistance genes in E. coli from raptors. One study on common buzzards reported that 60% of tetracycline-resistant isolates harbored the tet(A) and/or tet(B) genes [18]. Another investigation in the U.S.A. identified tet(M) in tetracycline-resistant E. coli, albeit at a low detection rate [22].
A high proportion of strains tested in our study were not susceptible to fluoroquinolones, including enrofloxacin and ciprofloxacin. Quinolones are classified as “highest priority critically important antimicrobials (HPCIA)” by the World Health Organization due to their significance in human medicine [51]. However, some quinolones, particularly enrofloxacin, are widely used in veterinary medicine for both pets and livestock [52]. Given this context, our findings align with expectations, although fluctuations in resistance levels are evident across different studies. For example, a report from Italy documented 16% of ciprofloxacin-resistant E. coli in raptors [29], while a U.S.A. study reported 5.35% resistance in E. coli from raptors [22]. Additionally, research on black kites in southwestern Siberia found 13% ciprofloxacin-resistant strains [24]. Conversely, a study in Portugal reported that 50% of E. coli isolates from common buzzards were resistant to ciprofloxacin [18]. Resistance to these antimicrobials is generally associated with chromosomal mutations in genes coding for DNA gyrase and topoisomerase IV, rather than the presence of mobile resistance genes [7,24]. Consequently, the molecular mechanisms underlying resistance were not investigated in the present study.
A relatively small proportion (14.81%) of the tested isolates exhibited resistance to chloramphenicol. Excluding data from Portugal, where 41% of E. coli isolates from common buzzards were resistant [18], the overall resistance levels in E. coli form raptors remain low, generally under 10% [22,29]. This low prevalence is likely attributable to the ban on chloramphenicol use in livestock implemented in the mid-1990s in many countries [7]. Despite the relatively low number of chloramphenicol-resistant E. coli identified in our study, we conducted further investigations for transferable resistance genes, given the clinical significance of this antimicrobial in human medicine. Three of the isolates tested positive: one for the cat1 gene and two for the cmlA gene. Similar findings have been reported by other researchers studying E. coli from raptors [18,22]. Both genes are commonly found in Enterobacteriaceae and confer chloramphenicol resistance through distinct mechanisms of action [7].
Regarding the other antimicrobials tested in this study, only a limited number of strains exhibited resistance to aminoglycosides and sulfonamides, while all strains were susceptible to colistin. Similar findings have been reported by other researchers studying E. coli isolated from raptors [18,22,29]. Given the growing concern over colistin resistance in recent years, particularly with the emergence and dissemination of mobile colistin resistance genes, these results are reassuring. They suggest a low or negligible impact of colistin resistance within the studied population and geographic area.
Considering the phenotypic and genotypic resistance data discussed above, some discrepancies have emerged. Specifically, certain strains exhibited phenotypic resistance to specific antimicrobials despite testing negative for all the resistance genes examined. Since E. coli is not intrinsically resistant to any antimicrobials, all observed resistance must be considered acquired [32]. The resistance genes selected for this study were chosen based on their clinical significance and epidemiological relevance, as they are among the most frequently detected in E. coli and other Enterobacteriaceae. Nonetheless, other resistance mechanisms have been described in this species, including chromosomal mutations and less commonly identified mobile resistance genes, which may account for some of the phenotypic resistance observed without corresponding genotypic markers [7].
Based on antimicrobial resistance results, we were able to assess the multidrug resistance profiles of the isolated E. coli strains. Co-resistance to antimicrobials across different classes significantly limits therapeutic options, posing a major challenge in infectious disease management. Consequently, this topic holds considerable importance and relevance. In our study, although 44.44% of the tested strains did not exhibit resistance to any of the evaluated antimicrobials, 37.04% were multidrug-resistant. Specifically, 29.63% were classified as MDR, and 7.41% as XDR. Data on multidrug resistance in E. coli from raptors are limited and show considerable variability across different studies. For example, research conducted in southwestern Siberia on E. coli isolated from black kites reported a high MDR prevalence of 94.1% [24]. Similarly, a study on E. coli from common buzzards in Portugal, although not specifying the exact number of MDR strains, noted that only one out of 36 isolates was susceptible to all tested antimicrobials [18]. Conversely, a study from the U.S.A. found that just 8% E. coli isolates from raptors exhibited MDR profiles [22]. In Central Italy, one study reported less than 20% MDR E. coli [29], while another from northern Italy observed a prevalence of 39.6% [19]. These variations may be influenced by differences in raptor species, geographic locations, and environmental factors. As apex predators, birds of prey can serve as valuable bioindicators, reflecting the presence and circulation of antimicrobial-resistant bacteria within specific habitats. These resistance patterns are likely shaped by multiple factors, particularly human activity and environmental contamination.
The second focus of this study was to assess the carriage of pathogenic E. coli by raptors. The findings suggest that raptors play a limited role in the dissemination of the enteric E. coli pathotypes. Specifically, none of the tested isolates belonged to STEC, EHEC, ETEC, EIEC, EAEC, or NTEC; only one aEPEC strain was identified, and 27.78% of isolates only carried the astA gene. Although E. coli strains from all these pathogenic groups are significant human health concerns, data on their presence in raptors remain scarce. Existing studies often do not distinguish between wild bird orders or species, especially those involving older or negative results. Generally, wild birds can serve as carriers of pathogenic E. coli, but detection rates tend to be low. Non-raptor birds, such as Passeriformes, Anseriformes, or Columbiformes, are more frequently found positive for InPEC [27,53,54]. Regarding raptors, a Brazilian study reported the isolation of one eae positive E. coli from 37 birds of the order Strigiformes, all of which were negative for stx genes [54]. Similarly, a Spanish study detected eae-positive E. coli in one owl among 79 strains from various bird species [55]. In southwestern Siberia, in 36 E. coli isolates from black kites, researchers revealed the presence of the cnf1 gene in one strain [24]. Additionally, a previous culture-independent study carried out in the same geographic area of the present investigation identified stx1, stx2, eaeA, and hylA genes in the intestine of one little owl out of nine tested raptors across different species [27]. Overall, our findings confirm that diurnal and nocturnal raptors have a minimal role as carriers, reservoirs, and spreaders of InPEC, despite being apex predators. However, the detection of virulent strains warrants attention, as it indicates the circulation of E. coli harboring selected virulence determinants in the area studied, highlighting the potential of raptors as bioindicators. Moreover, these strains pose risks of severe illnesses to both humans and domestic animals. Although atypical EPEC are generally less virulent than typical EPEC (tEPEC), they can still cause disease [2]. While tEPEC have primarily humans as reservoirs, aEPEC are zoonotic, maintained and transmitted to humans by animals [4]. Our data underscore the presence of aEPEC among wild bird populations and extend knowledge about potential carrier species. Notably, 27.78% of isolates carried the astA gene, which encodes a heat-stable toxin (EAST1) associated with secretory diarrhea. While commonly linked to EAEC, astA is also found in other pathotypes such as ETEC and DAEC [2]. Furthermore, astA can be located either on the chromosome or on plasmids, which enhances its ability to spread efficiently between isolates. Although EAST1 shares structural similarities with the heat-stable enterotoxin encoded by ETEC, its individual functional significance remains uncertain in the absence of other virulence factors. It is likely that this toxin plays a supportive role, enhancing the activity of other virulent determinants rather than acting as a primary virulence factor on its own [2]. However, the sole presence of astA, without other pathogenic markers, is sufficient to cause diarrhea in humans [56]. Our results reveal an active circulation of these virulent E. coli strains within the studied area and among the sampled bird population. They also expand our understanding of the potential spreaders of E. coli harboring selected virulence determinants, emphasizing the importance of monitoring wildlife as indicators of environmental, veterinary, and public health risks, in the One Health perspective.
The present study has some limitations that should be acknowledged. Firstly, the sample size of animals included was relatively limited. While working with wildlife, particularly non-hunting and protected species, poses significant challenges, increasing the number of raptors studied would enhance the representativeness and robustness of the findings. Additionally, for some species, only one or a few individuals were sampled, which restricts the ability to assess species-specific contributions to the observed results.
The second limitation pertains to the opportunistic sampling strategy employed. Specifically, only raptors admitted to a wildlife rescue center, primarily due to trauma, were included. Although this approach is ethically advantageous, avoiding the trapping and stress associated with active capture, it may not yield a sample that accurately reflects the broader wild population, potentially introducing bias.
Finally, we limited our analysis to a single colony from each sample to optimize resource use and enable more extensive analyses. However, expanding the sampling to include multiple colonies from the same animal would provide a broader perspective on the within-host diversity of E. coli, thereby enriching our understanding of its ecological and epidemiological dynamics.

5. Conclusions

The present study reinforces evidence that raptors can harbor E. coli exhibiting relevant antimicrobial resistance phenotypes, resistance genes, and selected virulence determinants. The resistance patterns observed were predominantly associated with resistance to aminopenicillins, fluoroquinolones, and tetracyclines. The detection of some mobile resistance genes further corroborates the potential of raptors to serve as reservoirs of clinically significant resistance traits.
Additionally, the identification of virulent E. coli, such as astA-positive isolates and atypical EPEC, emphasizes the capacity of these birds to harbor potentially zoonotic strains.
The coexistence of resistance traits and virulence genes within certain isolates raises concerns regarding their pathogenic potential and the risk of transmission to domestic animals or humans.
Our findings confirm that raptors are effective bioindicators for antimicrobial resistance and virulent bacteria in the environment, reflecting exposure to anthropogenic, livestock, and natural reservoirs within their foraging territories. Their ecological characteristics, including mobility and frequent interaction with human-related habitats, make them not only sensitive bioindicators of ecosystem health but also potential vectors of resistant bacteria.
Lastly, this research highlights the dual role of wildlife rescue centers as both healthcare facilities for injured wildlife and critical monitoring points for environmental health. It underscores the need for strict biosecurity protocols within these facilities to prevent the spread of antimicrobial-resistant and virulent bacteria, and to protect the health and safety of center personnel.

Author Contributions

Conceptualization, V.V.E.; formal analysis, G.C. and F.B.; investigation, G.C., F.B., A.D.P., R.C., and V.V.E.; resources, V.V.E.; writing—original draft preparation, G.C., F.B., and V.V.E.; writing—review and editing, F.B. and V.V.E.; supervision, V.V.E. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the University of Pisa, Fondi Ateneo 2024.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding author.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Gordon, D.M. The ecology of Escherichia coli. In Escherichia coli: Pathotypes and Principles of Pathogenesis: Second Edition; Elsevier Inc.: Amsterdam, The Netherlands, 2013; pp. 3–20. ISBN 9780123970480. [Google Scholar]
  2. Pakbin, B.; Brück, W.M.; Rossen, J.W.A. Virulence factors of enteric pathogenic Escherichia coli: A Review. Int. J. Mol. Sci. 2021, 22, 9922. [Google Scholar] [CrossRef]
  3. Pokharel, P.; Dhakal, S.; Dozois, C.M. The diversity of Escherichia coli pathotypes and vaccination strategies against this versatile bacterial pathogen. Microorganisms 2023, 11, 344. [Google Scholar] [CrossRef]
  4. Gomes, T.A.T.; Elias, W.P.; Scaletsky, I.C.A.; Guth, B.E.C.; Rodrigues, J.F.; Piazza, R.M.F.; Ferreira, L.C.S.; Martinez, M.B. Diarrheagenic Escherichia coli. Braz. J. Microbiol. 2016, 47, 3–30. [Google Scholar] [CrossRef] [PubMed]
  5. De Rycke, J.; Milon, A.; Oswald, E. Necrotoxic Escherichia coli (NTEC): Two emerging categories of human and animal pathogens. Vet. Res. 1999, 30, 221–233. [Google Scholar]
  6. Mainil, J.G.; Jacquemin, E.; Oswald, E. Prevalence and identity of cdt-related sequences in necrotoxigenic Escherichia coli. Vet. Microbiol. 2003, 94, 159–165. [Google Scholar] [CrossRef]
  7. Poirel, L.; Madec, J.-Y.; Lupo, A.; Schink, A.-K.; Kieffer, N.; Nordmann, P.; Schwarz, S. Antimicrobial resistance in Escherichia coli. Microbiol. Spectr. 2018, 6, 10–1128. [Google Scholar] [CrossRef]
  8. Costa, D.; Poeta, P.; Sáenz, Y.; Vinué, L.; Coelho, A.C.; Matos, M.; Rojo-Bezares, B.; Rodrigues, J.; Torres, C. Mechanisms of antibiotic resistance in Escherichia coli isolates recovered from wild animals. Microb. Drug Resist. 2008, 14, 71–77. [Google Scholar] [CrossRef]
  9. Paitan, Y. Current trends in antimicrobial resistance of Escherichia coli. In Current Topics in Microbiology and Immunology; Springer: Berlin/Heidelberg, Germany, 2018; Volume 416, pp. 181–211. [Google Scholar]
  10. Nang, S.C.; Li, J.; Velkov, T. The rise and spread of mcr plasmid-mediated polymyxin resistance. Crit. Rev. Microbiol. 2019, 45, 131–161. [Google Scholar] [CrossRef]
  11. EFSA (European Food Safety Authority); ECDC (European Centre for Disease Prevention and Control). The European Union Summary Report on Antimicrobial Resistance in zoonotic and indicator bacteria from humans, animals and food in 2023–2024. EFSA J. 2026, 24, e8583. [Google Scholar] [PubMed]
  12. Silva, A.; Silva, V.; Tavares, T.; López, M.; Rojo-Bezares, B.; Pereira, J.E.; Falco, V.; Valentão, P.; Igrejas, G.; Sáenz, Y.; et al. Rabbits as a reservoir of multidrug-resistant Escherichia coli: Clonal lineages and public health impact. Antibiotics 2024, 13, 376. [Google Scholar] [CrossRef] [PubMed]
  13. Adorján, A.; Makrai, L.; Mag, T.; Jánosi, S.; Könyves, L.; Tóth, I. High Frequency of multidrug-resistant (MDR) atypical Enteropathogenic Escherichia coli (aEPEC) in broilers in Hungary. Front. Vet. Sci. 2020, 7, 511. [Google Scholar] [CrossRef]
  14. Al-Marri, T.; Al-Marri, A.; Al-Zanbaqi, R.; Al Ajmi, A.; Fayez, M. Multidrug resistance, biofilm formation, and virulence genes of Escherichia coli from backyard poultry farms. Vet. World 2021, 14, 2869. [Google Scholar] [CrossRef] [PubMed]
  15. Literak, I.; Dolejska, M.; Radimersky, T.; Klimes, J.; Friedman, M.; Aarestrup, F.M.; Hasman, H.; Cizek, A. Antimicrobial-resistant faecal Escherichia coli in wild mammals in central Europe: Multiresistant Escherichia coli producing extended-spectrum beta-lactamases in wild boars. J. Appl. Microbiol. 2010, 108, 1702–1711. [Google Scholar] [CrossRef] [PubMed]
  16. Barth, S.A.; Blome, S.; Cornelis, D.; Pietschmann, J.; Laval, M.; Maestrini, O.; Geue, L.; Charrier, F.; Etter, E.; Menge, C.; et al. Faecal Escherichia coli as biological indicator of spatial interaction between domestic pigs and wild boar (Sus scrofa) in Corsica. Transbound. Emerg. Dis. 2018, 65, 746–757. [Google Scholar] [CrossRef] [PubMed]
  17. Vittecoq, M.; Godreuil, S.; Prugnolle, F.; Durand, P.; Brazier, L.; Renaud, N.; Arnal, A.; Aberkane, S.; Jean-Pierre, H.; Gauthier-Clerc, M.; et al. Antimicrobial resistance in wildlife. J. Appl. Ecol. 2016, 53, 519–529. [Google Scholar] [CrossRef]
  18. Radhouani, H.; Poeta, P.; Gonçalves, A.; Pacheco, R.; Sargo, R.; Igrejas, G. Wild birds as biological indicators of environmental pollution: Antimicrobial resistance patterns of Escherichia coli and enterococci isolated from common buzzards (Buteo buteo). J. Med. Microbiol. 2012, 61, 837–843. [Google Scholar] [CrossRef]
  19. Prandi, I.; Bellato, A.; Nebbia, P.; Stella, M.C.; Ala, U.; von Degerfeld, M.M.; Quaranta, G.; Robino, P. Antibiotic resistant Escherichia coli in wild birds hospitalised in a wildlife rescue centre. Comp. Immunol. Microbiol. Infect. Dis. 2023, 93, 101945. [Google Scholar] [CrossRef]
  20. Cagnoli, G.; Bertelloni, F.; Ceccherelli, R.; Ebani, V.V. Antimicrobial resistance and pathotypes of Escherichia coli isolates from yellow-legged seagulls (Larus michahellis) in Central Italy. Animals 2024, 14, 3048. [Google Scholar] [CrossRef]
  21. Handrova, L.; Kmet, V. Antibiotic resistance and virulence factors of Escherichia coli from eagles and goshawks. J. Environ. Sci. Health Part B 2019, 54, 605–614. [Google Scholar] [CrossRef]
  22. Hathcock, T.; Poudel, A.; Kang, Y.; Butaye, P.; Raiford, D.; Mobley, T.; Wang, C.; Bellah, J. Multidrug-Resistant Escherichia coli and tetracycline-resistant Enterococcus faecalis in wild raptors of Alabama and Georgia, USA. J. Wildl. Dis. 2019, 55, 482–487. [Google Scholar]
  23. Guenther, S.; Aschenbrenner, K.; Stamm, I.; Bethe, A.; Semmler, T.; Stubbe, A.; Stubbe, M.; Batsajkhan, N.; Glupczynski, Y.; Wieler, L.H.; et al. Comparable High Rates of Extended-Spectrum-Beta-Lactamase-Producing Escherichia coli in Birds of Prey from Germany and Mongolia. PLoS ONE 2012, 7, e53039. [Google Scholar] [CrossRef]
  24. Tarabai, H.; Krejci, S.; Karyakin, I.; Bitar, I.; Literak, I.; Dolejska, M. Clinically relevant antibiotic resistance in Escherichia coli from black kites in southwestern Siberia: A genetic and phenotypic investigation. mSphere 2023, 8, e00099-23. [Google Scholar] [CrossRef]
  25. Tarabai, H.; Valcek, A.; Jamborova, I.; Vazhov, S.V.; Karyakin, I.V.; Raab, R.; Literak, I.; Dolejska, M. Plasmid-mediated mcr-1 colistin resistance in Escherichia coli from a black kite in Russia. Antimicrob. Agents Chemother. 2019, 63, e01266-19. [Google Scholar] [CrossRef] [PubMed]
  26. Skarżyńska, M.; Zaja̧c, M.; Bomba, A.; Bocian, Ł.; Kozdruń, W.; Polak, M.; Wia̧cek, J.; Wasyl, D. Antimicrobial resistance glides in the sky—Free-living birds as a reservoir of resistant Escherichia coli with zoonotic potential. Front. Microbiol. 2021, 12, 656223. [Google Scholar] [CrossRef]
  27. Bertelloni, F.; Lunardo, E.; Rocchigiani, G.; Ceccherelli, R.; Ebani, V. Occurrence of Escherichia coli virulence genes in feces of wild birds from Central Italy. Asian Pac. J. Trop. Med. 2019, 12, 142–146. [Google Scholar] [CrossRef]
  28. Hughes, L.A.; Bennett, M.; Coffey, P.; Elliott, J.; Jones, T.R.; Jones, R.C.; Lahuerta-Marin, A.; McNiffe, K.; Norman, D.; Williams, N.J.; et al. Risk factors for the occurrence of Escherichia coli virulence genes eae, stx1 and stx2 in wild bird populations. Epidemiol. Infect. 2009, 137, 1574–1582. [Google Scholar] [CrossRef] [PubMed]
  29. Musa, L.; Stefanetti, V.; Casagrande Proietti, P.; Grilli, G.; Gobbi, M.; Toppi, V.; Brustenga, L.; Magistrali, C.F.; Franciosini, M.P. Antimicrobial susceptibility of commensal E. coli isolated from wild birds in Umbria (Central Italy). Animals 2023, 13, 1776. [Google Scholar] [CrossRef]
  30. Chen, J.; Griffiths, M.W. PCR differentiation of Escherichia coli from other Gram-negative bacteria using primers derived from the nucleotide sequences flanking the gene encoding the universal stress protein. Lett. Appl. Microbiol. 1998, 27, 369–371. [Google Scholar] [CrossRef]
  31. CLSI M02; Performance Standards for Antimicrobial Disk Susceptibility Tests. Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2018.
  32. CLSI M100; M100 Performance Standards for Antimicrobial Susceptibility Testing A CLSI Supplement for Global Application. Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2023.
  33. CLSI M07; Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria That Grow Aerobically. Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2018.
  34. Magiorakos, A.P.; Srinivasan, A.; Carey, R.B.; Carmeli, Y.; Falagas, M.E.; Giske, C.G.; Harbarth, S.; Hindler, J.F.; Kahlmeter, G.; Olsson-Liljequist, B.; et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect. 2012, 18, 268–281. [Google Scholar] [CrossRef]
  35. Hall, T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar]
  36. Dallenne, C.; Da Costa, A.; Decré, D.; Favier, C.; Arlet, G. Development of a set of multiplex PCR assays for the detection of genes encoding important β-lactamases in Enterobacteriaceae. J. Antimicrob. Chemother. 2010, 65, 490–495. [Google Scholar] [CrossRef]
  37. Hasman, H.; Mevius, D.; Veldman, K.; Olesen, I.; Aarestrup, F.M. β-Lactamases among extended-spectrum β-lactamase (ESBL)-resistant Salmonella from poultry, poultry products and human patients in The Netherlands. J. Antimicrob. Chemother. 2005, 56, 115–121. [Google Scholar] [CrossRef]
  38. Poirel, L.; Walsh, T.R.; Cuvillier, V.; Nordmann, P. Multiplex PCR for detection of acquired carbapenemase genes. Diagn. Microbiol. Infect. Dis. 2011, 70, 119–123. [Google Scholar] [CrossRef]
  39. Dahshan, H.; Shahada, F.; Chuma, T.; Moriki, H.; Okamoto, K. Genetic analysis of multidrug-resistant Salmonella enterica serovars Stanley and Typhimurium from cattle. Vet. Microbiol. 2010, 145, 76–83. [Google Scholar] [CrossRef]
  40. Van, T.T.H.; Chin, J.; Chapman, T.; Tran, L.T.; Coloe, P.J. Safety of raw meat and shellfish in Vietnam: An analysis of Escherichia coli isolations for antibiotic resistance and virulence genes. Int. J. Food Microbiol. 2008, 124, 217–223. [Google Scholar] [CrossRef]
  41. Paton, A.W.; Paton, J.C. Detection and Characterization of Shiga Toxigenic Escherichia coli by Using Multiplex PCR Assays for stx1, stx2, eaeA, Enterohemorrhagic E. coli hlyA, rfbO111, and rfbO157. J. Clin. Microbiol. 1998, 36, 598. [Google Scholar] [CrossRef] [PubMed]
  42. Müller, D.; Greune, L.; Heusipp, G.; Karch, H.; Fruth, A.; Tschäpe, H.; Schmidt, M.A. Identification of unconventional intestinal pathogenic Escherichia coli isolates expressing intermediate virulence factor profiles by using a novel single-step multiplex PCR. Appl. Environ. Microbiol. 2007, 73, 3380–3390. [Google Scholar] [CrossRef]
  43. Borriello, G.; Lucibelli, M.G.; De Carlo, E.; Auriemma, C.; Cozza, D.; Ascione, G.; Scognamiglio, F.; Iovane, G.; Galiero, G. Characterization of enterotoxigenic E. coli (ETEC), Shiga-toxin producing E. coli (STEC) and necrotoxigenic E. coli (NTEC) isolated from diarrhoeic Mediterranean water buffalo calves (Bubalus bubalis). Res. Vet. Sci. 2012, 93, 18. [Google Scholar] [CrossRef] [PubMed]
  44. Gargiulo, A.; Fioretti, A.; Russo, T.P.; Varriale, L.; Rampa, L.; Paone, S.; De Luca Bossa, L.M.; Raia, P.; Dipineto, L. Occurrence of enteropathogenic bacteria in birds of prey in Italy. Lett. Appl. Microbiol. 2018, 66, 202–206. [Google Scholar] [CrossRef] [PubMed]
  45. Rossi, G.; Terracciano, G.; Gherardi, R.; Galosi, L.; Perrucci, S. Parasites, bacteria, and associated pathological changes in the digestive system of diurnal and nocturnal raptors in Central Italy. Pathogens 2021, 10, 1567. [Google Scholar] [CrossRef]
  46. Livermore, D.M.; Canton, R.; Gniadkowski, M.; Nordmann, P.; Rossolini, G.M.; Arlet, G.; Ayala, J.; Coque, T.M.; Kern-Zdanowicz, I.; Luzzaro, F.; et al. CTX-M: Changing the face of ESBLs in Europe. J. Antimicrob. Chemother. 2007, 59, 165–174. [Google Scholar] [CrossRef] [PubMed]
  47. Stahl, L.M.; Kadletz, S.; Olson, J.B. Patterns of antibiotic resistance in Southeastern US raptors before and after rehabilitation. Comp. Immunol. Microbiol. Infect. Dis. 2025, 123, 102388. [Google Scholar] [CrossRef]
  48. Bush, K.; Bradford, P.A. Epidemiology of β-Lactamase-producing pathogens. Clin. Microbiol. Rev. 2020, 33, 10–1128. [Google Scholar] [CrossRef]
  49. Singh, S.; Kriti, M.; K.S, A.; Sharma, P.; Pal, N.; Sarma, D.K.; Tiwari, R.; Kumar, M. A one health approach addressing poultry-associated antimicrobial resistance: Human, animal and environmental perspectives. Microbe 2025, 7, 100309. [Google Scholar] [CrossRef]
  50. Valkama, J.; Korpimäki, E.; Arroyo, B.; Beja, P.; Bretagnolle, V.; Bro, E.; Kenward, R.; Mañosa, S.; Redpath, S.M.; Thirgood, S.; et al. Birds of prey as limiting factors of gamebird populations in Europe: A review. Biol. Rev. Camb. Philos. Soc. 2005, 80, 171–203. [Google Scholar] [CrossRef] [PubMed]
  51. WHO (World Health Organization). WHO’s List of Medically Important Antimicrobials: A Risk Management Tool for Mitigating Antimicrobial Resistance Due to Non-Human Use; World Health Organization: Geneva, Switzerland, 2024. [Google Scholar]
  52. Grabowski, Ł.; Gaffke, L.; Pierzynowska, K.; Cyske, Z.; Choszcz, M.; Węgrzyn, G.; Węgrzyn, A. Enrofloxacin—The ruthless killer of eukaryotic cells or the last hope in the fight against bacterial infections? Int. J. Mol. Sci. 2022, 23, 3648. [Google Scholar] [CrossRef]
  53. Kobayashi, H.; Kanazaki, M.; Hata, E.; Kubo, M. Prevalence and characteristics of eae- and stx-positive strains of Escherichia coli from wild birds in the immediate environment of Tokyo Bay. Appl. Environ. Microbiol. 2008, 75, 292. [Google Scholar] [CrossRef]
  54. Sanches, L.A.; Gomes, M.D.S.; Teixeira, R.H.F.; Cunha, M.P.V.; Oliveira, M.G.X.D.; Vieira, M.A.M.; Gomes, T.A.T.; Knobl, T. Captive wild birds as reservoirs of enteropathogenic E. coli (EPEC) and shiga-toxin producing E. coli (STEC). Braz. J. Microbiol. 2017, 48, 760. [Google Scholar] [CrossRef]
  55. Alonso, C.A.; Mora, A.; Díaz, D.; Blanco, M.; González-Barrio, D.; Ruiz-Fons, F.; Simón, C.; Blanco, J.; Torres, C. Occurrence and characterization of stx and/or eae-positive Escherichia coli isolated from wildlife, including a typical EPEC strain from a wild boar. Vet. Microbiol. 2017, 207, 69–73. [Google Scholar] [CrossRef] [PubMed]
  56. Kashima, K.; Sato, M.; Osaka, Y.; Sakakida, N.; Kando, S.; Ohtsuka, K.; Doi, R.; Chiba, Y.; Takase, S.; Fujiwara, A.; et al. An outbreak of food poisoning due to Escherichia coli serotype O7:H4 carrying astA for enteroaggregative E. coli heat-stable enterotoxin1 (EAST1). Epidemiol. Infect. 2021, 149, e244. [Google Scholar] [CrossRef]
Table 3. Sampled birds and the number of isolated Escherichia coli strains.
Table 3. Sampled birds and the number of isolated Escherichia coli strains.
Common NameScientific NameNumber of Tested AnimalsIsolated E. coli
Eurasian buzzardButeo buteo1312
Common kestrelFalco tinnunculus1010
Little owlAthene noctua109
Peregrine falconFalco peregrinus97
Barn owlTyto alba75
Tawny owlStrix aluco75
Scops owlOtus scops31
Black kiteMilvus migrans22
SparrowhawkAccipiter nisus22
Honey buzzardPernis apivorus11
Total6454
Table 4. Results of the antimicrobial susceptibility tests.
Table 4. Results of the antimicrobial susceptibility tests.
AntimicrobialsResistantIntermediateSusceptible
ClassAntimicrobialNumber
of Isolates
%Number
of Isolates
%Number
of Isolates
%
PenicillinsAmpicillin2240.74712.962546.30
Amoxicillin-clavulanate814.811120.373564.81
CephalosporinsCefoxitin1120.3747.413972.22
Cefotaxime916.671222.223361.11
Ceftiofur814.8159.264175.93
CarbapenemsImipenem35.56712.964481.48
Ertapenem47.4111.854990.74
MonobactamsAztreonam814.8123.704481.48
PhenicolsChloramphenicol814.8100.004685.19
TetracyclinesTetracycline1425.9311.853972.22
FluoroquinolonesEnrofloxacin1731.4859.263259.26
Ciprofloxacin1731.4823.703564.81
AminoglycosidesGentamicin712.9600.004787.04
Amikacin11.8523.705194.44
SulfonamidesTrimethoprim-sulfamethoxazole1018.5200.004481.48
PolymyxinsColistin00.0000.0054100.00
Table 5. Phenotypic and genotypic resistance and virulence profiles of the non-multidrug-resistant isolates.
Table 5. Phenotypic and genotypic resistance and virulence profiles of the non-multidrug-resistant isolates.
Strain
Number
Bird Species
(Number of Isolates)
Antimicrobial Resistance ProfileResistance
Genes
Virulence
Genes
15, 16,
20, 21,
59, 125,
144, 145,
146, 150,
157, 158,
160, 161
Peregrine falcon (3)
Eurasian buzzard (2)
Common kestrel (1)
Little owl (2)
Barn owl (2)
Scops owl (1)
Tawny owl (2)
Black kite (1)
not resistant to all molecules  
14, 24, 25,
26, 34,
90, 126,
136, 159
Eurasian buzzard (4)
Common kestrel (3)
Little owl (2)
not resistant to all molecules astA
127Eurasian buzzard (1)not resistant to all molecules astA, eaeA, escV
17Eurasian buzzard (1)SXT astA
18Little owl (1)SXT astA
23Little owl (1)AMP, AMC, FOX  
27Little owl (1)ATM  
58Common kestrel (1)AMPblaTEM 
143Barn owl (1)AMP  
147Tawny owl (1)IPM, ETP astA
153Honey buzzard (1)FOX  
163Common kestrel (1)TEtet(A)astA
164Sparrow hawk (1)TEtet(A) 
Legend: AMP: ampicillin; AMC: amoxicillin-clavulanate; ATM: aztreonam; FOX: cefotaxime; SXT: trimethoprim-sulfamethoxazole; TE: tetracycline.
Table 6. Phenotypic and genotypic resistance and virulence profiles of the MDR and XDR isolates.
Table 6. Phenotypic and genotypic resistance and virulence profiles of the MDR and XDR isolates.
Strain
Number
Bird Species
(Number of Isolates)
Antimicrobial Resistance ProfileResistance
Genes
Virulence
Genes
22Little owl (1)AMP, AMC, FOX, ENR  
30Eurasian buzzard (1)AMP, TE, ENR, CIP, SXTblaTEM, tet(B)astA
45Eurasian buzzard (1)AMP, C, TE, ENR, CIP, SXTblaTEM, tet(A), cmIa 
46Peregrine falcon (1)AMP, C, TE, ENR, CIPblaTEM, tet(A), cmIa 
47Peregrine falcon (1)C, TE, ENR, CIP, CN, SXTtet(B) 
137Common kestrel (1)AMP, AMC, FOX, ENR, CIPblaCMY2 
138Common kestrel (1)AMP, TE, ENR, CIPblaTEM 
142Eurasian buzzard (1)AMP, AMC, FOX, CTX, TE, ENR, CIPblaCMY2, blaTEM, tet(A) 
148Tawny owl (1)AMP, C, TEblaTEM, tet(A) 
149Tawny owl (1)AMP, AMC, FOX, CTX, FUR, IPM, ETP, ATM, CIP  
151Black kite (1)AMP, CTX, FUR, ATM, ENR, CIP, CNblaCTX-M 
152Sparrowhawk (1)AMP, FOX, FUR, C, ENR, CIPblaTEM 
154Common kestrel (1)AMP, FOX, IPM, TE, ENR, CIP, SXTblaTEM, blaCTX-M, tet(A)astA
155Eurasian buzzard (1)AMP, CTX, FUR, ETP, ATM, ENR, CIP, CN  
156Barn owl (1)AMP, AMC, CTX, SXTblaTEM 
162Peregrine falcon (1)AMP, ENR, CIP, CNblaTEM 
31Barn owl (1)AMP, CTX, FUR, ATM, C, TE, ENR, CIP, SXTblaSHV, blaTEM, tet(B), cat1 
139Common kestrel (1)AMP, FOX, CTX, FUR, ETP, ATM, TE, ENR, CIP, CN, AKblaTEM, tet(B) 
140Peregrine falcon (1)AMP, AMC, FOX, CTX, FUR, ATM, C, TE, ENR, CIP, CN, SXTblaCMY2, blaCTX-M, tet(A) 
141Little owl (1)AMP, AMC, FOX, CTX, FUR, ATM, C, TE, ENR, CIP, CN, SXTblaCTX-M, tet(A) 
Legend: AK: amikacin; AMP: ampicillin; AMC: amoxicillin-clavulanate; ATM: aztreonam; C: chloramphenicol; CIP: ciprofloxacin; CN: gentamicin; CTX: cefotaxime; ENR: enrofloxacin; ETP: ertapenem; FOX: cefotaxime; FUR: ceftiofur; SXT: trimethoprim-sulfamethoxazole; TE: tetracycline; Light blue = MDR strains; light green = XDR strains.
Table 7. Distribution of virulence and resistance genes in relation to raptor species.
Table 7. Distribution of virulence and resistance genes in relation to raptor species.
SpeciesAnalyzed
Strains
Virulence GenesResistance Genes
eaeAescVastAblaCMY2blaSHVblaCTX-MblaTEMtet(A)tet(B)cat1cmIa
Eurasian buzzard1211710032101
Common kestrel1000510142100
Little owl900300101000
Peregrine falcon700010122101
Barn owl500001020110
Tawny owl500100011000
Scops owl100000000000
Black kite200000100000
Sparrowhawk200000011000
Honey buzzard100000000000
Total541116314139412
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Cagnoli, G.; Bertelloni, F.; Di Paolo, A.; Ceccherelli, R.; Ebani, V.V. Antimicrobial Resistance and Virulence Genes in Escherichia coli Isolated from Raptors in Central Italy. Vet. Sci. 2026, 13, 342. https://doi.org/10.3390/vetsci13040342

AMA Style

Cagnoli G, Bertelloni F, Di Paolo A, Ceccherelli R, Ebani VV. Antimicrobial Resistance and Virulence Genes in Escherichia coli Isolated from Raptors in Central Italy. Veterinary Sciences. 2026; 13(4):342. https://doi.org/10.3390/vetsci13040342

Chicago/Turabian Style

Cagnoli, Giulia, Fabrizio Bertelloni, Alessia Di Paolo, Renato Ceccherelli, and Valentina Virginia Ebani. 2026. "Antimicrobial Resistance and Virulence Genes in Escherichia coli Isolated from Raptors in Central Italy" Veterinary Sciences 13, no. 4: 342. https://doi.org/10.3390/vetsci13040342

APA Style

Cagnoli, G., Bertelloni, F., Di Paolo, A., Ceccherelli, R., & Ebani, V. V. (2026). Antimicrobial Resistance and Virulence Genes in Escherichia coli Isolated from Raptors in Central Italy. Veterinary Sciences, 13(4), 342. https://doi.org/10.3390/vetsci13040342

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop