Next Article in Journal
Incidence and Risk Factors of Surgical Site Infection in 376 Mastectomy Procedures in Female Dogs: A Retrospective Cohort Study
Previous Article in Journal
Optimizing Poultry Growth and Meat Quality: Effects of Guanidinoacetic Acid Supplementation in Yellow-Feathered Broilers
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Investigation of Infection of Enterocytozoon bieneusi and Giardia duodenalis in Beef Cattle in Yunnan, China

1
The Yunnan Key Laboratory of Veterinary Etiological Biology, Yunnan Agricultural University, Kunming 650201, China
2
College of Veterinary Medicine, Yunnan Agricultural University, Kunming 650201, China
3
College of Agriculture and Biological Science, Dali University, Dali 671003, China
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Vet. Sci. 2025, 12(6), 552; https://doi.org/10.3390/vetsci12060552
Submission received: 17 April 2025 / Revised: 22 May 2025 / Accepted: 3 June 2025 / Published: 5 June 2025

Simple Summary

Enterocytozoon bieneusi and Giardia duodenalis are significant zoonotic protists that infect humans and animals worldwide. Cattle are common hosts for these pathogens. Understanding the genetic diversity of these pathogens in beef cattle is crucial for disease prevention and control. This study has investigated the prevalence and genotypes of E. bieneusi and assemblages of G. duodenalis in seven beef cattle populations across four regions of Yunnan Province, China. The results demonstrate that the prevalence rates of E. bieneusi and G. duodenalis were 3.0% (16/529) and 3.6% (19/529), respectively. These two pathogens infection rates showed significant differences among animals of different age groups. Four E. bieneusi genotypes and two G. duodenalis assemblages were identified. This study reveals the prevalence of E. bieneusi and G. duodenalis in beef cattle in Yunnan Province for the first time. The findings provide essential baseline data for developing effective prevention and control strategies against these parasitic infections in the region’s cattle industry.

Abstract

Enterocytozoon bieneusi and Giardia duodenalis are major zoonotic pathogens that often cause diarrhea in immunocompromised humans or animals. Beef cattle are important reservoirs for these two pathogens. Yunnan Province is a major region for beef cattle farming, and its suitable climatic conditions facilitate the transmission of the pathogens. However, research on the prevalence and distribution of E. bieneusi and G. duodenalis in beef cattle in Yunnan remains understudied. This study collected 529 fecal samples from seven beef cattle breeds in four regions in Yunnan Province for an epidemiological survey. Nested PCR combined with sequencing was used to detect E. bieneusi and G. duodenalis, and the sequencing results were analyzed to determine genotypes or assemblage types. Our results demonstrate that the prevalence rates of E. bieneusi and G. duodenalis were 3.0% (16/529) and 3.6% (19/529), respectively. The study identified four genotypes of E. bieneusi, including I (n = 8), J (n = 4), BEB8 (n = 3), and BEB4 (n = 1). Both assemblages E (n = 18) and A (n = 1) were identified among G. duodenalis-positive animals. Phylogenetic analysis revealed that the E. bieneusi genotypes detected in this study belong to Group 2. In conclusion, these findings indicate that although the overall prevalence is relatively low compared to other regions, the presence of zoonotic Group 2 genotypes and assemblage A highlights the potential risk of cross-species transmission. Moreover, the results provide foundational data to support the development of region-specific surveillance and control strategies for bovine giardiasis and microsporidiosis, and emphasize the importance of the One Health approach in managing parasitic infections in livestock populations.

1. Introduction

Enterocytozoon bieneusi and Giardia duodenalis are globally distributed zoonotic protozoa that can infect a variety of vertebrates, including humans, livestock, and wildlife [1,2]. These pathogens are primarily transmitted through the fecal–oral route, with contaminated food and water serving as major vectors of infection [3,4]. Infection with these pathogens is typically asymptomatic in immunocompetent hosts, while immunocompromised individuals (e.g., HIV-positive patients, organ transplant recipients, children, and the elderly) may experience symptoms ranging from self-limiting diarrhea to severe wasting syndrome [5,6,7,8,9]. Recent studies have highlighted growing concerns about the role of cattle as reservoirs for these pathogens, given their close contact with humans and the environment they share [10].
The detecting of E. bieneusi accurately under the microscope is challenging, making the PCR method a common and effective approach for its identification [10]. The internal transcribed spacer (ITS) region of the rRNA gene servers as the primary genetic marker for E. bieneusi genotyping [11]. Based on ITS sequence variation, over 500 genotypes have been identified and classified into 15 phylogenetic groups [12,13]. Group 1 and 2 genotypes demonstrate public health risks, as they include genotypes with broad host range and zoonotic potential, which is the ability to transmit between animals and humans, whereas Groups 3–15 exhibit strict host specificity [3,14]. Current studies have identified over 40 E. bieneusi genotypes in cattle, predominantly from Group 2 [15,16]. Notably, 15 of these genotypes (8 from Group 1 and 7 from Group 2) have also been detected in human infections [13,15,17], indicating cattle may serve as important reservoirs for zoonotic transmission.
Similarly, G. duodenalis exhibits host-adapted genetic diversity, with eight assemblages (A–H) identified. Zoonotic assemblages A and B infect humans and animals, while assemblages C–H are host-specific. In cattle, assemblage E predominates as the most prevalent G. duodenalis genotype globally, while zoonotic assemblages A and B have been reported in some epidemiological investigations [18]. This highlights the need for surveillance in cattle populations, particularly in high-density farming regions.
Yunnan Province, located in southwestern China, is one of the country’s most important regions for beef cattle breeding. As China’s largest beef cattle production province, it maintained nearly 9 million heads of cattle in 2023, and is home to at least 15 different breeds of cattle [19]. The warm climate and intensive farming practices in Yunnan Province may facilitate the spread of pathogens. In previous studies, dairy cattle and dairy buffalo in Yunnan Province were found to be infected with E. bieneusi, with five genotypes identified in a small-scale survey of animals [20]. Furthermore, G. duodenalis assemblages A and E have been reported in both dairy cattle and Yunling cattle in Yunnan Province [21,22]. However, the prevalence of these pathogens in beef cattle in Yunnan remains understudied. The “One Health” framework highlights the need for integrated strategies to reduce disease risks at the human–animal–environment interface. A better understanding of E. bieneusi and G. duodenalis in beef cattle could inform more effective control measures. Therefore, this study aimed to determine the occurrence and their genotypes of E. bieneusi and G. duodenalis in seven cattle breeds in four regions of Yunnan, and to assess potential transmission risks to humans.

2. Materials and Methods

2.1. Sample Collection and Sampling Area

This study collected fecal samples from seven beef cattle breeds (Simmental, Brahman, Aberdeen Angus, Yunnan Yellow, Dulong, Hereford, and Humped) in four different regions in Yunnan Province (Figure 1). A total of 160 samples were obtained from Kunming, 162 from Dehong, 106 from Xishuangbanna, and 101 from Lincang (Table 1). The sampling in Baoshan, Dehong, and Xishuangbanna took place in June in 2022, while sampling in Lincang was conducted in September, and in Kunming in October 2024. All cattle were kept in confinement and fed self-produced silage and commercial concentrate feed. All samples were freshly collected and picked up with disposable polyethylene gloves; the gloves were then turned inside out and placed into appropriately sized transparent resealable bags, while simultaneously recording the sample information and collection time. Each sample was individually packaged to avoid cross-contamination between samples. Sample information was recorded during the sampling process, and the packaged samples were then transported to the laboratory, stored at −20 °C, and tested within 48 h.

2.2. DNA Extraction and PCR

Prior to genomic DNA extraction, approximately 300 mg of fecal samples preserved in potassium dichromate were washed three times with distilled water through centrifugation (2000× g for 10 min each time). The resulting pellet was processed using the FastDNA Spin Kit for Soil (MP Biomedicals, Solon, OH, USA), following the manufacturer’s protocol [21]. The purified DNA was stored at −20 °C until subsequent PCR analysis.

2.3. PCR Amplification

The detection of E. bieneusi was performed using a nested PCR assay targeting the ITS gene, as described in reference [23] (Table 2), with an expected amplicon size of approximately 392 bp. Additionally, all fecal DNA samples were subjected to PCR amplification targeting the gdh locus of Giardia spp. following the protocol outlined in reference [24] (Table 2), yielding a product of approximately 530 bp. DNA preparations of assemblage G from mice and genotype PtEb IX from dogs were used as positive controls in the PCR analysis for G. duodenalis and E. bieneusi, respectively, whereas ultrapure water was used as the negative control. After amplification, the PCR products were analyzed by agarose gel electrophoresis and visualized using a gel imaging system.

2.4. Sequence Analysis

All secondary PCR products testing positive were subjected to bidirectional sequencing at Sangon Biotech (Shanghai, China) using an ABI 3730xl Genetic Analyzer (Applied Biosystems, Thermo Fisher Scientific, Foster City, CA, USA). Sequence data processing involved the following: (1) raw trace file assembly using ChromasPro 2.0 (Technelysium Pty Ltd., Queensland, Australia), (2) manual editing and quality control in BioEdit 7.3 (Ibis Therapeutics, Carlsbad, CA, USA), and (3) multiple sequence alignment against GenBank reference sequences via Clustal Omega 1.2.4 with default parameters. Genotype classification followed international standardization guidelines [24]. Phylogenetic reconstruction was performed in MEGA-11 using the maximum likelihood algorithm, with node support evaluated by 1000 bootstrap replicates.

2.5. Statistical Analysis

The occurrence frequencies of E. bieneusi and G.duodenalis in different regions, breeds, ages, and genders were analyzed using chi-square tests in SPSS 20.0 (IBM SPSS, Chicago, IL, USA) and SAS 9.1 (SAS Institute Inc., Cary, NC, USA), with statistical significance set at p < 0.05. Odds ratios (ORs) and 95% confidence intervals (CIs) were computed to evaluate potential risk factors.

3. Results

3.1. Prevalence and Genotypes of E. bieneusi

Of the 529 fecal samples collected from beef cattle, 3.0% (95% CI: 1.56–4.49%; 16/529) were tested positive for E. bieneusi in the PCR analysis of the ITS, with infection rates ranging from 0 to 4.4% among the four locations (Table 3). The highest infection rate at Kunming was 4.4% (95% CI: 1.17–7.58%; 7/160), followed by Dehong 3.7% (95% CI: 0.76–6.64%; 6/162) and Lincang 3.0% (95% CI: −0.40–6.34%; 3/101). No E. bieneusi was detected in samples from Xishuangbanna. Of the different breeds, Simmental cattle showed the highest detection rate of 5.6% (95% CI: 2.48–8.63%; 12/216), followed by Aberdeen Angus cattle 3.8% (95% CI: −0.50–8.00%; 3/80) and Humped cattle 2.8% (95% CI: −2.86–8.42%; 1/36), while no infection was found in four other breeds. By age, the infection rate in pre-weaned calves (20.7% (95% CI: 5.01–36.37%; 6/29)) was higher than that in growing cattle (6.8% (95% CI: 0.90–12.61%; 5/74)), post-weaned calves (3.2% (95% CI: −1.30–7.75%; 2/62)), and adult cattle (0.8% (95% CI: −0.11–1.76%; 3/364)). By sex, female cattle had higher infection rates of 4.0% (95% CI: 1.57–6.50%; 10/248) than males at 2.1% (95% CI: 0.43–3.84%; 6/281). Statistical analysis revealed significant differences only among age groups (p < 0.001), while no significant differences were observed for the other three factors (region, breed, or sex).
This study identified four genotypes of E. bieneusi, namely, I, J, BEB8, and BEB4. Among them, genotype I was the most frequently detected (50.0%, 8/16), followed by J (25.0%, 4/16), BEB8 (18.8%, 3/16), and BEB4 (6.3%, 1/16). Genotype I was found in Kunming, Dehong, and Lincang; genotype J was detected in Dehong and Lincang; BEB8 and BEB4 were distributed in Kunming and Dehong, respectively. By breed, genotypes I and J were primarily found in Simmental and Aberdeen Angus cattle, while all three BEB8 cases were exclusively detected in Simmental cattle. The only BEB4 case was identified in Humped cattle. By age category, genotype I was detected in all age categories except weaned calves. Genotype J was found in young cattle and weaned calves, BEB8 was present in pre- and post-weaning calves, and the single case of BEB4 was only detected in adult cattle. In terms of sex, genotypes I and J were detected in both females and males, whereas BEB8 and BEB4 were found only in females and males, respectively. Phylogenetic analysis revealed that all the genotypes obtained in this study belong to Group 2 (Figure 2). The representative sequences have been submitted to GenBank and assigned GenBank accession numbers of PV467405 to PV467416.

3.2. Prevalence and Genotypes of G. duodenalis

Nested PCR analyses of the gdh loci revealed that 19 of the 529 fecal samples (3.6% (95% CI: 2.00–5.18%; 19/529)) were positive for G. duodenalis, with infection rates ranging from 0.9% to 7.5% among the four sampling locations (Table 4). The infection rate in Kunming was the highest (7.5% (95% CI: 3.37–11.63%; 12/160)), followed by Lincang (5.9% (95% CI: 1.25–10.63%; 6/101)) and Xishuangbanna (0.9% (95% CI: −0.93–2.81%; 1/106)). No G. duodenalis was detected in the 162 samples collected from Dehong. Among the seven beef cattle breeds, the detection rate ranged from 1.0% to 6.3%, with Aberdeen Angus cattle showing the highest rate (6.3% (95% CI: 0.83–11.67%; 5/80)), followed by Simmental (5.6% (95% CI: 2.48–8.63%; 12/216)), Hereford (4.8% (95% CI: −5.17–14.70%; 1/21)), and Brahman (0.9% (95% CI: −0.93–2.81%; 1/106)). The prevalence of G. duodenalis varied significantly across four age groups (1.1–24.1%), with the highest rate observed in pre-weaned calves (24.1% (95% CI: 7.57–40.70%; 7/29)), followed by weaned calves (6.5% (95% CI: 0.16–12.74%; 4/62)), young cattle (5.4% (95% CI: 0.13–10.68%; 4/74)), and adult cattle (1.1% (95% CI: 0.02–2.17%; 4/364)). In terms of gender, the infection rate was higher in females (4.4% (95% CI: −1.86–7.02%; 11/248)) than in males (2.8% (95% CI: 0.89–4.80%; 8/281)). Statistical analysis revealed significant differences among different regions and age groups (p < 0.001), while no significant variations were observed for the other three factors (breed, or sex). Of the positive samples in this study, 18 were identified as assemblage E, while only 1 sample (from an Aberdeen Angus cattle in Lincang) belonged to assemblage A. Phylogenetic analysis showed that among the obtained assemblage, 18 clustered within assemblage E, while a single sample was classified as assemblage 1 (Figure 3). The representative sequences have been submitted to GenBank and assigned GenBank accession numbers PV658025 to PV658030.

4. Discussion

This study provides new molecular epidemiological insights into the occurrence and genotype distribution of E. bieneusi and G. duodenalis in beef cattle in Yunnan Province, China. By combining nested PCR and sequence-based genotyping, we identified zoonotic genotypes of both parasites, albeit at relatively low infection rates. These findings contribute to the limited regional data available on parasitic protozoa in southwestern China and offer a comparative basis for understanding their epidemiological features across geographic regions. The implications of these results are multifaceted, spanning public health, veterinary parasitology, and livestock production.
The overall infection rate of E. bieneusi in Yunnan beef cattle was 3.0% (16/529), which is lower than the global pooled prevalence reported in cattle (12.9–16.6%) [26,27,28]. Furthermore, the prevalence observed in this study was lower than that reported in cattle from Asia (14.2%, 2000/14,132), Europe (16.2%, 71/441), the Americas (19.1%, 707/3703), Africa (13.2%, 20/152), and Oceania (10.4%, 49/471) [26]. Compared with other countries, the infection rate observed in this study were lower than the infection rates reported in most nations, including South Africa (7.4%), Egypt (6.1%), Thailand (5.0%), the U.S. (12.9%), Australia (10.4%), Türkiye (10.3%), South Korea (15.6%), Iran (18.7%), and Brazil (17.4%) [26]. Additionally, it was lower than the pooled prevalence of E. bieneusi in Chinese cattle (11.2–20.0%) [26,28,29,30] and lower than rates reported in Ningxia (45.9%, 50/109) [31], Jilin (37.6%, 35/93) [32], Hunan (32.3%, 144/446) [33], Heilongjiang (29.0%, 93/321) [34], Shanghai (26.5%, 214/809) [35], Henan (24.4%, 214/879) [31], Gansu (22.6%, 320/1414) [36], Shanxi (22.4%, 90/401) [37], Shaanxi (19.7%, 73/371) [38], Tianjin and Hebei (19.4%, 202/1040) [39], Xinjiang (16.5%, 85/514) [40], Zhejiang (14.0%, 37/265) [41], Jiangsu (13.0%, 177/1366) [42], Guangdong (11.1%, 160/1440) [36], Hainan (9.9%, 31/314) [43], Qinghai (7.2%, 40/554) [44], Jiangxi (5.4%, 30/556) [45], Anhui (4.2%, 40/955) [46], and Shandong (3.1%, 21/673) [35]. However, it was higher than rates reported in Yunnan (0.6%, 5/841) [20], Gansu (1.1%, 4/353) [47], Heilongjiang (1.4%, 22/1632) [48], and Tibet (2.5%, 11/442) [49].
The overall infection rate of G. duodenalis in cattle in Yunnan Province was 3.6% (19/529). Compared with other countries, this study’s overall infection rate was lower than that reported in the United States (52.0%, 237/456) [50], Scotland (32.5%, 126/388) [51], Maryland, USA (32.1%, 125/390) [52], India (12.5%, 9/72) [53], and Malaysia (8.3%, 10/120) [54], but higher than that in New Zealand (2.0%, 2/100) [55]. In China, the detection rate of G. duodenalis varies between provinces, ranging from 1.0% to 41.2% [56]. The detection rate in this study was similar to that in Tibet (3.8%, 17/442) [57] and lower than in Sichuan (41.2%, 126/306) [58], Inner Mongolia (29.5%, 149/505) [57], Yunnan (27.5%, 144/524) [21], Inner Mongolia (9.2%, 10/108) [59], Hubei (22.6%, 70/309) [60], Jiangsu (20.6%, 281/1366) [53], Shaanxi (16.8%, 29/173) [52], Xinjiang (13.4%, 69/514) [61], Qinghai (10.0%, 39/389) [62], and Henan (7.2%, 128/1777) [63], but higher than in Liaoning (3.1%, 3/98) [64], Guangdong (2.2%, 31/1440) [65], Ningxia (2.1%, 29/1366) [66], and Gansu (1.0%, 14/1414) [67].
The relatively low prevalence of E. bieneusi and G. duodenalis observed in this study may be partially attributed to the regional characteristics of cattle farming in Yunnan Province. In contrast to intensively managed, large-scale feedlots common in other parts of China or abroad, beef cattle production in Yunnan remains predominantly smallholder-based, with limited degrees of intensification and low animal stocking densities. Extensive management practices and free-range systems reduce close contact among animals, thereby potentially limiting the fecal–oral transmission of enteric protozoa such as E. bieneusi and G. duodenalis [49]. Moreover, the reduced use of shared water sources and confinement structures in these low-density farms may decrease environmental contamination and cyst/spore accumulation, further contributing to the low detection rates. These findings underscore the influence of production systems and farm ecology on pathogen circulation dynamics in livestock populations.
The four E. bieneusi genotypes (I, J, BEB4, BEB8) belonging to Group 2, which are associated with confirmed zoonotic transmission, have been identified in this study [12,15]. These genotypes were originally considered as host-specific to ruminants [3], but now demonstrate an expanding host range [68]. For instance, genotype I has been detected in diarrheic children and non-human primates in China [32,69,70]. Genotype J exhibits broad distribution in children, non-human primates, commercial broiler chickens, wild deer and pigeons [3,71,72,73,74,75,76]. Genotypes BEB4 and BEB8 have been identified in human infections, non-human primates and swine populations [3]. Notably, the four genotypes detected in our study are zoonotic genotypes identified in both humans and animals, posing potential public health risks [25,77]. In the current study, genotype I was the predominant genotype among the four detected, which is consistent with findings from Shanxi [37], Shaanxi [38], Tibet [49], and Zhejiang [78]. Genotype J is the most frequently reported genotype in most Chinese provinces [79], while genotype BEB4 has a relatively higher distribution in Qinghai [80]. Thus, our study suggests the zoonotic potential of all genotypes of E. bieneusi in Yunnan beef cattle farms.
Assemblages E and A of G. duodenalis were detected in this study. Consistent with previous findings, assemblage E is the predominant genotype of G. duodenalis infections in cattle, a finding consistent with most domestic studies, including those from Heilongjiang [56], Henan [63], Jiangxi [81], and Ningxia [82]. Although assemblage E has traditionally been considered as infecting animals, recent studies suggest that domestic cattle may serve as a source of G. duodenalis transmission to humans. For instance, in a rural Egyptian community with intensive cattle farming, 62.5% (25/40) of children tested positive for assemblage E, likely due to direct contact with livestock or exposure to contaminated water [83]. Additionally, reports of assemblage E infections in humans have shown a rising trend globally [84,85]. The assemblage A identified in this study belonged to the A1 subtype, which has been primarily detected in animals [86,87]. At the gdh locus, subtypes A1 and A5 primarily infect animals, while subtypes A2, A3, and A4 are predominantly associated with human infections. Subtype A6 has been predominantly identified in wild ruminants (primarily deer) [88]. However, human infections with the A1 subtype have also been reported in China [89], Portugal [90], Mexico [91], and Brazil [92]. Although only assemblage E and a minor proportion of assemblage A were detected in this study, G. duodenalis still poses a zoonotic risk in Yunnan beef cattle farms.
From a One Health perspective, these findings have both public health and economic implications. To meet its increasing meat consumption needs, Yunnan has aggressively expanded its beef cattle industry. However, it is important for both farmers and consumers to prioritize the prevention of bovine microsporidiosis and giardiasis, as these pathogens can enter the environment through feces, contaminating water sources, food, and soil. Human exposure to infectious spores/cysts can lead to infection, with immunocompromised individuals facing higher risks and more severe symptoms. Currently, there are no effective treatments for these two parasitic diseases. Factors such as climate, sanitation conditions, stocking density, and animal immunity influence the transmission of E. bieneusi and G. duodenalis in cattle. To effectively control these infections, it is essential to adopt the One Health approach, which integrates human, animal, and environmental interactions, understanding how these interactions occur and the factors sustaining infections in animals [93,94,95]. In the age of misinformation, it is crucial to promote public understanding of zoonotic parasites through accessible platforms, such as Twitter, TikTok and ResearchGate.

5. Conclusions

In conclusion, this study expands the current understanding of E. bieneusi and G. duodenalis infection dynamics in beef cattle in Yunnan Province, identifying genotypes with zoonotic potential. While the infection rate was relatively low, the presence of genotypes shared with humans warrants closer monitoring. Four genotypes of E. bieneusi (I, J, BEB8, BEB4) were identified, of which I, J, and BEB4 have been reported in both human and animal infections, highlighting their potential zoonotic relevance. In particular, genotype I was the most frequently detected in this study. For G. duodenalis, the majority of detected assemblages belonged to assemblage E, and one assemblage A, which has potential zoonotic transmission risks, was also identified. Future research should adopt longitudinal and multisite approaches, integrate environmental and host-level risk factors, and explore the role of antimicrobial resistance. At the same time, researchers should engage broader audiences through digital platforms to strengthen awareness of zoonotic parasites, align with One Health objectives, and enhance the societal relevance of veterinary parasitology.

Author Contributions

F.Z. and F.S. conceived and designed the experiments; J.Y. collected fecal samples; F.Y. and W.C. performed the experiments; L.L. analyzed the data and drafted the manuscript; F.Z. and J.H. critically revised the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by The Yunnan Key Laboratory of Veterinary Etiological Biology (Grant No. 202449CE340019) and the International Science and Technology Commissioner Program (Grant No. 202403AK140046).

Institutional Review Board Statement

The animal study protocol was approved by the Yunnan Agricultural University Life Ethics Review Committee (protocol code: 202403094 and date of approval: 7 March 2024).

Informed Consent Statement

All Cattle’s owner gave their informed consent after receiving a thorough explanation of this study’s objectives and procedures.

Data Availability Statement

The datasets presented in this study can be found in online repositories. The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding authors.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Matos, O.; Lobo, M.L.; Xiao, L. Epidemiology of Enterocytozoon bieneusi infection in humans. J. Parasitol. Res. 2012, 1, 981424. [Google Scholar]
  2. Stentiford, G.D.; Becnel, J.; Weiss, L.M.; Keeling, P.J.; Didier, E.S.; Williams, B.P.; Bjornson, S.; Kent, M.L.; Freeman, M.A.; Brown, M.J.F.; et al. Microsporidia–Emergent pathogens in the global food chain. Trends Parasitol. 2016, 32, 336–348. [Google Scholar] [CrossRef] [Scilit]
  3. Li, W.; Feng, Y.; Santin, M. Host Specificity of Enterocytozoon bieneusi and Public Health Implications. Trends Parasitol. 2019, 35, 436–451. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Li, W.; Feng, Y.; Xiao, L. Diagnosis and molecular typing of Enterocytozoon bieneusi: The significant role of domestic animals in transmission of human microsporidiosis. Res. Vet Sci. 2020, 133, 251–261. [Google Scholar] [CrossRef] [Scilit]
  5. Didier, E.S.; Weiss, L.M. Microsporidiosis: Not just in AIDS patients. Curr. Opin. Infect. Dis. 2011, 24, 490–495. [Google Scholar] [CrossRef] [Scilit]
  6. Lobo, M.L.; Xiao, L.H.; Antunes, F.; Matos, O. Microsporidia as emerging pathogens and the implication for public health: A 10-year study on HIV positive and negative patients. Int. J. Parasitol. 2012, 42, 197–205. [Google Scholar] [CrossRef] [Scilit]
  7. Galvan, A.L.; Sanchez, A.M.; Valentin, M.A.P.; Henriques-Gil, N.; Izquierdo, F.; Fenoy, S.; Del Aguila, C. First cases of microsporidiosis in transplant recipients in Spain and review of the literature. J. Clin. Microbiol. 2011, 49, 1301–1306. [Google Scholar] [CrossRef] [Scilit]
  8. Sak, B.; Brady, D.; Pelikánová, M.; Květoňová, D.; Rost, M.; Kostka, M.; Tolarová, V.; Hůzová, Z.; Kváč, M. Unapparent microsporidial infection among immunocompetent humans in the Czech Republic. J. Clin. Microbiol. 2011, 49, 1064–1070. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  9. Nkinin, S.W.; Asonganyi, T.; Didier, E.S.; Kaneshiro, E.S. Microsporidian infection is prevalent in healthy people in Cameroon. J. Clin. Microbiol. 2007, 45, 2841–2846. [Google Scholar] [CrossRef] [Scilit]
  10. Cheng, C.; Cai, Y.; Xing, H.; Tao, J.; Cheng, D. Investigation of the Infection of Enterocytozoon bieneusi in Sheep and Goats in Jiangsu, China. Vet. Sci. 2024, 11, 327. [Google Scholar] [CrossRef] [Scilit]
  11. Meng, X.; Ou, Y.; Jiang, W.; Guo, Y.; Xiao, L.; Feng, Y.; Li, N. Identification of two new genetic loci for high-resolution genotyping of Enterocytozoon bieneusi. Parasite 2025, 32, 6. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Jiang, S.; Yu, S.; Feng, Y.; Zhang, L.; Santin, M.; Xiao, L.; Li, W. Widespread distribution of human-infective Enterocytozoon bieneusi genotypes in small rodents in northeast China and phylogeny and zoonotic implications revisited. Acta Trop. 2024, 253, 107160. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Santin, M.; Fayer, R. Enterocytozoon bieneusi genotype nomenclature based on the internal transcribed spacer sequence: A consensus. J. Eukaryot. Microbiol. 2009, 56, 34–38. [Google Scholar] [CrossRef] [Scilit]
  14. Zhang, Z.; Ma, J.; Huang, X.; Wen, X.; Jiang, W.; Chen, L.; Li, N.; Guo, Y.; Zhang, L.; Xiao, L.; et al. Population genetic analysis suggests genetic recombination is responsible for increased zoonotic potential of Enterocytozoon bieneusi from ruminants in China. One Health 2020, 11, 100184. [Google Scholar] [CrossRef] [Scilit]
  15. Jiang, Y.X.; Tao, W.; Wan, Q.; Li, Q.; Yang, Y.Q.; Lin, Y.; Zhang, S.; Li, W. Zoonotic and potentially host-adapted Enterocytozoon bieneusi genotypes in sheep and cattle in northeast China and an increasing concern about the zoonotic importance of previously considered ruminant-adapted genotypes. Appl. Environ. Microbiol. 2015, 81, 3326–3335. [Google Scholar] [CrossRef] [Scilit]
  16. Zhao, W.; Zhang, W.; Yang, F.; Zhang, L.; Wang, R.; Cao, J.; Shen, Y.; Liu, A. Enterocytozoon bieneusi in dairy cattle in the Northeast of China: Genetic diversity of ITS gene and evaluation of zoonotic transmission potential. J. Eukaryot. Microbiol. 2015, 62, 553–560. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  17. Del Coco, V.F.; Cordoba, M.A.; Bilbao, G.; Castro, P.D.; Basualdo, J.A.; Santín, M. First report of Enterocytozoon bieneusi from dairy cattle in Argentina. Vet. Parasitol. 2014, 199, 112–115. [Google Scholar] [CrossRef] [Scilit]
  18. Bulumulla, S.; Xiao, L.; Feng, Y.; Ash, A.; Ryan, U.; Barbosa, A.D. Update on transmission of zoonotic Giardia in cattle. Trends Parasitol. 2025, 41, 210–221. [Google Scholar] [CrossRef] [Scilit]
  19. Gao, Z.; Lu, Y.; Chong, Y.; Li, M.; Hong, J.; Wu, J.; Wu, D.; Xi, D.; Deng, W. Beef cattle genome project: Advances in genome sequencing, assembly, and functional genes discovery. Int. J. Mol. Sci. 2024, 25, 7147. [Google Scholar] [CrossRef] [Scilit]
  20. Song, H.Y.; Wang, K.S.; Yang, J.F.; Mao, H.M.; Pu, L.H.; Zou, Y.; Ma, J.; Zhu, X.Q.; Zou, F.C.; He, J.J. Prevalence and Novel Genotypes Identification of Enterocytozoon bieneusi in Dairy Cattle in Yunnan Province, China. Animals 2021, 11, 3014. [Google Scholar] [CrossRef] [Scilit]
  21. Heng, Z.J.; Yang, J.F.; Xie, X.Y.; Xu, C.R.; Chen, J.R.; Ma, J.; He, J.J.; Mao, H.M. Prevalence and multilocus genotyping of Giardia duodenalis in Holstein cattle in Yunnan, China. Front. Vet. Sci. 2022, 21, 949462. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  22. Liang, X.X.; Zou, Y.; Li, T.S.; Chen, H.; Wang, S.S.; Cao, F.Q.; Yang, J.F.; Sun, X.L.; Zhu, X.Q.; Zou, F.C. First report of the prevalence and genetic characterization of Giardia duodenalis and Cryptosporidium spp. in Yunling cattle in Yunnan Province, southwestern China. Microb. Pathog. 2021, 158, 105025. [Google Scholar] [CrossRef] [Scilit]
  23. Buckholt, M.A.; Lee, J.H.; Tzipori, S. Prevalence of Enterocytozoon bieneusi in swine: An 18-month survey at a slaughterhouse in Massachusetts. Appl. Environ. Microbiol. 2002, 68, 2595–2599. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Wegayehu, T.; Karim, M.R.; Ekro, B.; Zhang, L.; Tilahun, G. Multilocus genotyping of Giardia duodenalis isolates from calves in Oromia Special Zone, Central Ethiopia. Infect. Genet. Evol. 2016, 4, 281–288. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Lasek-Nesselquist, E.; Welch, D.M.; Sogin, M.L. The identification of a new Giardia duodenalis assemblage in marine vertebrates and a preliminary analysis of G. duodenalis population biology in marine systems. Int. J. Parasitol. 2010, 40, 1063–1074. [Google Scholar] [CrossRef] [Scilit]
  26. Taghipour, A.; Bahadory, S.; Abdoli, A. A systematic review and meta-analysis on the global prevalence of cattle microsporidiosis with focus on Enterocytozoon bieneusi: An emerging zoonotic pathogen. Prev. Vet. Med. 2022, 200, 105581. [Google Scholar] [CrossRef] [Scilit]
  27. Qin, Y.; Chen, C.; Qin, Y.F.; Yang, X.B.; Li, M.H.; Meng, X.Z.; Zhao, Z.Y.; Ma, N.; Cai, Y.; Zhang, Y.; et al. Prevalence and related factors of Enterocytozoon bieneusi in cattle: A global systematic review and meta-analysis. Prev. Vet. Med. 2022, 208, 105775. [Google Scholar] [CrossRef] [Scilit]
  28. Ruan, Y.; Xu, X.; He, Q.; Li, L.; Guo, J.; Bao, J.; Pan, G.; Li, T.; Zhou, Z. The largest meta-analysis on the global prevalence of microsporidia in mammals, avian and water provides insights into the epidemic features of these ubiquitous pathogens. Parasit. Vectors 2021, 14, 186. [Google Scholar] [CrossRef] [Scilit]
  29. Qiu, L.; Xia, W.; Li, W.; Ping, J.; Ding, S.; Liu, H. The prevalence of microsporidia in China: A systematic review and meta-analysis. Sci. Rep. 2019, 9, 3174. [Google Scholar] [CrossRef] [Scilit]
  30. Wang, S.S.; Wang, R.J.; Fan, X.C.; Liu, T.L.; Zhang, L.X.; Zhao, G.H. Prevalence and genotypes of Enterocytozoon bieneusi in China. Acta Trop. 2018, 183, 142–152. [Google Scholar] [CrossRef] [Scilit]
  31. Li, J.; Luo, N.; Wang, C.; Qi, M.; Cao, J.; Cui, Z.; Huang, J.; Wang, R.; Zhang, L. Occurrence, molecular characterization and predominant genotypes of Enterocytozoon bieneusi in dairy cattle in Henan and Ningxia, China. Parasit. Vectors 2016, 9, 142. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. Zhang, X.; Wang, Z.; Su, Y.; Liang, X.; Sun, X.; Peng, S.; Lu, H.; Jiang, N.; Yin, J.; Xiang, M.; et al. Identification and genotyping of Enterocytozoon bieneusi in China. J. Clin. Microbiol. 2011, 49, 2006–2008. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  33. Ma, J.; Li, P.; Zhao, X.; Xu, H.; Wu, W.; Wang, Y.; Guo, Y.; Wang, L.; Feng, Y.; Xiao, L. Occurrence and molecular characterization of Cryptosporidium spp. and Enterocytozoon bieneusi in dairy cattle, beef cattle and water buffaloes in China. Vet. Parasitol. 2015, 207, 220–227. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Tao, W.F.; Ni, H.B.; Du, H.F.; Jiang, J.; Li, J.; Qiu, H.Y.; Li, Y.; Zhang, X.X. Molecular detection of Cryptosporidium and Enterocytozoon bieneusi in dairy calves and Sika deer in four provinces in Northern China. Parasitol. Res. 2020, 119, 105–114. [Google Scholar] [CrossRef] [Scilit]
  35. Tang, C.; Cai, M.; Wang, L.; Guo, Y.; Li, N.; Feng, Y.; Xiao, L. Genetic diversity within dominant Enterocytozoon bieneusi genotypes in pre-weaned calves. Parasit. Vectors 2018, 11, 170. [Google Scholar] [CrossRef] [Scilit]
  36. Wang, H.Y.; Qi, M.; Sun, M.F.; Li, D.F.; Wang, R.J.; Zhang, S.M.; Zhao, J.F.; Li, J.Q.; Cui, Z.H.; Chen, Y.C.; et al. Prevalence and Population Genetics Analysis of Enterocytozoon bieneusi in Dairy Cattle in China. Front. Microbiol. 2019, 10, 1399. [Google Scholar] [CrossRef] [Scilit]
  37. Liu, Y.Y.; Qin, R.L.; Mei, J.J.; Zou, Y.; Zhang, Z.H.; Zheng, W.B.; Liu, Q.; Zhu, X.Q.; Gao, W.W.; Xie, S.C. Molecular Detection and Genotyping of Enterocytozoon bieneusi in Beef Cattle in Shanxi Province, North China. Animals 2022, 12, 2961. [Google Scholar] [CrossRef] [Scilit]
  38. Wang, X.T.; Wang, R.J.; Ren, G.J.; Yu, Z.Q.; Zhang, L.X.; Zhang, S.Y.; Lu, H.; Peng, X.Q.; Zhao, G.H. Multilocus genotyping of Giardia duodenalis and Enterocytozoon bieneusi in dairy and native beef (Qinchuan) calves in Shaanxi Province, Northwestern China. Parasitol. Res. 2016, 115, 1355–1361. [Google Scholar] [CrossRef] [Scilit]
  39. Hu, S.; Liu, Z.; Yan, F.; Zhang, Z.; Zhang, G.; Zhang, L.; Jian, F.; Zhang, S.; Ning, C.; Wang, R. Zoonotic and host-adapted genotypes of Cryptosporidium spp., Giardia duodenalis and Enterocytozoon bieneusi in dairy cattle in Hebei and Tianjin, China. Vet. Parasitol. 2017, 248, 68–73. [Google Scholar] [CrossRef] [Scilit]
  40. Qi, M.; Jing, B.; Jian, F.; Wang, R.; Zhang, S.; Wang, H.; Ning, C.; Zhang, L. Dominance of Enterocytozoon bieneusi genotype J in dairy calves in Xinjiang, Northwest China. Parasitol. Int. 2017, 66, 960–963. [Google Scholar] [CrossRef] [Scilit]
  41. Xin, X.; Sun, L.; Liu, W.; Zhang, J.; Ma, S.; Fu, X.; Zhao, W.; Yan, B. Molecular prevalence and genotype identification of Enterocytozoon bieneusi in cattle and goats from Zhejiang Province, China. Front. Vet. Sci. 2024, 11, 1415813. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  42. Wang, R.; Li, N.; Jiang, W.; Guo, Y.; Wang, X.; Jin, Y.; Feng, Y.; Xiao, L. Infection patterns, clinical significance, and genetic characteristics of Enterocytozoon bieneusi and Giardia duodenalis in dairy cattle in Jiangsu, China. Parasitol. Res. 2019, 118, 3053–3060. [Google Scholar] [CrossRef] [Scilit]
  43. Zheng, X.L.; Zhou, H.H.; Ren, G.; Ma, T.M.; Cao, Z.X.; Wei, L.M.; Liu, Q.W.; Wang, F.; Zhang, Y.; Liu, H.L.; et al. Genotyping and zoonotic potential of Enterocytozoon bieneusi in cattle farmed in Hainan Province, the southernmost region of China. Parasite 2020, 27, 65. [Google Scholar] [CrossRef] [Scilit]
  44. Zhang, Q.; Cai, J.; Li, P.; Wang, L.; Guo, Y.; Li, C.; Lei, M.; Feng, Y.; Xiao, L. Enterocytozoon bieneusi genotypes in Tibetan sheep and Yaks. Parasitol. Res. 2018, 117, 721–727. [Google Scholar] [CrossRef] [Scilit]
  45. Li, S.; Wang, P.; Zhu, X.Q.; Zou, Y.; Chen, X.Q. Prevalence and genotypes/subtypes of Enterocytozoon bieneusi and Blastocystis sp. in different breeds of cattle in Jiangxi Province, southeastern China. Infect. Genet. Evol. 2022, 98, 105216. [Google Scholar] [CrossRef] [Scilit]
  46. Liu, X.; Tang, L.; Li, W.; Li, C.; Gu, Y. Prevalence And molecular characterization of Cryptosporidium spp. And Enterocytozoon bieneusi from large-scale cattle farms in Anhui Province, China. J. Vet. Med. Sci. 2022, 84, 40–47. [Google Scholar] [CrossRef] [Scilit]
  47. Ma, J.G.; Zhang, N.Z.; Hou, J.L.; Zou, Y.; Hu, G.X.; Zhu, X.Q.; Zhou, D.H. Detection of Enterocytozoon bieneusi in white Yaks in Gansu Province, China. BioMed Res. Int. 2017, 2017, 5790181. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  48. Duan, J.; Qin, H.; Sun, M.; Fu, Y.; Lang, J.; Zhang, A.; Qin, Z.; Guo, Z.; Xu, H.; Li, X.; et al. Occurrence and genotypic identification of Blastocystis sp., Enterocytozoon bieneusi, and Giardia duodenalis in dairy cattle in Heilongjiang Province, China. Parasitol. Int. 2024, 100, 102871. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  49. Wu, Y.; Chen, Y.; Chang, Y.; Zhang, X.; Li, D.; Wang, L.; Zheng, S.; Wang, R.; Zhang, S.; Li, J.; et al. Genotyping and identification of Cryptosporidium spp., Giardia duodenalis and Enterocytozoon bieneusi from free-range Tibetan yellow cattle and cattle–yak in Tibet, China. Acta Trop. 2020, 212, 105671. [Google Scholar] [CrossRef] [Scilit]
  50. Trout, J.M.; Santin, M.; Greiner, E.; Fayer, R. Prevalence and genotypes of Giardia duodenalis in post-weaned dairy calves. Vet. Parasitol. 2005, 130, 177–183. [Google Scholar] [CrossRef] [Scilit]
  51. Bartley, P.M.; Roehe, B.K.; Thomson, S.; Shaw, H.J.; Peto, F.; Innes, E.A.; Katzer, F. Detection of potentially human infectious assemblages of Giardia duodenalis in fecal samples from beef and dairy cattle in Scotland. Parasitology 2019, 146, 1123–1130. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  52. Santin, M.; Trout, J.M.; Fayer, R. A longitudinal study of Giardia duodenalis genotypes in dairy cows from birth to 2 years of age. Vet. Parasitol. 2009, 162, 40–45. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  53. Khan, S.M.; Debnath, C.; Pramanik, A.K.; Xiao, L.; Nozaki, T.; Ganguly, S. Molecular evidence for zoonotic transmission of Giardia duodenalis among dairy farm workers in West Bengal, India. Vet. Parasitol. 2011, 178, 342–345. [Google Scholar] [CrossRef] [Scilit]
  54. Muhid, A.; Robertson, I.; Ng, J.; Yang, R.; Ryan, U. Prevalence of Giardia spp. infection in pre-weaned and weaned calves in relation to management factors. Vet. J. 2012, 191, 135–137. [Google Scholar] [CrossRef] [Scilit]
  55. Abeywardena, H.; Jex, A.R.; Nolan, M.J.; Haydon, S.R.; Stevens, M.A.; McAnulty, R.W.; Gasser, R.B. Genetic characterisation of Cryptosporidium and Giardia from dairy calves: Discovery of species/genotypes consistent with those found in humans. Infect. Genet. Evol. 2012, 12, 1984–1993. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  56. Gao, J.F.; Zhou, L.; Zhang, A.H.; Hou, M.R.; Liu, X.W.; Zhang, X.H.; Wang, J.W.; Wang, X.; Bai, X.; Jiao, C.L.; et al. Prevalence and Molecular Characterization of Cryptosporidium spp., Giardia duodenalis, and Enterocytozoon bieneusi in Cattle in Heilongjiang Province, Northeast China. Animals 2024, 14, 1635. [Google Scholar] [CrossRef] [Scilit]
  57. Zhao, L.; Chai, H.L.; Wang, M.Y.; Zhang, Z.S.; Han, W.X.; Yang, B.; Wang, Y.; Zhang, S.; Zhao, W.H.; Ma, Y.M.; et al. Prevalence and molecular characterization of Cryptosporidium spp. in dairy cattle in Central Inner Mongolia, Northern China. BMC Vet. Res. 2023, 19, 134. [Google Scholar] [CrossRef] [Scilit]
  58. Dan, J.; Zhang, X.; Ren, Z.; Wang, L.; Cao, S.; Shen, L.; Deng, J.; Zuo, Z.; Yu, S.; Wang, Y.; et al. Occurrence and multilocus genotyping of Giardia duodenalis from post-weaned dairy calves in Sichuan province, China. PLoS ONE 2019, 14, e0224627. [Google Scholar] [CrossRef] [Scilit]
  59. Fu, Y.; Dong, H.; Bian, X.; Qin, Z.; Han, H.; Lang, J.; Zhang, J.; Zhao, G.; Li, J.; Zhang, L. Molecular characterizations of Giardia duodenalis based on multilocus genotyping in sheep, goats, and beef cattle in Southwest Inner Mongolia, China. Parasite 2022, 29, 33. [Google Scholar] [CrossRef] [Scilit]
  60. Fan, Y.; Wang, T.; Koehler, A.V.; Hu, M.; Gasser, R.B. Molecular investigation of Cryptosporidium and Giardia in pre- and post-weaned calves in Hubei Province, China. Parasites Vectors 2017, 10, 519. [Google Scholar] [CrossRef] [Scilit]
  61. Qi, M.; Wang, H.; Jing, B.; Wang, R.; Jian, F.; Ning, C.; Zhang, L. Prevalence and multilocus genotyping of Giardia duodenalis in dairy calves in Xinjiang, Northwestern China. Parasites Vectors 2016, 9, 546. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  62. Jian, Y.; Zhang, X.; Li, X.; Karanis, G.; Ma, L.; Karanis, P. Prevalence and molecular characterization of Giardia duodenalis in cattle and sheep from the Qinghai-Tibetan Plateau Area (QTPA), northwestern China. Vet. Parasitol. 2018, 250, 40–44. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  63. Wang, H.; Zhao, G.; Chen, G.; Jian, F.; Zhang, S.; Feng, C.; Wang, R.; Zhu, J.; Dong, H.; Hua, J.; et al. Multilocus genotyping of Giardia duodenalis in dairy cattle in Henan, China. PLoS ONE 2014, 9, e100453. [Google Scholar] [CrossRef] [Scilit]
  64. Liu, G.; Su, Y.; Zhou, M.; Zhao, J.; Zhang, T.; Ahmad, W.; Lu, H.; Jiang, N.; Chen, Q.; Xiang, M.; et al. Prevalence and molecular characterization of Giardia duodenalis isolates from dairy cattle in northeast China. Exp. Parasitol. 2015, 154, 20–24. [Google Scholar] [CrossRef] [Scilit]
  65. Cui, Z.; Wang, L.; Cao, L.; Sun, M.; Liang, N.; Wang, H.; Chang, Y.; Lin, X.; Yu, L.; Wang, R.; et al. Genetic characteristics and geographic segregation of Giardia duodenalis in dairy cattle from Guangdong Province, southern China. Infect. Genet. Evol. 2018, 66, 95–100. [Google Scholar] [CrossRef] [Scilit]
  66. Huang, J.; Yue, D.; Qi, M.; Wang, R.; Zhao, J.; Li, J.; Shi, K.; Wang, M.; Zhang, L. Prevalence and molecular characterization of Cryptosporidium spp. and Giardia duodenalis in dairy cattle in Ningxia, northwestern China. BMC Vet. Res. 2014, 10, 292. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  67. Wang, Y.; Cao, J.; Chang, Y.; Yu, F.; Zhang, S.; Wang, R.; Zhang, L. Prevalence and molecular characterization of Cryptosporidium spp. and Giardia duodenalis in dairy cattle in Gansu, northwest China. Parasite 2020, 27, 62. [Google Scholar] [CrossRef] [Scilit]
  68. Thellier, M.; Breton, J. Enterocytozoon bieneusi in human and animals, focus on laboratory identification and molecular epidemiology, Paris. Parasite 2008, 15, 349–358. [Google Scholar] [CrossRef] [Scilit]
  69. Karim, M.R.; Wang, R.; Dong, H.; Zhang, L.; Li, J.; Zhang, S.; Rume, F.I.; Qi, M.; Jian, F.; Sun, M.; et al. Genetic polymorphism and zoonotic potential of Enterocytozoon bieneusi from nonhuman primates in China. Appl. Environ. Microbiol. 2014, 80, 1893–1898. [Google Scholar] [CrossRef] [Scilit]
  70. Karim, M.R.; Wang, R.; He, X.; Zhang, L.; Li, J.; Rume, F.I.; Dong, H.; Qi, M.; Jian, F.; Zhang, S.; et al. Multilocus sequence typing of Enterocytozoon bieneusi in nonhuman primates in China. Vet. Parasitol. 2014, 200, 13–23. [Google Scholar] [CrossRef] [Scilit]
  71. Yu, F.; Li, D.; Chang, Y.; Wu, Y.; Guo, Z.; Jia, L.; Xu, J.; Li, J.; Qi, M.; Wang, R.; et al. Molecular characterization of three intestinal protozoans in hospitalized children with different disease backgrounds in Zhengzhou, central China. Parasites Vectors 2019, 12, 543. [Google Scholar] [CrossRef] [Scilit]
  72. Yu, F.; Wu, Y.; Li, T.; Cao, J.; Wang, J.; Hu, S.; Zhu, H.; Zhang, S.; Wang, R.; Ning, C.; et al. High prevalence of Enterocytozoon bieneusi zoonotic genotype D in captive golden snub-nosed monkey (Rhinopithecus roxellanae) in zoos in China. BMC Vet. Res. 2017, 13, 158. [Google Scholar] [CrossRef] [Scilit]
  73. Zhang, X.X.; Cong, W.; Liu, G.H.; Ni, X.T.; Ma, J.G.; Zheng, W.B.; Zhao, Q.; Zhu, X.Q. Prevalence and genotypes of Enterocytozoon bieneusi in sika deer in Jilin Province, Northeastern China. Acta Parasitol. 2016, 61, 382–388. [Google Scholar] [CrossRef] [Scilit]
  74. Santín, M.; Fayer, R. Enterocytozoon bieneusi, Giardia, and Cryptosporidium Infecting White-tailed Deer. J. Eukaryot. Microbiol. 2015, 62, 34–43. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  75. Reete, J.; Rinder, H.; Thomschke, A.; Manke, H.; Schwebs, M.; Bruderek, A. First detection of the microsporidium Enterocytozoon bieneusi in non-mammalian hosts (chickens). Int. J. Parasitol. 2002, 32, 785–787. [Google Scholar]
  76. Pirestani, M.; Sadraei, J.; Forouzandeh, M. Molecular characterization and genotyping of human related microsporidia in free-ranging and captive pigeons of Tehran, Iran. Infect. Genet. Evol. 2013, 20, 495–499. [Google Scholar] [CrossRef] [Scilit]
  77. Santin, M.; Dargatz, D.; Fayer, R. Prevalence and genotypes of Enterocytozoon bieneusi in weaned beef calves on cow-calf operations in the USA. Parasitol. Res. 2012, 110, 2033–2041. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  78. Nourrisson, C.; Lavergne, R.A.; Moniot, M.; Morio, F.; Poirier, P. Enterocytozoon bieneusi, a human pathogen. Emerg. Microbes Infect. 2024, 13, 2406276. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  79. Fan, W.J.; Zhang, S.; Wang, L.F.; Ding, Y.L.; Liu, H.X.; Wang, M.Y.; Wang, Y.; Chai, H.L.; Zhang, Z.S.; Yi, C.; et al. Prevalence and genotyping of Enterocytozoon bieneusi in cattle from Shanxi and Inner Mongolia, China. Sci. Rep. 2025, 15, 6818. [Google Scholar] [CrossRef] [Scilit]
  80. Ma, J.; Cai, J.; Ma, J.; Feng, Y.; Xiao, L. Enterocytozoon bieneusi genotypes in Yaks (Bos grunniens) and their public health potential. J. Eukaryot. Microbiol. 2015, 62, 21–25. [Google Scholar] [CrossRef] [Scilit]
  81. Li, S.; Zou, Y.; Zhang, X.L.; Wang, P.; Chen, X.Q.; Zhu, X.Q. Prevalence and Multilocus Genotyping of Giardia lamblia in Cattle in Jiangxi Province, China: Novel Assemblage E Subtypes Identified. Korean J. Parasitol. 2020, 58, 681–687. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  82. Zhao, Q.; Ning, X.; Yue, Z.; Jian, F.; Li, D.; Lang, J.; Lu, S.; Ning, C. Unveiling the presence and genotypic diversity of Giardia duodenalis on large-scale sheep farms: Insights from the Henan and Ningxia Regions, China. Parasit. Vectors 2024, 17, 312. [Google Scholar] [CrossRef] [Scilit]
  83. Abdel-Moein, K.A.; Saeed, H. The zoonotic potential of Giardia intestinalis assemblage E in rural settings. Parasitol. Res. 2016, 115, 3197–3202. [Google Scholar] [CrossRef] [Scilit]
  84. Fantinatti, M.; Bello, A.R.; Fernandes, O.; Da-Cruz, A.M. Identification of Giardia lamblia assemblage E in humans points to a new anthropozoonotic cycle. J. Infect. Dis. 2016, 214, 1256–1259. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  85. Garcia, R.J.; Ogbuigwe, P.; Pita, A.B.; Velathanthiri, N.; Knox, M.A.; Biggs, P.J.; French, N.P.; Hayman, D.T.S. First report of novel assemblages and mixed infections of Giardia duodenalis in human isolates from New Zealand. Acta Trop. 2021, 220, 105969. [Google Scholar] [CrossRef] [Scilit]
  86. Li, J.; Wang, H.; Wang, R.; Zhang, L. Giardia duodenalis Infections in Humans and Other Animals in China. Front. Microbiol. 2017, 8, 2004. [Google Scholar] [CrossRef] [Scilit]
  87. Feng, Y.; Xiao, L. Zoonotic potential and molecular epidemiology of Giardia species and giardiasis. Clin. Microbiol. Rev. 2011, 24, 110–140. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  88. Cai, W.; Ryan, U.; Xiao, L.; Feng, Y. Zoonotic giardiasis: An update. Parasitol. Res. 2021, 120, 4199–4218. [Google Scholar] [CrossRef] [Scilit]
  89. Wang, R.; Zhang, X.; Zhu, H.; Zhang, L.; Feng, Y.; Jian, F.; Ning, C.; Qi, M.; Zhou, Y.; Fu, K.; et al. Genetic characterizations of Cryptosporidium spp. and Giardia duodenalis in humans in Henan, China. Exp. Parasitol. 2011, 127, 42–45. [Google Scholar] [CrossRef] [Scilit]
  90. Sousa, M.C.; Morais, J.B.; Machado, J.E.; Poiares-da-Silva, J. Genotyping of Giardia lamblia human isolates from Portugal by PCR-RFLP and sequencing. J. Eukaryot. Microbiol. 2006, 53, S174–S176. [Google Scholar] [CrossRef] [Scilit]
  91. Lalle, M.; Jimenez-Cardosa, E.; Caccio, S.M.; Pozio, E. Genotyping of Giardia duodenalis from humans and dogs from Mexico using a beta-giardin nested polymerase chain reaction assay. J. Parasitol. 2005, 91, 203–205. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  92. Volotao, A.C.; Costa-Macedo, L.M.; Haddad, F.S.; Brandao, A.; Peralta, J.M.; Fernandes, O. Genotyping of Giardia duodenalis from human and animal samples from Brazil using beta-giardin gene: A phylogenetic analysis. Acta Trop. 2007, 102, 10–19. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  93. Ryan, U.; Zahedi, A.; Paparini, A. Cryptosporidium in humans and animals-a one health approach to prophylaxis. Parasite Immunol. 2016, 38, 535–547. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  94. Meng, Y.W.; Shu, F.F.; Pu, L.H.; Zou, Y.; Yang, J.F.; Zou, F.C.; Zhu, X.Q.; Li, Z.; He, J.J. Occurrence and Molecular Characterization of Cryptosporidium spp. in Dairy Cattle and Dairy Buffalo in Yunnan Province, Southwest China. Animals 2022, 12, 1031. [Google Scholar] [CrossRef] [Scilit]
  95. Deng, M.L.; Heng, Z.J.; Li, L.J.; Yang, J.F.; He, J.J.; Zou, F.C.; Shu, F.F. Cryptosporidium spp. Infection and Genotype Identification in Pre-Weaned and Post-Weaned Calves in Yunnan Province, China. Animals 2024, 14, 1907. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Map of beef cattle sampling sites in Yunnan Province, China.
Figure 1. Map of beef cattle sampling sites in Yunnan Province, China.
Vetsci 12 00552 g001
Figure 2. Phylogenetic tree of the E. bieneusi based on the ITS gene sequence. The red symbols are the samples in this study.
Figure 2. Phylogenetic tree of the E. bieneusi based on the ITS gene sequence. The red symbols are the samples in this study.
Vetsci 12 00552 g002
Figure 3. Phylogenetic tree of the Giardia duodenalis based on the gdh gene sequence. The red symbols are the samples in this study. Note: The reference sequences GU176088 and GU176092 are cited from reference [25].
Figure 3. Phylogenetic tree of the Giardia duodenalis based on the gdh gene sequence. The red symbols are the samples in this study. Note: The reference sequences GU176088 and GU176092 are cited from reference [25].
Vetsci 12 00552 g003
Table 1. Geographical distribution and sample collection details of seven species of beef cattle (Total n = 529) at four locations in Yunnan Province, China, for Enterocytozoon bieneusi and Giardia duodenalis investigations.
Table 1. Geographical distribution and sample collection details of seven species of beef cattle (Total n = 529) at four locations in Yunnan Province, China, for Enterocytozoon bieneusi and Giardia duodenalis investigations.
LocationGeographical
Coordinates
Altitude (m)No. of SamplesTotal
Simmental Cattle Brahman Cattle Aberdeen Angus CattleYunnan Yellow Cattle Humped CattleDulong CattleHereford Cattle
Dehong98°48′ E, 24°33′ N835–280087--3936--162
Kunming102°91′ E, 25°63′ N2100–2900129----31-160
Xishuangbanna101°55′ E, 21°52′ N640–1200-106-----106
Lincang99°95′ E, 24°14′ N740–1400--80---21101
Total--2161068039363121529
Note: Dash (-) indicates no samples collected for that breed at the location. Altitude ranges show minimum–maximum elevations of sampling sites.
Table 2. Information on the primer used for the molecular identification and/or the characterization of Enterocytozoon bieneusi and Giardia duodenalis in the present study.
Table 2. Information on the primer used for the molecular identification and/or the characterization of Enterocytozoon bieneusi and Giardia duodenalis in the present study.
SpeciesLociPrimer IDPrimer Sequences (5′-3′)Fragment
Length
(bp)
Temperature
Annealing
(°C)
Reference
Enterocytozoon
bieneusi
ITS geneEB-F1GGTCATAGGGATGAAGAG39255 °C[23]
EB-R1TTCGAGTTCTTTCGCGCTC
EB-F2GCTCTGAATATCTATGGCT
EB-R2ATCGCCGACGGATCCAAGTG
Giardia
duodenalis
gdh genegdh-F1TTCCGTRTYCAGTACAACTC53059 °C[24]
gdh-R1ACCTCGTTCTGRGTGGCGCA
gdh-F2ATGACYGAGCTYCAGAGGCACGT
gdh-R2GTGGCGCARGGCATGATGCA
Table 3. Occurrence, factors and genotypes associated with Enterocytozoon bieneusi infection in beef cattle in Yunnan Province, China.
Table 3. Occurrence, factors and genotypes associated with Enterocytozoon bieneusi infection in beef cattle in Yunnan Province, China.
VariableCategoryNo.
Tested
No.
Positive
Prevalence (%)
(95% CI)
OR (95%, CI)p-ValueGenotype
RegionKunming16074.4 (1.17–7.58)1.49 (0.38–5.92)0.207I (4), BEB8 (3)
Dehong16263.7 (0.76–6.64)1.26 (0.31–5.14)J (3), I (2), BEB4 (1)
Xishuangbanna106----
Lincang10133.0 (−0.40–6.34)ReferenceI (2), J (1)
BreedSimmental cattle216125.6 (2.48–8.63)2.06 (0.26–16.34)0.088I (6), J (3), BEB8 (3)
Brahman cattle106----
Aberdeen Angus8033.8 (−0.50–8.00)1.36 (0.14–13.58)I (2), J (1)
Yunnan Yellow cattle39----
Humped cattle3612.8 (−2.86–8.42)ReferenceBEB4 (1)
Dulong cattle31----
Hereford cattle21----
GenderFemale248104.0 (1.57–6.50)1.93 (0.69–5.38)0.204I (5), J (2), BEB8 (3)
Male28162.1 (0.43–3.84)ReferenceI (3),J (2), BEB4 (1)
AgePre-weaned
(0–60 days)
29620.7 (5.01–36.37)31.39 (7.37–133.64)<0.001I (4), BEB8 (2)
Post-weaned
(61–180 days)
6223.2 (−1.30–7.75)4.01 (0.66–24.51)J (1), BEB8 (1)
Juvenile cattle
(7–18 months)
7456.8 (0.90–12.61)8.72 (2.04–37.34)J (3), I (2)
Adult cattle
(>18 months)
36430.8 (−0.11–1.76)ReferenceI (2), BEB4 (1)
Total529163.0 (1.56–4.49)--I (8), J (4), BEB8 (3), BEB4 (1)
No: number; CI: confidence interval; OR: odds ratio.
Table 4. Occurrence, factors and assemblages associated with Giardia duodenalis infection in beef cattle in Yunnan Province, China.
Table 4. Occurrence, factors and assemblages associated with Giardia duodenalis infection in beef cattle in Yunnan Province, China.
VariableCategoryNo.
Tested
No.
Positive
Prevalence (%)
(95% CI)
OR (95%, CI)p-ValueAssemblages
RegionKunming160127.5 (3.37–11.63)8.51 (1.09–66.48)<0.001E (12)
Dehong162----
Xishuangbanna10610.9 (−0.93–2.81)ReferenceE (1)
Lincang10165.9 (1.25–10.63)6.63 (0.78–56.09)E (5), A (1)
BreedSimmental cattle216125.6 (2.48–8.63)6.18 (0.79–48.15)0.116E (12)
Brahman cattle10610.9 (−0.93–2.81)ReferenceE (1)
Aberdeen Angus8056.3 (0.83–11.67)7.00 (0.80–61.15)E (4), A (1)
Yunnan Yellow cattle39----
humped cattle36----
Dulong cattle31----
Hereford cattle2114.8 (−5.17–14.70)5.25 (0.32–87.44)E (1)
GenderFemale248114.4 (1.86–7.02)1.58 (0.63–4.00)0.327E (11)
Male28182.8 (0.89–4.80)ReferenceE (7), A (1)
AgePre-weaned
(0–60 days)
29724.1 (7.57–40.70)28.64 (7.79–105.25)<0.001E (7)
Post-weaned
(61–180 days)
6246.5 (0.16–12.74)6.21 (1.51–25.51)E (3), A (1)
Juvenile cattle
(7–18 months)
7445.4 (0.13–10.68)5.14 (1.26–21.05)E (4)
Adult cattle
(>18 months)
36441.1 (0.02–2.17)ReferenceE (4)
Total529193.6 (2.00–5.18)--E (18), A (1)
No: number; CI: confidence interval; OR: odds ratio.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Yang, F.; Cheng, W.; Yang, J.; He, J.; Li, L.; Zou, F.; Shu, F. Investigation of Infection of Enterocytozoon bieneusi and Giardia duodenalis in Beef Cattle in Yunnan, China. Vet. Sci. 2025, 12, 552. https://doi.org/10.3390/vetsci12060552

AMA Style

Yang F, Cheng W, Yang J, He J, Li L, Zou F, Shu F. Investigation of Infection of Enterocytozoon bieneusi and Giardia duodenalis in Beef Cattle in Yunnan, China. Veterinary Sciences. 2025; 12(6):552. https://doi.org/10.3390/vetsci12060552

Chicago/Turabian Style

Yang, Fan, Wenjie Cheng, Jianfa Yang, Junjun He, Liujia Li, Fengcai Zou, and Fanfan Shu. 2025. "Investigation of Infection of Enterocytozoon bieneusi and Giardia duodenalis in Beef Cattle in Yunnan, China" Veterinary Sciences 12, no. 6: 552. https://doi.org/10.3390/vetsci12060552

APA Style

Yang, F., Cheng, W., Yang, J., He, J., Li, L., Zou, F., & Shu, F. (2025). Investigation of Infection of Enterocytozoon bieneusi and Giardia duodenalis in Beef Cattle in Yunnan, China. Veterinary Sciences, 12(6), 552. https://doi.org/10.3390/vetsci12060552

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop