Effects of 1,25-Dihydroxycholecalciferol Glycoside Supplementation on the Growth, Intestinal Health, and Immunity of Broilers from Breeders Supplemented or Not with the Same Additive
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animal Ethics Statement
2.2. Animals and Experimental Design
2.3. Diets and Feeding Management
2.4. Performance
2.5. Intestinal Histomorphometry
2.6. Biochemical Variables
2.7. Bone Quality and Tibia Proximal Composition
2.8. Gene Expression
2.9. Statistical Analyses
3. Results
3.1. Performance
3.2. Intestinal Histomorphometry
3.3. Biochemical Variables
3.4. Bone Quality and Tibia Proximal Composition
3.5. Gene Expression
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
| CALB-D28K: | Calbindin D28K |
| IL-1β | Interleukin-1 beta |
| IL-10 | Interleukin 10 |
| SEM | Standard error of the mean |
| FI | Feed intake |
| BW | Body weight |
| BWG | Body weight gain |
| FCR | Feed conversion ratio |
| VH | Villus height |
| CD | Crypt depth |
| AA | Absorption area |
| VH/CD | Villus-height-to-crypt-depth ratio |
| LDH | Lactate dehydrogenase |
| CPK | Creatine phosphokinase |
| ALP | Alkaline phosphatase |
References
- Vieites, F.M.; Drosghic, L.C.A.B.; Souza, C.S.; Júnior, J.G.V.; Nunes, R.V.; de Moraes, G.H.K.; Corrêa, G.S.S.; Júnior, J.G.C. Características Ósseas de Frangos de Corte Alimentados Com Rações Suplementadas Com Solanum Glaucophyllum. Semin. Agrar. 2016, 37, 381. [Google Scholar] [CrossRef]
- Świątkiewicz, S.; Arczewska-Włosek, A.; Bederska-Lojewska, D.; Józefiak, D. Efficacy of Dietary Vitamin D and Its Metabolites in Poultry—Review and Implications of the Recent Studies. World’s Poult. Sci. J. 2017, 73, 57–68. [Google Scholar] [CrossRef]
- de Souza Castro, F.L.; Baião, N.C.; Ecco, R.; Louzada, M.J.Q.; de Faria Melo, É.; Saldanha, M.M.; Triginelli, M.V.; Lara, L.J.C. Effects of 1,25-Dihydroxycholecalciferol and Reduced Vitamin D3 Level on Broiler Performance and Bone Quality. Rev. Bras. Zootec. 2018, 47, e20170186. [Google Scholar] [CrossRef]
- Souza, C.S.; Vieites, F.M. Vitamina D3 e Seus Metabólitos Para Frangos de Corte. Arch. Zootecnia 2014, 63, 11–24. [Google Scholar] [CrossRef]
- Hsiao, F.S.-H.; Cheng, Y.-H.; Han, J.-C.; Chang, M.-H.; Yu, Y.-H. Effect of Different Vitamin D3 Metabolites on Intestinal Calcium Homeostasis-Related Gene Expression in Broiler Chickens. Rev. Bras. Zootecnia 2018, 47, e20170015. [Google Scholar] [CrossRef]
- Aye Cho, T.-Z.; Sadiq, M.B.; Srichana, P.; Anal, A.K. Vitamin D3 Enhanced Intestinal Phosphate Cotransporter Genes in Young and Growing Broilers. Poult. Sci. 2020, 99, 2041–2047. [Google Scholar] [CrossRef]
- Trautenmüller, H.; Genova, J.L.; de Azevedo dos Santos, L.B.; Leal, I.F.; de Brito Santos, G.; Rupolo, P.E.; Nunes, R.V.; de Oliveira, E.R.; de Oliveira Carvalho, P.L. Partial Cholecalciferol Replacement with 1,25-Dihydroxycholecalciferol Glycoside in Diets for Piglets. Anim. Prod. Sci. 2022, 62, 1590–1599. [Google Scholar] [CrossRef]
- Khan, R.U.; Naz, S.; Ullah, H.; Khan, N.A.; Laudadio, V.; Ragni, M.; Piemontese, L.; Tufarelli, V. Dietary Vitamin D: Growth, Physiological and Health Consequences in Broiler Production. Anim. Biotechnol. 2023, 34, 1635–1641. [Google Scholar] [CrossRef]
- Vieites, F.M.; Drosghic, L.C.A.B.; Souza, C.S.; Lima, C.A.R.; Moraes, G.H.K.; Nunes, R.V.; Vasconcellos, C.H.F.; Vargas Júnior, J.G. 1,25-Dihidroxivitamina-D 3 Sobre as Características Ósseas de Frangos de Corte Fêmeas. Arq. Bras. Med. Vet. Zootec. 2017, 69, 1285–1293. [Google Scholar] [CrossRef]
- Nunes, R.A.; de Souza Duarte, M.; Campos, P.H.R.F.; de Oliveira, L.L.; e Silva, F.F.; Kreuz, B.S.; Mirabile, C.G.; Borges, S.O.; Calderano, A.A. Active Vitamin D3-Glycoside Preserves Weight Gain and Modulates the Inflammatory Response in Broiler Chickens Challenged with Lipopolysaccharide. Anim. Feed. Sci. Technol. 2020, 270, 114704. [Google Scholar] [CrossRef]
- Bassi, L.S.; Moreno, F.A.; Martins, C.C.S.; Sens, R.F.; Lozano-Poveda, C.A.; Maiorka, A. Effect of 25-Hydroxycholecalciferol Supplementation with Different Dietary Available Phosphorus Levels for Broilers. Br. Poult. Sci. 2023, 65, 71–78. [Google Scholar] [CrossRef]
- Poorhemati, H.; Ghaly, M.; Sadvakassova, G.; Komarova, S.V. FGF23 Level in Poultry Chicken, a Systematic Review and Meta-Analysis. Front. Physiol. 2023, 14, 1279204. [Google Scholar] [CrossRef] [PubMed]
- Souza, C.S.; Vieites, F.M.; Nunes, R.V.; Brusamarelo, E.; Reis, T.L.; de Lima, C.A.R.; de Vargas Junior, J.G. Suplemento de 1,25-Dihidroxicolecalciferol e Redução de Cálcio e Fósforo Disponível Para Frangos de Corte Fêmeas. Res. Soc. Dev. 2020, 9, e119973975. [Google Scholar] [CrossRef]
- Hu, Y.; van Baal, J.; Hendriks, W.H.; Resink, J.-W.; Liesegang, A.; van Krimpen, M.M.; Bikker, P. High Dietary Ca and Microbial Phytase Reduce the Expression of Ca Transporters While Enhancing Claudins Involved in Paracellular Ca Absorption in the Porcine Jejunum and Colon. Br. J. Nutr. 2023, 129, 1127–1135. [Google Scholar] [CrossRef]
- Vieites, F.; Brusamarelo, E.; Corrêa, G.d.S.; Souza, C.; De Oliveira, C.; De Moraes, G.; Júnior, J.C. 1,25-Dihidroxicolecalciferol de Origem Herbal (Solanum glaucophyllum) Mantém o Desempenho e a Qualidade Óssea de Frangos de Corte Fêmeas Durante Restrição de Cálcio e Fósforo. Arch. Zootecnia 2018, 67, 414–419. [Google Scholar] [CrossRef]
- Warren, M.F.; Vu, T.C.; Toomer, O.T.; Fernandez, J.D.; Livingston, K.A. Efficacy of 1-α-Hydroxycholecalciferol Supplementation in Young Broiler Feed Suggests Reducing Calcium Levels at Grower Phase. Front. Vet. Sci. 2020, 7, 245. [Google Scholar] [CrossRef]
- Han, J.; Wu, L.; Lv, X.; Liu, M.; Zhang, Y.; He, L.; Hao, J.; Xi, L.; Qu, H.; Shi, C.; et al. Intestinal Segment and Vitamin D3 Concentration Affect Gene Expression Levels of Calcium and Phosphorus Transporters in Broiler Chickens. J. Anim. Sci. Technol. 2022, 65, 336–350. [Google Scholar] [CrossRef] [PubMed]
- Ismailova, A.; White, J.H. Vitamin D, Infections and Immunity. Rev. Endocr. Metab. Disord. 2022, 23, 265–277. [Google Scholar] [CrossRef]
- Shojadoost, B.; Behboudi, S.; Villanueva, A.I.; Brisbin, J.T.; Ashkar, A.A.; Sharif, S. Vitamin D3 Modulates the Function of Chicken Macrophages. Res. Vet. Sci. 2015, 100, 45–51. [Google Scholar] [CrossRef]
- Shojadoost, B.; Yitbarek, A.; Alizadeh, M.; Kulkarni, R.R.; Astill, J.; Boodhoo, N.; Sharif, S. Centennial Review: Effects of Vitamins A, D, E, and C on the Chicken Immune System. Poult. Sci. 2021, 100, 100930. [Google Scholar] [CrossRef]
- Cao, S.; Li, T.; Shao, Y.; Zhang, L.; Lu, L.; Zhang, R.; Hou, S.; Luo, X.; Liao, X. Regulation of Bone Phosphorus Retention and Bone Development Possibly by Related Hormones and Local Bone-Derived Regulators in Broiler Chicks. J. Anim. Sci. Biotechnol. 2021, 12, 88. [Google Scholar] [CrossRef] [PubMed]
- Saddoris, K.L.; Fleet, J.C.; Radcliffe, J.S. The Effect of Dietary Vitamin D Supplementation on Sodium-Dependent Phosphate Uptake and Expression of NaPi-IIb in the Small Intestine of Weanling Pigs. J. Anim. Sci. 2021, 99, skz106. [Google Scholar] [CrossRef] [PubMed]
- Gloux, A.; Le Roy, N.; Ezagal, J.; Même, N.; Hennequet-Antier, C.; Piketty, M.L.; Prié, D.; Benzoni, G.; Gautron, J.; Nys, Y.; et al. Possible Roles of Parathyroid Hormone, 1.25(OH)2D3, and Fibroblast Growth Factor 23 on Genes Controlling Calcium Metabolism across Different Tissues of the Laying Hen. Domest. Anim. Endocrinol. 2020, 72, 106407. [Google Scholar] [CrossRef]
- Dimitrov, V.; Barbier, C.; Ismailova, A.; Wang, Y.; Dmowski, K.; Salehi-Tabar, R.; Memari, B.; Groulx-Boivin, E.; White, J.H. Vitamin D-Regulated Gene Expression Profiles: Species-Specificity and Cell-Specific Effects on Metabolism and Immunity. Endocrinology 2021, 162, bqaa218. [Google Scholar] [CrossRef] [PubMed]
- Haussler, M.R.; Livingston, S.; Sabir, Z.L.; Haussler, C.A.; Jurutka, P.W. Vitamin D Receptor Mediates a Myriad of Biological Actions Dependent on Its 1,25-Dihydroxyvitamin D Ligand: Distinct Regulatory Themes Revealed by Induction of Klotho and Fibroblast Growth Factor-23. JBMR Plus 2021, 5, e10432. [Google Scholar] [CrossRef]
- Souza, C.S.; Vieites, F.M.; Vasconcellos, C.H.F.; Calderano, A.A.; Nunes, R.V.; Ferreira, C.M.; Pereira, T.V.S.; Moraes, G.H.K. Suplemento de 1,25 Dihidroxicolecalciferol e Redução de Cálcio e Fósforo Disponível Para Frangos de Corte. Arq. Bras. Med. Vet. E Zootec. 2013, 65, 519–525. [Google Scholar] [CrossRef]
- Alves, O.D.S.; Calixto, L.F.L.; Araujo, A.H.B.; Torres-Cordido, K.A.A.; Reis, T.L.; Calderano, A.A. Decreased Levels of Vitamin D3 and Supplementation with 1,25-Dihydroxyvitamin D3-Glycoside on Performance, Carcass Yield and Bone Quality in Broilers. Cienc. Rural. 2018, 48, e20170705. [Google Scholar] [CrossRef]
- Gili, V.; Pardo, V.G.; Ronda, A.C.; De Genaro, P.; Bachmann, H.; Boland, R.; de Boland, A.R. In Vitro Effects of 1α,25(OH)2D3-Glycosides from Solbone A (Solanum Glaucophyllum Leaves Extract; Herbonis AG) Compared to Synthetic 1α,25(OH)2D3 on Myogenesis. Steroids 2016, 109, 7–15. [Google Scholar] [CrossRef]
- Trautenmüller, H.; Genova, J.L.; de Faria, A.B.B.; Martins, J.S.; Viana, S.C.M.; Castilha, L.D.; Gonçalves, A.C.; Baraldi-Artoni, S.M.; de Oliveira Carvalho, P.L. Bone Traits and Gastrointestinal Tract Parameters of Piglets Fed Cholecalciferol and 1,25-Dihydroxycholecalciferol Glycoside. Rev. Bras. Zootecnia 2021, 50, e20210098. [Google Scholar] [CrossRef]
- Yavaş, İ.; Çenesiz, A.A.; Ceylan, N. Effects of Herbal Vitamin D3 and Phytase Supplementation to Broiler Feed on Performance, Bone Development and Serum Parameters of Broilers. J. Agric. Sci. Bilim. Derg. 2020, 26, 212–219. [Google Scholar] [CrossRef]
- Jacquillet, G.; Unwin, R.J. Physiological Regulation of Phosphate by Vitamin D, Parathyroid Hormone (PTH) and Phosphate (Pi). Pflügers Archiv 2019, 471, 83–98. [Google Scholar] [CrossRef] [PubMed]
- Wu, L.; Wang, X.; Lv, X.; He, L.; Qu, H.; Shi, C.; Zhang, L.; Zhang, J.; Wang, Z.; Han, J. 1,25-Dihydroxycholecalciferol Improved the Growth Performance and Upregulated the Calcium Transporter Gene Expression Levels in the Small Intestine of Broiler Chickens. J. Poult. Sci. 2022, 59, 0210019. [Google Scholar] [CrossRef] [PubMed]
- Khan, S.H.; Shahid, R.; Mian, A.A.; Sardar, R.; Anjum, M.A. ORIGINAL ARTICLE: Effect of the Level of Cholecalciferol Supplementation of Broiler Diets on the Performance and Tibial Dyschondroplasia. J. Anim. Physiol. Anim. Nutr. 2010, 94, 584–593. [Google Scholar] [CrossRef] [PubMed]
- Colet, S.; Garcia, R.; Almeida Paz, I.; Caldara, F.; Borille, R.; Royer, A.; Nääs, I.; Sgavioli, S. Bone Characteristics of Broilers Supplemented with Vitamin D. Rev. Bras. Cienc. Avicola 2015, 17, 325–332. [Google Scholar] [CrossRef]
- Nääs, I.D.A.; Baracho, M.D.S.; Bueno, L.G.F.; de Moura, D.J.; Vercelino, R.D.A.; Salgado, D.D. Use of Vitamin D to Reduce Lameness in Broilers Reared in Harsh Environments. Rev. Bras. Cienc. Avicola 2012, 14, 165–172. [Google Scholar] [CrossRef]
- Gil, Á.; Plaza-Diaz, J.; Mesa, M.D. Vitamin D: Classic and Novel Actions. Ann. Nutr. Metab. 2018, 72, 87–95. [Google Scholar] [CrossRef]
- Hodnik, J.J.; Ježek, J.; Starič, J. A Review of Vitamin D and Its Importance to the Health of Dairy Cattle. J. Dairy Res. 2020, 87, 84–87. [Google Scholar] [CrossRef]
- Marques, M.; Oliveira, R.; Donzele, J.; Albino, L.; Tizziani, T.; Faria, L.; Muniz, J.; Dalólio, F.; Lozano, C.; Silva, C. 25-Hydroxycholecalciferol As an Alternative to Vitamin D3 in Diets with Different Levels of Calcium for Broilers Reared Under Heat Stress. Braz. J. Poult. Sci. 2022, 24, eRBCA-2021. [Google Scholar] [CrossRef]
- Kumar, R.; Brar, R.S.; Banga, H.S. Hypervitaminosis D3 in Broiler Chicks: Histopathological, Immunomodulatory and Immunohistochemical Approach. Iran. J. Vet. Res. 2017, 18, 170–176. [Google Scholar]
- Koivisto, O.; Hanel, A.; Carlberg, C. Key Vitamin D Target Genes with Functions in the Immune System. Nutrients 2020, 12, 1140. [Google Scholar] [CrossRef]
- Jaime, J.; Vargas-Bermúdez, D.S.; Yitbarek, A.; Reyes, J.; Rodríguez-Lecompte, J.C. Differential Immunomodulatory Effect of Vitamin D (1,25(OH)2D3) on the Innate Immune Response in Different Types of Cells Infected in Vitro with Infectious Bursal Disease Virus. Poult. Sci. 2020, 99, 4265–4277. [Google Scholar] [CrossRef] [PubMed]
- Rodriguez-Lecompte, J.C.; Yitbarek, A.; Cuperus, T.; Echeverry, H.; van Dijk, A. The Immunomodulatory Effect of Vitamin D in Chickens Is Dose-Dependent and Influenced by Calcium and Phosphorus Levels. Poult. Sci. 2016, 95, 2547–2556. [Google Scholar] [CrossRef] [PubMed]
- Prietl, B.; Treiber, G.; Pieber, T.; Amrein, K. Vitamin D and Immune Function. Nutrients 2013, 5, 2502–2521. [Google Scholar] [CrossRef] [PubMed]
- Bachmann, H.; Autzen, S.; Frey, U.; Wehr, U.; Rambeck, W.; McCormack, H.; Whitehead, C.C. The Efficacy of a Standardised Product from Dried Leaves of Solanum glaucophyllum as Source of 1,25-Dihydroxycholecalciferol for Poultry. Br. Poult. Sci. 2013, 54, 642–652. [Google Scholar] [CrossRef]
- Vieites, F.M.; Nalon, R.P.; Santos, A.L.; Castelo Branco, P.A.; Souza, C.S.; Nunes, R.V.; Calderano, A.A.; de Arruda, N.V.M. Desempenho, Rendimento de Carcaça e Cortes Nobres de Frangos de Corte Alimentados Com Rações Suplementadas Com Solanum Glaucophyllum. Semin. Cienc. Agrar. 2014, 35, 1617. [Google Scholar] [CrossRef]
- Kumar, R.; Singh Banga, H.; Singh Brar, R. Effects of Dietary Vitamin D3 Over-Supplementation on Broiler Chickens’ Health; Clinicopathological and Immunohistochemical Characteristics. J. Vet. Physiol. Pathol. 2023, 2, 20–31. [Google Scholar] [CrossRef]
- Pande, V.V.; Chousalkar, K.C.; Bhanugopan, M.S.; Quinn, J.C. Super Pharmacological Levels of Calcitriol (1,25-(OH)2 D3) Inhibits Mineral Deposition and Decreases Cell Proliferation in a Strain Dependent Manner in Chicken Mesenchymal Stem Cells Undergoing Osteogenic Differentiation in Vitro. Poult. Sci. 2015, 94, 2784–2796. [Google Scholar] [CrossRef] [PubMed]
- Nong, K.; Liu, Y.; Fang, X.; Qin, X.; Liu, Z.; Zhang, H. Effects of the Vitamin D3 on Alleviating the Oxidative Stress Induced by Diquat in Wenchang Chickens. Animals 2023, 13, 711. [Google Scholar] [CrossRef]
- Liao, X.D.; Suo, H.Q.; Lu, L.; Hu, Y.X.; Zhang, L.Y.; Luo, X.G. Effects of Sodium, 1,25-Dihydroxyvitamin D3 and Parathyroid Hormone Fragment on Inorganic P Absorption and Type IIb Sodium-Phosphate Cotransporter Expression in Ligated Duodenal Loops of Broilers. Poult. Sci. 2017, 96, 2344–2350. [Google Scholar] [CrossRef]
- Lu, L.; Li, S.M.; Zhang, L.; Liu, X.Q.; Li, D.Y.; Zhao, X.L.; Liu, Y.P. Expression of β-Defensins in Intestines of Chickens Injected with Vitamin D3 and Lipopolysaccharide. Genet. Mol. Res. 2015, 14, 3330–3337. [Google Scholar] [CrossRef]
- Zhang, Y.; Leung, D.Y.M.; Richers, B.N.; Liu, Y.; Remigio, L.K.; Riches, D.W.; Goleva, E. Vitamin D Inhibits Monocyte/Macrophage Proinflammatory Cytokine Production by Targeting MAPK Phosphatase-1. J. Immunol. 2012, 188, 2127–2135. [Google Scholar] [CrossRef] [PubMed]
- Rostagno, H.S.; Albino, L.F.T.; Calderano, A.A.; Hanas, M.I.; Sakomura, N.K.; Perazzo, F.; Rocha, G.C.; Saraiva, A.; Abreu, M.L.T.; Genova, J.L.; et al. Tabelas Brasileiras Para Aves e Suínos: Composição de Alimentos e Exigências Nutricionais; Suprema: Visconde do Rio Branco, Brazil, 2024; Volume 5. [Google Scholar]
- Sakomura, N.K.; Rostagno, S.H. Métodos de Pesquisa Em Nutrição de Monogástricos; FUNEP, Ed.; Funep: Jaboticabal, Brazil, 2016; Volume 2. [Google Scholar]
- Luna, L.G. Manual of Histologic Staining Methods of the Armed Forces Institute of Pathology. In Pathology; McGraw-Hill: New York, NY, USA, 1968; Volume 3. [Google Scholar]
- Kisielinski, K.; Willis, S.; Prescher, A.; Klosterhalfen, B.; Schumpelick, V. A Simple New Method to Calculate Small Intestine Absorptive Surface in the Rat. Clin. Exp. Med. 2002, 2, 131–135. [Google Scholar] [CrossRef]
- Nunes, R.V.; Broch, J.; Wachholz, L.; de Souza, C.; Damasceno, J.L.; Oxford, J.H.; Bloxham, D.J.; Billard, L.; Pesti, G.M. Choosing Sample Sizes for Various Blood Parameters of Broiler Chickens with Normal and Non-Normal Observations. Poult. Sci. 2018, 97, 3746–3754. [Google Scholar] [CrossRef] [PubMed]
- Seedor, J.G. The Biophosphanate Alendronate (MK-217) Inhibit Bone Loss Due to Ovariectomy in Rats. J. Bone Miner. Res. 1993, 6, 265–275. [Google Scholar]
- Silva, D.J.; Queiroz, A.C. Análise de Alimentos: Métodos Químicos e Biológicos; UFV: Viçosa, Brazil, 2006; Volume 3. [Google Scholar]
- Crenshaw, T.D.; Peo, E.R.; Lewis, A.J.; Moser, B.D. Bone Strength as a Trait for Assessing Mineralization in Swine: A Critical Review of Techniques Involved. J. Anim. Sci. 1981, 53, 827–835. [Google Scholar] [CrossRef]
- Proszkowiec-Weglarz, M.; Angel, R. Calcium and Phosphorus Metabolism in Broilers: Effect of Homeostatic Mechanism on Calcium and Phosphorus Digestibility. J. Appl. Poult. Res. 2013, 22, 609–627. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- SAS Institute. SAS University Edition: Installation Guide for Windows; SAS Institute Inc.: Cary, NC, USA, 2020; Available online: https://www.sas.com/pt_br/software/on-demand-for-academics.html (accessed on 12 March 2023).
- Fatemi, S.A.; Elliott, K.E.C.; Bello, A.; Peebles, E.D. Effects of the in Ovo Injection of Vitamin D3 and 25-Hydroxyvitamin D3 in Ross 708 Broilers Subsequently Challenged with Coccidiosis. I. Performance, Meat Yield and Intestinal Lesion Incidence1,2,3. Poult. Sci. 2021, 100, 101382. [Google Scholar] [CrossRef]
- Fatemi, S.A.; Elliott, K.E.C.; Macklin, K.S.; Bello, A.; Peebles, E.D. Effects of the In Ovo Injection of Vitamin D3 and 25-Hydroxyvitamin D3 in Ross 708 Broilers Subsequently Challenged with Coccidiosis: II Immunological and Inflammatory Responses and Small Intestine Histomorphology. Animals 2022, 12, 1027. [Google Scholar] [CrossRef]
- Fatemi, S.A.; Elliott, K.E.C.; Bello, A.; Durojaye, O.A.; Zhang, H.-J.; Peebles, E.D. The Effects of in Ovo Injected Vitamin D3 Sources on the Eggshell Temperature and Early Posthatch Performance of Ross 708 Broilers. Poult. Sci. 2020, 99, 1357–1362. [Google Scholar] [CrossRef]
- Kanani, R.; Kianfar, R.; Janmohammadi, H.; Kyun Kim, W.; Olyaee, M. Influence of Vitamin D3 and Lactic Acid on Performance, Egg Quality, and Hatchability in Broiler Breeder Hens. Anim. Prod. Res. 2022, 11, 67–81. [Google Scholar] [CrossRef]
- Setiyaningsih, N.; Jayanegara, A.; Wardani, W.W. Effects of a Vitamins D and C Supplement on Performance, Hatchability and Blood Profiles of Broiler Breeders. J. World’s Poult. Res. 2023, 13, 71–80. [Google Scholar] [CrossRef]
- Li, H.-M.; Liu, Y.; Zhang, R.-J.; Ding, J.-Y.; Shen, C.-L. Vitamin D Receptor Gene Polymorphisms and Osteoarthritis: A Meta-Analysis. Rheumatology 2021, 60, 538–548. [Google Scholar] [CrossRef]
- San, J.; Zhang, Z.; Bu, S.; Zhang, M.; Hu, J.; Yang, J.; Wu, G. Changes in Duodenal and Nephritic Ca and P Absorption in Hens during Different Egg-Laying Periods. Heliyon 2021, 7, e06081. [Google Scholar] [CrossRef]
- Barnkob, L.L.; Argyraki, A.; Jakobsen, J. Naturally Enhanced Eggs as a Source of Vitamin D: A Review. Trends Food Sci. Technol. 2020, 102, 62–70. [Google Scholar] [CrossRef]
- Yusuf, G.M.; Sumiati, S.; Mutia, R.; Wardani, W.W.; Akbar, I.; Putri, N.D.S. Performance, Egg Quality, Bone Health, and Immunity Assessments of Lohmann Laying Hens Supplemented with Vitamin D3 in the Diet. J. Trop Anim. Sci. 2023, 46, 461–470. [Google Scholar] [CrossRef]
- Li, J.; Yuan, J.; Miao, Z.; Guo, Y. Effects of Age on Intestinal Phosphate Transport and Biochemical Values of Broiler Chickens. Asian-Australas. J. Anim. Sci. 2016, 30, 221–228. [Google Scholar] [CrossRef]
- Kermani, Z.A.; Taheri, H.R.; Faridi, A.; Shahir, M.H.; Baradaran, N. Interactive Effects of Calcium, Vitamin D3, and Exogenous Phytase on Phosphorus Utilization in Male Broiler Chickens from 1 to 21 Days Post-Hatch: A Meta-Analysis Approach. Anim. Feed. Sci. Technol. 2023, 295, 115525. [Google Scholar] [CrossRef]
- Costa, C.H.R.; de Toledo Barreto, S.L.; Umigi, R.T.; Lima, H.J.D.; de Araujo, M.S.; Medina, P. Balanço de Cálcio e Fósforo e Estudo Dos Níveis Desses Minerais Em Dietas Para Codornas Japonesas (45 a 57 Semanas de Idade). Rev. Bras. Zootecnia 2010, 39, 1748–1755. [Google Scholar] [CrossRef]
- Sakkas, P.; Smith, S.; Hill, T.R.; Kyriazakis, I. A Reassessment of the Vitamin D Requirements of Modern Broiler Genotypes. Poult. Sci. 2019, 98, 330–340. [Google Scholar] [CrossRef]
- Lopes, T.S.B.; Shi, H.; White, D.; Araújo, I.C.S.; Kim, W.K. Effects of 25-Hydroxycholecalciferol on Performance, Gut Health, and Bone Quality of Broilers Fed with Reduced Calcium and Phosphorus Diet during Eimeria Challenge. Poult Sci. 2024, 103, 103267. [Google Scholar] [CrossRef] [PubMed]
- Düngelhoef, K.; Wilkens, M.R.; Mrochen, N.; Schröder, B.; Sander, S.; Kamphues, J. Effects of an Extra Supply of Vitamin D, Calcium and Phosphorus via Drinking Water on the Calcium and Phosphorus Metabolism in Growing Chickens Fed a Conventional Complete Diet. Eur. Poult. Sci. (EPS) 2014, 78, 1–15. [Google Scholar] [CrossRef]
- Lv, X.; Hao, J.; Wu, L.; Liu, M.; He, L.; Qiao, Y.; Cui, Y.; Wang, G.; Zhang, C.; Qu, H.; et al. Age Quadratically Affects Intestinal Calcium and Phosphorus Transporter Gene Expression in Broiler Chickens. Anim. Biosci. 2022, 35, 1921–1928. [Google Scholar] [CrossRef]
- Yang, L.-P.; Dong, Y.-P.; Luo, W.-T.; Zhu, T.; Li, Q.-W.; Zhang, L.-J.; Kong, J.; Yuan, Z.-W.; Zhao, Q. Tissue-Specific Regulatory Effects of Vitamin D and Its Receptor on Calbindin- D28K and Calbindin-D9K. Biochem. Mol. Biol. J. 2018, 4, 23. [Google Scholar] [CrossRef]
- Christakos, S.; Liu, Y.; Dhawan, P.; Peng, X. The Calbindins: Calbindin-D9K and Calbindin-D28K. In Vitamin D; Elsevier: Amsterdam, The Netherlands, 2005; pp. 721–735. [Google Scholar]
- David, L.S.; Anwar, M.N.; Abdollahi, M.R.; Bedford, M.R.; Ravindran, V. Calcium Nutrition of Broilers: Current Perspectives and Challenges. Animals 2023, 13, 1590. [Google Scholar] [CrossRef] [PubMed]
- Silva, J.C.S.; Fernandes, A.W.D.N.; Nunes, M.J.M.; Morais, P.L.A.d.G.; Fonseca, I.A.T.; Engelberth, R.C.G.J.; Cavalcanti, J.R.L.d.P.; de Araújo, D.P. Regulação Negativa de Calbindina-D28k Durante o Envelhecimento Neural Animal. Revista Neurociências 2022, 30, 1–36. [Google Scholar] [CrossRef]
- Bolt, M.J.; Cao, L.-P.; Kong, J.; Sitrin, M.D.; Li, Y.C. Vitamin D Receptor Is Required for Dietary Calcium-Induced Repression of Calbindin-D9k Expression in Mice. J. Nutr. Biochem. 2005, 16, 286–290. [Google Scholar] [CrossRef]
| Ingredients, g/kg | 1 to 7 Day | 8 to 21 Day |
|---|---|---|
| Corn (7.88%) | 504.76 | 525.03 |
| Soybean Meal (46%) | 423.88 | 402.13 |
| Degummed Soybean oil | 29.70 | 33.66 |
| Dicalcium Phosphate | 17.86 | 16.37 |
| Limestone | 9.39 | 8.64 |
| Salt | 4.02 | 3.68 |
| Sodium Bicarbonate | 1.00 | 1.50 |
| Lysine Sulphate (60%) | 1.70 | 1.75 |
| DL-Methionine (99%) | 3.27 | 3.09 |
| L-Threonine (99%) | 0.47 | 0.42 |
| Choline Chloride (60%) | 0.50 | 0.50 |
| Adsorbent 1 | 1.00 | 1.00 |
| Vitamin Premix 2 | 1.30 | 1.00 |
| Mineral Premix 3 | 0.50 | 0.50 |
| Anticoccidial 4 | 0.55 | 0.55 |
| Enramycin 5 | 0.08 | |
| Inert (kaolin) 6 | 0.10 | 0.10 |
| Calculated Nutrient Composition, g/kg | ||
| Metabolisable Energy, MJ/kg | 12.552 | 12.761 |
| Crude Protein | 240.471 | 231.848 |
| Digestible Lysine | 13.000 | 12.50 |
| dMet+Cys 7 | 9.620 | 9.250 |
| Digestible Threonine | 8.580 | 8.250 |
| Digestible Valine | 10.000 | 9.630 |
| Digestible Tryptophan | 2.804 | 2.688 |
| Digestible Arginine | 15.196 | 14.573 |
| Calcium | 9.500 | 8.780 |
| Available Phosphorus | 4.500 | 4.190 |
| Sodium | 2.000 | 2.000 |
| Potassium | 9.372 | 9.039 |
| Vitamin D3 Breeders, mg/kg | Vitamin D3 Broilers, mg/kg |
|---|---|
| 0.0 | 0.0 |
| 0.0 | 50 |
| 0.0 | 100 |
| 100 | 0.0 |
| 100 | 50 |
| 100 | 100 |
| Gene | Primer Sequence (5′→3′) | Amplicon Size (bp) | Reference |
|---|---|---|---|
| β-actina | F: TTCTTTTGGCGCTTGACTCA R: GCGTTCGCTCCAACATGTT | 88 | [60] |
| CALB-D28K | F: TTGGCACTGAAATCCCACTGAA R: CATGCCAAGACCAAGGCTGA | 116 | NM_205513.2 |
| IL-1β | F: GCTCTACATGTCGTGTGTGATGAG R: TGTCGATGTCCCGCATGA | 80 | NM_204524.2 |
| IL-10 | F: CATGCTGCTGGGCCTGAA R: CGTCTCCTTGATCTGCTTGATG | 94 | NM_001004414.4 |
| Vitamin D3 Levels, mg/kg | Hatching BW, g/Bird | FI, g/Bird | BWG, g/Bird | FCR, g FI/g BWG |
|---|---|---|---|---|
| Vitamin D3 Breeders | ||||
| 0.0 | 47.73 b | 1154 | 917 | 1.261 |
| 100 | 48.48 a | 1157 | 923 | 1.254 |
| SEM 1 | 0.03 | 5.93 | 4.31 | 0.01 |
| Vitamin D3 Broilers | ||||
| 0.0 | 48.12 | 1167 | 914 | 1.279 B |
| 50 | 48.14 | 1152 | 920 | 1.252 A |
| 100 | 48.06 | 1149 | 925 | 1.242 A |
| SEM | 0.09 | 5.89 | 4.33 | 0.01 |
| p-Value | ||||
| Vitamin D3 Breeders | 0.001 | 0.812 | 0.480 | 0.351 |
| Vitamin D3 Broilers | 0.893 | 0.443 | 0.603 | 0.001 |
| Vitamin D3 Breeders × Vitamin D3 Broilers Interaction | 0.737 | 0.672 | 0.845 | 0.245 |
| Vitamin D3 Levels, mg/kg | VH, µm | CD, µm | AA, µm2 | VH/CD, µm |
|---|---|---|---|---|
| Vitamin D3 Breeders | ||||
| 0.0 | 780.50 | 49.17 | 16.43 | 15.89 |
| 100 | 745.51 | 44.51 | 16.17 | 17.52 |
| SEM 1 | 17.78 | 1.53 | 0.53 | 0.60 |
| Vitamin D3 Broilers | ||||
| 0.0 | 804.82 | 46.42 | 17.44 | 17.14 |
| 50 | 761.37 | 49.58 | 15.55 | 15.90 |
| 100 | 724.36 | 44.17 | 15.92 | 17.09 |
| SEM | 17.48 | 1.54 | 0.52 | 0.61 |
| p-Value | ||||
| Vitamin D3 Breeders | 0.205 | 0.095 | 0.766 | 0.181 |
| Vitamin D3 Broilers | 0.089 | 0.315 | 0.329 | 0.304 |
| Vitamin D3 Breeders × Vitamin D3 Broilers Interaction | 0.004 | 0.105 | 0.001 | 0.810 |
| Villus Height, µm | Absorption Area, µm2 | |||||||
|---|---|---|---|---|---|---|---|---|
| Vitamin D3 Broilers, mg/kg | Vitamin D3 Breeders, mg/kg | |||||||
| 0.0 | 100 | SEM | p-Value | 0.0 | 100 | SEM | p-Value | |
| 0.0 | 898.52 aA | 722.84 B | 18.31 | 0.004 | 19.74 aA | 15.13 B | 0.72 | 0.004 |
| 50 | 780.15 ab | 742.60 | 36.14 | 0.599 | 15.76 b | 15.34 | 0.94 | 0.823 |
| 100 | 677.65 b | 771.08 | 24.21 | 0.066 | 13.80 bB | 18.03 A | 0.71 | 0.008 |
| SEM 1 | 20.10 | 20.03 | 0.48 | 0.58 | ||||
| p-Value | 0.002 | 0.660 | 0.001 | 0.180 | ||||
| Vitamin D3 Levels, mg/kg | Ca mg/dL | P mg/dL | LDH U/L | CPK U/L | ALP U/L |
|---|---|---|---|---|---|
| Vitamin D3 Breeders | |||||
| 0.0 | 9.48 | 7.50 | 683 | 2162 | 26,500 a |
| 100 | 9.09 | 7.16 | 642 | 2872 | 20,920 b |
| SEM 1 | 0.11 | 0.13 | 30.56 | 123.54 | 412.70 |
| Vitamin D3 Broilers | |||||
| 0.0 | 9.16 | 7.24 | 662 | 2349 | 23,561 |
| 50 | 9.70 | 7.48 | 671 | 3233 | 24,057 |
| 100 | 9.01 | 7.27 | 654 | 1904 | 23,684 |
| SEM | 0.12 | 0.13 | 31.05 | 151.28 | 316.01 |
| p-Value | |||||
| Vitamin D3 Breeders | 0.411 | 0.184 | 0.505 | 0.320 | 0.004 |
| Vitamin D3 Broilers | 0.492 | 0.691 | 0.965 | 0.274 | 0.962 |
| Vitamin D3 Breeders × Vitamin D3 Broilers Interaction | 0.758 | 0.545 | 0.367 | 0.611 | 0.529 |
| Vitamin D3 Levels, mg/kg | Seedor Index | Breaking Strength, kg |
|---|---|---|
| Vitamin D3 Breeders | ||
| 0.0 | 68.82 | 22.45 |
| 100 | 70.18 | 22.28 |
| SEM 1 | 1.02 | 0.53 |
| Vitamin D3 Broilers | ||
| 0.0 | 68.43 | 21.89 |
| 50 | 67.26 | 21.41 |
| 100 | 72.78 | 23.77 |
| SEM | 0.97 | 0.52 |
| p-Value | ||
| Vitamin D3 Breeders | 0.453 | 0.879 |
| Vitamin D3 Broilers | 0.057 | 0.142 |
| Vitamin D3 Breeders × Vitamin D3 Broilers Interaction | 0.505 | 0.726 |
| Vitamin D3 Levels, mg/kg | Dry Matter, % | Phosphorus, % | Calcium, % |
|---|---|---|---|
| Vitamin D3 Breeders | |||
| 0.0 | 40.12 | 11.34 | 16.23 |
| 100 | 40.70 | 11.31 | 16.27 |
| SEM 1 | 0.33 | 0.29 | 0.36 |
| Vitamin D3 Broilers | |||
| 0.0 | 39.72 | 11.68 A | 17.51 A |
| 50 | 40.71 | 11.96 A | 16.64 A |
| 100 | 40.83 | 10.33 B | 14.59 B |
| SEM | 0.33 | 0.27 | 0.31 |
| p-Value | |||
| Vitamin D3 Breeders | 0.344 | 0.966 | 0.951 |
| Vitamin D3 Broilers | 0.306 | 0.044 | 0.005 |
| Vitamin D3 Breeders × Vitamin D3 Broilers Interaction | 0.487 | 0.900 | 0.006 |
| Vitamin D3 Broilers, mg/kg | Vitamin D3 Breeders, mg/kg | |||
|---|---|---|---|---|
| 0.0 | 100 | SEM | p-Value | |
| 0.0 | 16.78 | 18.25 a | 0.45 | 0.118 |
| 50 | 15.98 | 17.31 a | 0.63 | 0.292 |
| 100 | 15.94 A | 13.25 bB | 0.42 | 0.005 |
| SEM 1 | 0.37 | 0.45 | ||
| p-Value | 0.567 | 0.003 | ||
| Vitamin D3 Levels, mg/kg | Calbindin D28K | Interleukin 10 | Interleukin 1β |
|---|---|---|---|
| Vitamin D3 Breeders | |||
| 0.0 | 0.239 b | 1.557 b | 1.030 b |
| 100 | 0.358 a | 1.820 a | 1.366 a |
| SEM 1 | 0.02 | 0.12 | 0.07 |
| Vitamin D3 Broilers | |||
| 0.0 | 0.273 B | 1.781 | 1.255 |
| 50 | 0.318 A | 1.707 | 1.108 |
| 100 | 0.306 A | 1.599 | 1.207 |
| SEM | 0.02 | 0.13 | 0.07 |
| p-Value | |||
| Vitamin D3 Breeders | 0.001 | 0.001 | 0.003 |
| Vitamin D3 Broilers | 0.047 | 0.176 | 0.461 |
| Vitamin D3 Breeders × Vitamin D3 Broilers Interaction | 0.122 | 0.227 | 0.897 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Andrade, T.S.; Rohloff Junior, N.; Carvalho, P.L.O.; Vieira, B.S.; Vargas Junior, J.G.; Calderano, A.A.; Pozza, P.C.; Castilha, L.D.; Klosowski, E.S.; Eyng, C.; et al. Effects of 1,25-Dihydroxycholecalciferol Glycoside Supplementation on the Growth, Intestinal Health, and Immunity of Broilers from Breeders Supplemented or Not with the Same Additive. Vet. Sci. 2025, 12, 434. https://doi.org/10.3390/vetsci12050434
Andrade TS, Rohloff Junior N, Carvalho PLO, Vieira BS, Vargas Junior JG, Calderano AA, Pozza PC, Castilha LD, Klosowski ES, Eyng C, et al. Effects of 1,25-Dihydroxycholecalciferol Glycoside Supplementation on the Growth, Intestinal Health, and Immunity of Broilers from Breeders Supplemented or Not with the Same Additive. Veterinary Sciences. 2025; 12(5):434. https://doi.org/10.3390/vetsci12050434
Chicago/Turabian StyleAndrade, Thiago S., Nilton Rohloff Junior, Paulo L. O. Carvalho, Bruno S. Vieira, José G. Vargas Junior, Arele A. Calderano, Paulo C. Pozza, Leandro D. Castilha, Elcio S. Klosowski, Cinthia Eyng, and et al. 2025. "Effects of 1,25-Dihydroxycholecalciferol Glycoside Supplementation on the Growth, Intestinal Health, and Immunity of Broilers from Breeders Supplemented or Not with the Same Additive" Veterinary Sciences 12, no. 5: 434. https://doi.org/10.3390/vetsci12050434
APA StyleAndrade, T. S., Rohloff Junior, N., Carvalho, P. L. O., Vieira, B. S., Vargas Junior, J. G., Calderano, A. A., Pozza, P. C., Castilha, L. D., Klosowski, E. S., Eyng, C., & Nunes, R. V. (2025). Effects of 1,25-Dihydroxycholecalciferol Glycoside Supplementation on the Growth, Intestinal Health, and Immunity of Broilers from Breeders Supplemented or Not with the Same Additive. Veterinary Sciences, 12(5), 434. https://doi.org/10.3390/vetsci12050434

