Aflatoxin B1-Induced Apoptosis in Donkey Kidney via EndoG-Mediated Endoplasmic Reticulum Stress
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animal and Treatment
2.2. Routine Blood and Renal Function Tests
2.3. Determination of Renal Organ Coefficient
2.4. Histomorphological Observation
2.5. Ultrastructure Observations
2.6. TUNEL Assay
2.7. Immunofluorescence Staining
2.8. Detection of Antioxidant Function
2.9. Real-Time Quantitative PCR Analysis
2.10. Western Blotting Analysis
2.11. Data and Analyses
3. Results
3.1. Effect of AFB1 on Blood Indices in Donkey
3.2. Impact of AFB1 on Renal Organ Coefficient and Renal Function in Donkeys
3.3. Effect of AFB1 on Histopathology of Donkey Kidney Tissue
3.4. Effect of AFB1 on Ultrastructure of Kidney in Donkey
3.5. Effect of AFB1 on Antioxidant Capacity in Kidney of Donkey
3.6. Effect of AFB1 on the EndoG Expression in Donkey Kidney
3.7. Effects of AFB1 Exposure on ER Stress in Donkey Kidney
3.8. Effects of AFB1 Exposure on Apoptosis in Donkey Kidney
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Gurtoo, H.L.; Dahms, R.P.; Paigen, B. Metabolic Activation of Aflatoxins Related to Their Mutagenicity. Biochem. Biophys. Res. Commun. 1978, 81, 965–972. [Google Scholar] [CrossRef] [PubMed]
- Bondy, G.S.; Pestka, J.J. Immunomodulation by Fungal Toxins. J. Toxicol. Pestka Environ. Health Part B 2000, 3, 109–143. [Google Scholar]
- Abdel-Fattah, H.M.; Kamel, Y.Y.; Megalla, S.E.; Mycopathologia, H.A.H. Aflatoxin and Aflatoxicosis. Mycopathologia 1982, 77, 129–135. [Google Scholar] [CrossRef] [PubMed]
- Rodricks, J.V.; Hesseltine, C.W.; Mehlman, M.A. Mycotoxins in Human and Animal Health. In Proceedings of the Conference on Mycotoxins in Human and Animal Health, Convened at University of Maryland University College, Center of Adult Education, College Park, MD, USA, 4–8 October 1977. [Google Scholar]
- Zou, G.X.; Zhang, H.X.; Hua, R.M. Research Progress in Toxicological Effects and Mechanism of T-2 Toxin. Asian J. Ecotoxicol. 2011, 6, 121–128. [Google Scholar]
- Bertrand, G.; Applegate, T. Modulation of Intestinal Functions Following Mycotoxin Ingestion: Meta-Analysis of Published Experiments in Animals. Toxins 2013, 5, 396–430. [Google Scholar] [CrossRef]
- Peters, A.; Nawrot, T.S.; Baccarelli, A.A. Hallmarks of Environmental Insults. Cell 2021, 184, 1455–1468. [Google Scholar] [CrossRef]
- Benkerroum, N. Chronic and Acute Toxicities of Aflatoxins: Mechanisms of Action. Int. J. Environ. Res. Public Health 2020, 17, 423. [Google Scholar] [CrossRef] [PubMed]
- Cao, W.Y.; Yu, P.; Yang, K.P.; Cao, D.L. Aflatoxin B1: Metabolism, Toxicology, and Its Involvement in Oxidative Stress and Cancer Development. Toxicol. Mech. Methods 2022, 32, 395–419. [Google Scholar] [CrossRef] [PubMed]
- Deng, J.; Zhao, L.; Zhang, N.; Karrow, A.K.; Krumm, Q.D.; Sun, L. Aflatoxin B-1 Metabolism: Regulation by Phase I and Ii Metabolizing Enzymes and Chemoprotective Agents. Mutation Research. Rev. Mutat. Res. 2018, 778, 79–89. [Google Scholar] [CrossRef] [PubMed]
- Pu, J.; Yuan, Q.; Yan, H.; Tian, G.; Chen, D.; He, J.; Zheng, P.; Yu, J.; Mao, X.; Huang, Z. Effects of Chronic Exposure to Low Levels of Dietary Aflatoxin B1 on Growth Performance, Apparent Total Tract Digestibility and Intestinal Health in Pigs. Animals 2021, 11, 336. [Google Scholar] [CrossRef]
- Elgioushy, M.M.; Elgaml, S.A.; El-Adl, M.M.; Hegazy, A.M.; Hashish, E.A. Aflatoxicosis in Cattle: Clinical Findings and Biochemical Alterations. Environ. Sci. Hashish Pollut. Res. Int. 2020, 28, 35526–35534. [Google Scholar] [CrossRef] [PubMed]
- Fouad, A.M.; Ruan, D.; El-Senousey, H.K.; Chen, W.; Jiang, S.; Zheng, C. Harmful Effects and Control Strategies of Aflatoxin B1 Produced by Aspergillus Flavus and Aspergillus Parasiticus Strains on Poultry: Review. Toxins 2019, 11, 176. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.; Li, W.; Muhammad, I.; Sun, X.; Cui, X.; Chen, P.; Qayum, A.; Zhang, X. Biochemical Basis for the Age-Related Sensitivity of Broilers to Aflatoxin B1. Toxicol Mech Methods 2018, 28, 361–368. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Li, S.; Yang, H.; Wang, Y.; Wang, J.; Zheng, N. L-Proline Alleviates Kidney Injury Caused by Afb1 and Afm1 through Regulating Excessive Apoptosis of Kidney Cells. Toxins 2019, 11, 226. [Google Scholar] [CrossRef]
- Qian, G.; Tang, L.; Lin, S.; Xue, K.S.; Nicole, J.M.; Su, J.; Gelderblom, W.C.; Riley, R.T.; Phillipset, T.D.; Wang, J. Sequential Dietary Exposure to Aflatoxin B1 and Fumonisin B1 in F344 Rats Increases Liver Preneoplastic Changes Indicative of a Synergistic Interaction. Food Chem. Toxicol. 2016, 95, 188–195. [Google Scholar] [CrossRef] [PubMed]
- Wang, W.; Tan, J.; Liu, X.; Guo, W.; Li, M.; Liu, X.; Liu, Y.; Dai, W.; Hu, L.; Wang, Y.; et al. Cytoplasmic Endonuclease G promotes nonalcoholic fatty liver disease via mTORC2-AKT-ACLY and endoplasmic reticulum stress. Nat. Commun. 2023, 14, 6201. [Google Scholar] [CrossRef] [PubMed]
- Berridge, M.J. The endoplasmic reticulum: A multifunctional signaling organelle. Cell Calcium. 2002, 32, 235–249. [Google Scholar] [CrossRef] [PubMed]
- Arruda, A.P.; Hotamisligil, G.S. Calcium Homeostasis and Organelle Function in the Pathogenesis of Obesity and Diabetes. Cell Metab. 2015, 22, 381–397. [Google Scholar] [CrossRef] [PubMed]
- Krebs, J.; Agellon, L.B.; Michalak, M. Ca(2+) homeostasis and endoplasmic reticulum (ER) stress: An integrated view of calcium signaling. Biochem. Biophys. Res. Commun. 2015, 460, 114–121. [Google Scholar] [CrossRef] [PubMed]
- Hourihan, J.M.; Moronetti, M.L.E.; Fernández-Cárdenas, L.P.; Blackwell, T.K. Cysteine Sulfenylation Directs IRE-1 to Activate the SKN-1/Nrf2 Antioxidant Response. Mol. Cell. 2016, 63, 553–566. [Google Scholar] [CrossRef]
- Fernández, A.; Ordóñez, R.; Reiter, R.J.; González-Gallego, J.; Mauriz, J.L. Melatonin and endoplasmic reticulum stress: Relation to autophagy and apoptosis. J. Pineal. Res. 2015, 59, 292–307. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Guo, J.; Yang, N.; Huang, Y.; Hu, T.; Rao, C. Endoplasmic reticulum stress-mediated cell death in liver injury. Cell Death Dis. 2022, 13, 1051. [Google Scholar] [CrossRef] [PubMed]
- Gorman, A.M.; Healy, S.J.; Jäger, R.; Samali, A. Stress management at the ER: Regulators of ER stress-induced apoptosis. Pharmacol. Ther. 2012, 134, 306–316. [Google Scholar] [CrossRef] [PubMed]
- Corcuera, L.A.; Ibáñez-Vea, M.; Vettorazzi, A.; González-Peñas, E.; Cerain, A.L. Validation of a UHPLC-FLD analytical method for the simultaneous quantification of aflatoxin B1 and ochratoxin a in rat plasma, liver and kidney. J. Chromatogr. B Analyt. Technol. Biomed. Life Sci. 2011, 879, 2733–2740. [Google Scholar] [CrossRef] [PubMed]
- Monson, M.S.; Settlage, R.E.; McMahon, K.; Mendoza, K.M.; Rawal, S.; El-Nezami, H.S.; Coulombe, R.A. Reed KM. Response of the hepatic transcriptome to aflatoxin B1 in domestic turkey (Meleagris gallopavo). PLoS ONE 2014, 9, e100930. [Google Scholar] [CrossRef] [PubMed]
- Mykkänen, H.; Zhu, H.; Salminen, E.; Juvonen, R.O.; Ling, W.; Ma, J.; Polychronaki, N.; Kemiläinen, H.; Mykkänen, O.; Salminen, S.; et al. Fecal and urinary excretion of aflatoxin B1 metabolites (AFQ1, AFM1 and AFB-N7-guanine) in young Chinese males. Int. J. Cancer 2005, 115, 879–884. [Google Scholar] [CrossRef] [PubMed]
- Narkwa, P.W.; Blackbourn, D.J.; Mutocheluh, M. Aflatoxin B1 inhibits the type 1 interferon response pathway via STAT1 suggesting another mechanism of hepatocellular carcinoma. Infect. Agent. Cancer 2017, 12, 17. [Google Scholar] [CrossRef]
- Pandey, I.; Chauhan, S.S. Studies on production performance and toxin residues in tissues and eggs of layer chickens fed on diets with various concentrations of aflatoxin AFB1. Br. Poult. Sci. 2007, 48, 713–723. [Google Scholar] [CrossRef]
- Câmara, N.O.; Iseki, K.; Kramer, H.; Liu, Z.H.; Sharma, K. Kidney disease and obesity: Epidemiology, mechanisms and treatment. Nat. Rev. Nephrol. 2017, 13, 181–190. [Google Scholar] [CrossRef] [PubMed]
- Romagnoli, S.; Ricci, Z. The Kidney in Diastolic Dysfunction. In Critical Care Nephrology, 3rd ed.; Elsevier: Amsterdam, The Netherlands, 2019; pp. 718–721. [Google Scholar]
- Mogilnaya, O.; Puzyr, A.; Baron, A.; Bondar, V. Hematological parameters and the state of liver cells of rats after oral administration of aflatoxin b1 alone and together with nanodiamonds. Nanoscale Res. Lett. 2010, 5, 908–912. [Google Scholar] [CrossRef] [PubMed]
- Bodas, R.; Giráldez, F.J.; Olmedo, S.; Herrera, M.; Lorán, S.; Ariño, A.; López, S.; Benito, A.; Juan, T. The Effects of Aflatoxin B1 Intake in Assaf Dairy Ewes on Aflatoxin M1 Excretion, Milk Yield, Haematology and Biochemical Profile. Animals 2023, 13, 436. [Google Scholar] [CrossRef]
- Soudani, N.; Sefi, M.; Ben, A.I.; Boudawara, T.; Zeghal, N. Protective effects of Selenium (Se) on Chromium (VI) induced nephrotoxicity in adult rats. Ecotoxicol. Environ. Saf. 2010, 73, 671–678. [Google Scholar] [CrossRef]
- Wang, N.; Li, P.; Wang, M.; Chen, S.; Huang, S.; Long, M.; Yang, S.; He, J. The Protective Role of Bacillus velezensis A2 on the Biochemical and Hepatic Toxicity of Zearalenone in Mice. Toxins 2018, 10, 449. [Google Scholar] [CrossRef] [PubMed]
- Gao, X.; Jiang, L.; Xu, J.; Liu, W.; Li, S.; Huang, W.; Zhao, H.; Yang, Z.; Yu, X.; Wei, Z. Aflatoxin B1-activated heterophil extracellular traps result in the immunotoxicity to liver and kidney in chickens. Dev. Comp. Immunol. 2022, 128, 104325. [Google Scholar] [CrossRef] [PubMed]
- Li, W.; Wu, G.; Yang, X.; Yang, J.; Hu, J. Taurine Prevents AFB1-Induced Renal Injury by Inhibiting Oxidative Stress and Apoptosis. Adv. Exp. Med. Biol. 2022, 1370, 435–444. [Google Scholar] [PubMed]
- Lin, L.X.; Cao, Q.Q.; Zhang, C.D.; Xu, T.T.; Yue, K.; Li, Q.; Liu, F.; Wang, X.; Dong, H.J.; Huang, S.C.; et al. Aflatoxin B1 causes oxidative stress and apoptosis in sheep testes associated with disrupting rumen microbiota. Ecotoxicol. Environ. Saf. 2022, 232, 113225. [Google Scholar] [CrossRef]
- Wang, Y.; Liu, F.; Zhou, X.; Liu, M.; Zang, H.; Liu, X.; Shan, A.; Feng, X. Alleviation of Oral Exposure to Aflatoxin B1-Induced Renal Dysfunction, Oxidative Stress, and Cell Apoptosis in Mice Kidney by Curcumin. Antioxidants 2022, 11, 1082. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Wang, J.; Chang, Z.; Li, S.; Zhang, Z.; Liu, S.; Wang, S.; Wei, L.; Lv, Q.; Ding, K.; et al. SeMet alleviates AFB1-induced oxidative stress and apoptosis in rabbit kidney by regulating Nrf2//Keap1/NQO1 and PI3K/AKT signaling pathways. Ecotoxicol. Environ. Saf. 2024, 269, 115742. [Google Scholar] [CrossRef] [PubMed]
- Xu, F.; Wang, P.; Yao, Q.; Shao, B.; Yu, H.; Yu, K.; Li, Y. Lycopene alleviates AFB1-induced immunosuppression by inhibiting oxidative stress and apoptosis in the spleen of mice. Food Funct. 2019, 10, 3868–3879. [Google Scholar] [CrossRef]
- Liu, H.; He, Y.; Gao, X.; Li, T.; Qiao, B.; Tang, L.; Lan, J.; Su, Q.; Ruan, Z.; Tang, Z.; et al. Curcumin alleviates AFB1-induced nephrotoxicity in ducks: Regulating mitochondrial oxidative stress, ferritinophagy, and ferroptosis. Mycotoxin Res. 2023, 39, 437–451. [Google Scholar] [CrossRef]
- Tao, W.; Li, Z.; Nabi, F.; Hu, Y.; Hu, Z.; Liu, J. Penthorum chinense Pursh Compound Ameliorates AFB1-Induced Oxidative Stress and Apoptosis via Modulation of Mitochondrial Pathways in Broiler Chicken Kidneys. Front. Vet. Sci. 2021, 8, 750937. [Google Scholar] [CrossRef] [PubMed]
- Li, L.Y.; Luo, X.; Wang, X. Endonuclease G is an apoptotic DNase when released from mitochondria. Nature 2001, 412, 95–99. [Google Scholar] [CrossRef] [PubMed]
- Yuan, S.; Wu, B.; Yu, Z.; Fang, J.; Liang, N.; Zhou, M.; Huang, C.; Peng, X. The mitochondrial and endoplasmic reticulum pathways involved in the apoptosis of bursa of Fabricius cells in broilers exposed to dietary aflatoxin B1. Oncotarget 2016, 7, 65295–65306. [Google Scholar] [CrossRef]
- Song, C.; Wang, Z.; Cao, J.; Dong, Y.; Chen, Y. Hesperetin protects hippocampal neurons from the neurotoxicity of Aflatoxin B1 in mice. Ecotoxicol. Environ. Saf. 2024, 269, 115782. [Google Scholar] [CrossRef] [PubMed]
- Peng, X.; Yu, Z.; Liang, N.; Chi, X.; Li, X.; Jiang, M.; Fang, J.; Cui, H.; Lai, W.; Zhou, Y.; et al. The mitochondrial and death receptor pathways involved in the thymocytes apoptosis induced by aflatoxin B1. Oncotarget 2016, 7, 12222–12234. [Google Scholar] [CrossRef]
- Lebeaupin, C.; Deborah, V.; Hazari, Y.; Hetz, C.; Bailly-Maitre, B. Endoplasmic Reticulum stress signaling and the pathogenesis of Non-Alcoholic Fatty Liver Disease. J. Hepatol. 2018, 69, 927–947. [Google Scholar] [CrossRef]
- Wang, W.; Li, J.; Zhou, Q. The biological function of cytoplasm-translocated ENDOG (endonuclease G). Autophagy 2024, 20, 445–447. [Google Scholar] [CrossRef]
- Tabas, I.; Ron, D. Integrating the mechanisms of apoptosis induced by endoplasmic reticulum stress. Nat.Cell Biol. 2011, 13, 184–190. [Google Scholar] [CrossRef]
- Park, S.M.; Kang, T.I.; So, J.S. Roles of XBP1s in Transcriptional Regulation of Target Genes. Biomedicines 2021, 9, 791. [Google Scholar] [CrossRef]
- Hillary, R.F.; FitzGerald, U. A lifetime of stress: ATF6 in development and homeostasis. J. Biomed. Sci. 2018, 25, 48. [Google Scholar] [CrossRef] [PubMed]
- Iurlaro, R.; Muñoz-Pinedo, C. Cell death induced by endoplasmic reticulum stress. FEBS J. 2016, 283, 2640–2652. [Google Scholar] [CrossRef] [PubMed]
- Tsukano, H.; Gotoh, T.; Endo, M.; Miyata, K.; Tazume, H.; Kadomatsu, T.; Yano, M.; Iwawaki, T.; Kohno, K.; Araki, K.; et al. he endoplasmic reticulum stress-C/EBP homologous protein pathway-mediated apoptosis in macrophages contributes to the instability of atherosclerotic plaques. Arterioscler. Thromb. Vasc. Biol. 2010, 10, 1925–1932. [Google Scholar] [CrossRef] [PubMed]
- Liao, S.; Shi, D.; Clemons-Chevis, C.L.; Guo, S.; Su, R.; Qiang, P.; Tang, Z. Protective role of selenium on aflatoxin b1-induced hepatic dysfunction and apoptosis of liver in ducklings. Biol. Trace. Elem. Res. 2014, 162, 296–301. [Google Scholar] [CrossRef]
- Murai, A.; Ebara, S.; Sasaki, S.; Ohashi, T.; Miyazaki, T.; Nomura, T.; Araki, S. Synergistic apoptotic effects in cancer cells by the combination of CLK and Bcl-2 family inhibitors. PLoS ONE 2020, 15, e0240718. [Google Scholar] [CrossRef] [PubMed]
- Lakhani, S.A.; Masud, A.; Kuida, K.; Porter, G.A.J.; Booth, C.J.; Mehal, W.Z.; Inayat, I.; Flavell, R.A. Caspases 3 and 7: Key mediators of mitochondrial events of apoptosis. Science 2006, 311, 847–851. [Google Scholar] [CrossRef] [PubMed]
- Yasin, M.; Mazdak, R.; Mino, I. Aflatoxin B1 impairs spermatogenesis: An experimental study for crosslink between oxidative stress and mitochondria-dependent apoptosis. Environ. Toxicol. 2018, 33, 1204–1213. [Google Scholar] [CrossRef]
- Liu, Y.; Wang, W. Aflatoxin B1 impairs mitochondrial functions, activates ROS generation, induces apoptosis and involves Nrf2 signal pathway in primary broiler hepatocytes. Anim. Sci. J. 2016, 87, 1490–1500. [Google Scholar] [CrossRef] [PubMed]
Name | Forward Primer Sequence (5′-3′) | Reverse Primer Sequence (5′-3′) |
---|---|---|
β-actin | CGGGACCTGACGGACTACCTC | TCCTTGATGTCACGCACGATTTCC |
Endo G | TCTGCTCCTATGTGATGCCCAAC | CTTGACTCTGCCCGCCCTTG |
GRP78 | AACCGCATCACGCCGTCTTATG | GGTTGGAGGTGAGCTGGTTCTTG |
GRP94 | ACCCCGATGCAAAGGTTGAAGAAG | GTCTTGCTCCGTGTCGTCTGTG |
ATF-6 | TGGGAAACAGGCATTTGGGACATC | CTGAACAACTTGAGGAGGCTGGAG |
IRE1 | TCCAACCACTCGCTCCACTCTAC | CCTCATCCTCGTCGTCCTGCTC |
XBP1 | ACTGAAGAGGAGGCTGAGACCAAG | GGAGAGGTTCTGGAGGGGTGAC |
CHOP | TGCTTCTCTGGCTTGGCTGAC | TGGTCTTCCTCCTCTTCCTCCTG |
BAX | TGGACACTGGACTTCCTTCGAGAG | TGGTGAGCGAGGCGGTGAG |
BCL2 | GGGACGCTTTGCCACGGTAG | CGGTTGACGCTCTCCACACAC |
Caspase9 | GACCTGACCGCCGAGCAAATG | TGACAGCCGTGAGAGAGGATGAC |
Caspase3 | TGCAGAAGTCTAGCTGGAAAACCC | TAGCACAAAGCGACTGGATGAACC |
Antibody Name | Diluting Factor | Source | Brand |
---|---|---|---|
β-actin | 1:10,000 | Rabbit | Abclonal |
EndoG | 1:1000 | Rabbit | Abclonal |
GRP78 | 1:2000 | Rabbit | Wanleibio |
GRP94 | 1:1000 | Rabbit | Wanleibio |
ATF6 | 1:2000 | Rabbit | Wanleibio |
IRE1 | 1:1000 | Rabbit | Wanleibio |
XBP1 | 1:1000 | Rabbit | Wanleibio |
BAX | 1:1000 | Rabbit | Wanleibio |
BCL2 | 1:1000 | Rabbit | Wanleibio |
Caspase9 | 1:1000 | Rabbit | Wanleibio |
Caspase3 | 1:1000 | Rabbit | Wanleibio |
Control Group | AFB1 Group | p-Value | |
---|---|---|---|
WBC (109/L) | 14.73 ± 1.23 | 13.94 ± 0.88 | 0.27 |
HGB (g/L) | 117.2 ± 9.83 | 105.6 ± 10.6 | 0.11 |
PLT (109/L) | 301 ± 72.6 | 328.25 ± 36.3 | 0.53 |
RBC (1012/L) | 6.88 ± 0.51 | 6.22 ± 0.72 | 0.133 |
Lym (109/L) | 6.82 ± 1.85 | 7.8 ± 1.92 | 0.194 |
Neu (109/L) | 4.91 ± 0.29 | 6.52 ± 0.78 | 0.002 |
Neu% | 35.3 ± 3.17 | 44.62 ± 7.38 | 0.03 |
Lym% | 46.14 ± 6.14 | 55.82 ± 3.67 | 0.015 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ji, Y.; Zhang, Y.; Si, W.; Guo, J.; Liu, G.; Wang, C.; Khan, M.Z.; Zhao, X.; Liu, W. Aflatoxin B1-Induced Apoptosis in Donkey Kidney via EndoG-Mediated Endoplasmic Reticulum Stress. Vet. Sci. 2025, 12, 130. https://doi.org/10.3390/vetsci12020130
Ji Y, Zhang Y, Si W, Guo J, Liu G, Wang C, Khan MZ, Zhao X, Liu W. Aflatoxin B1-Induced Apoptosis in Donkey Kidney via EndoG-Mediated Endoplasmic Reticulum Stress. Veterinary Sciences. 2025; 12(2):130. https://doi.org/10.3390/vetsci12020130
Chicago/Turabian StyleJi, Yanfei, Yu Zhang, Wenxuan Si, Jing Guo, Guiqin Liu, Changfa Wang, Muhammad Zahoor Khan, Xia Zhao, and Wenqiang Liu. 2025. "Aflatoxin B1-Induced Apoptosis in Donkey Kidney via EndoG-Mediated Endoplasmic Reticulum Stress" Veterinary Sciences 12, no. 2: 130. https://doi.org/10.3390/vetsci12020130
APA StyleJi, Y., Zhang, Y., Si, W., Guo, J., Liu, G., Wang, C., Khan, M. Z., Zhao, X., & Liu, W. (2025). Aflatoxin B1-Induced Apoptosis in Donkey Kidney via EndoG-Mediated Endoplasmic Reticulum Stress. Veterinary Sciences, 12(2), 130. https://doi.org/10.3390/vetsci12020130