Detection of Insertion/Deletions (InDel) Within Five Clock Genes and Their Associations with Growth Traits in Four Chinese Sheep Breeds
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Animal Samples, Data Collection, DNA Extraction and Genomic DNA Pools Construction
2.3. Primer Design, PCR Amplification, and InDel Genotyping
2.4. Statistical Analysis of Population Genetics
3. Results
3.1. Indel Genotyping and Sequencing
3.2. Genetic Polymorphism Analysis of CLOCK Gene in Hu Sheep, Tong Sheep, Small-Tail Han Sheep, and Lanzhou Fat-Tailed Sheep
3.3. Genetic Polymorphism Analysis of PER3 Gene in Hu Sheep, Tong Sheep, Small-Tail Han Sheep, and Lanzhou Fat-Tailed Sheep
3.4. Association Analysis of Growth Traits in Hu Sheep with the CLOCK Gene
3.5. Association Analysis of Growth Traits in Tong Sheep and Small-Tail Han Sheep with the PER3 Gene
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Tao, L.; Liu, Y.F.; Zhang, H.; Li, H.Z.; Zhao, F.P.; Wang, F.Y.; Zhang, R.S.; Di, R.; Chu, M.X. Genome-wide Association Study and Inbreeding Depression on Body Size Traits in Qira Black Sheep (Ovis aries). Anim. Genet. 2021, 52, 560–564. [Google Scholar] [CrossRef]
- Dawut, A.; Tian, Y. Competitiveness of Xinjiang’s Mutton Industry Based on Diamond Model. PLoS ONE 2021, 16, e0257669. [Google Scholar] [CrossRef] [PubMed]
- Montossi, F.; Font-i-Furnols, M.; Del Campo, M.; San Julián, R.; Brito, G.; Sañudo, C. Sustainable Sheep Production and Consumer Preference Trends: Compatibilities, Contradictions, and Unresolved Dilemmas. Meat Sci. 2013, 95, 772–789. [Google Scholar] [CrossRef] [PubMed]
- Grochowska, E.; Lisiak, D.; Akram, M.Z.; Adeniyi, O.O.; Lühken, G.; Borys, B. Association of a Polymorphism in Exon 3 of the IGF1R Gene with Growth, Body Size, Slaughter and Meat Quality Traits in Colored Polish Merino Sheep. Meat Sci. 2021, 172, 108314. [Google Scholar] [CrossRef] [PubMed]
- Hyten, D.L.; Cannon, S.B.; Song, Q.; Weeks, N.; Fickus, E.W.; Shoemaker, R.C.; Specht, J.E.; Farmer, A.D.; May, G.D.; Cregan, P.B. High-Throughput SNP Discovery through Deep Resequencing of a Reduced Representation Library to Anchor and Orient Scaffolds in the Soybean Whole Genome Sequence. BMC Genom. 2010, 11, 38. [Google Scholar] [CrossRef] [PubMed]
- Wu, M.; Zhao, H.; Tang, X.; Li, Q.; Yi, X.; Liu, S.; Sun, X. Novel InDels of GHR, GHRH, GHRHR and Their Association with Growth Traits in Seven Chinese Sheep Breeds. Animals 2020, 10, 1883. [Google Scholar] [CrossRef]
- Yi, X.; He, S.; Wang, S.; Zhao, H.; Wu, M.; Liu, S.; Pan, Y.; Zhang, Y.; Sun, X. Expression of Different Genotypes of Bovine TRDMT1 Gene and Its Polymorphisms Association with Body Measures in Qinchuan Cattle (Bos taurus). Anim. Biotechnol. 2023, 34, 574–584. [Google Scholar] [CrossRef]
- Yi, X.; He, S.; Wang, S.; Zhao, H.; Wu, M.; Liu, S.; Sun, X. Detection of Genetic Variation and Activity Analysis of the Promoter Region of the Cattle tRNA-Modified Gene TRDMT1. Arch. Anim. Breed. 2021, 64, 147–155. [Google Scholar] [CrossRef] [PubMed]
- Zhao, H.; Wu, M.; Yi, X.; Tang, X.; Chen, P.; Wang, S.; Sun, X. Functional Analysis of Haplotypes in Bovine PSAP Gene and Their Relationship with Beef Cattle Production Traits. Animals 2020, 11, 49. [Google Scholar] [CrossRef] [PubMed]
- Xin, D.; Bai, Y.; Bi, Y.; He, L.; Kang, Y.; Pan, C.; Zhu, H.; Chen, H.; Qu, L.; Lan, X. Insertion/Deletion Variants within the IGF2BP2 Gene Identified in Reported Genome-Wide Selective Sweep Analysis Reveal a Correlation with Goat Litter Size. J. Zhejiang Univ. Sci. B 2021, 22, 757–766. [Google Scholar] [CrossRef]
- Wang, W.; La, Y.; Zhou, X.; Zhang, X.; Li, F.; Liu, B. The Genetic Polymorphisms of TGFβ Superfamily Genes Are Associated with Litter Size in a Chinese Indigenous Sheep Breed (Hu Sheep). Anim. Reprod. Sci. 2018, 189, 19–29. [Google Scholar] [CrossRef] [PubMed]
- Tao, L.; He, X.Y.; Pan, L.X.; Wang, J.W.; Gan, S.Q.; Chu, M.X. Genome-wide Association Study of Body Weight and Conformation Traits in Neonatal Sheep. Anim. Genet. 2020, 51, 336–340. [Google Scholar] [CrossRef]
- Zhao, Y.; Zhao, E.; Zhang, N.; Duan, C. Mitochondrial DNA Diversity, Origin, and Phylogenic Relationships of Three Chinese Large-Fat-Tailed Sheep Breeds. Trop. Anim. Health Prod. 2011, 43, 1405–1410. [Google Scholar] [CrossRef] [PubMed]
- Sun, W.; Chang, H.; Musa Hussein, H.; Liao, X.; Chu, M.; Kija, J. Microsatellite-Based Genetic Differentiation and Phylogeny of Sheep Breeds in Mongolia Sheep Group of China. Agric. Sci. China 2011, 10, 1080–1087. [Google Scholar] [CrossRef]
- Wang, S.; Liu, S.; Yuan, T.; Sun, X. Genetic Effects of FTO Gene Insertion/Deletion (InDel) on Fat-Tail Measurements and Growth Traits in Tong Sheep. Anim. Biotechnol. 2021, 32, 229–239. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Xu, H.; Liu, X.; Xu, H.; Cai, Y.; Lan, X. Insight into the Possible Formation Mechanism of the Intersex Phenotype of Lanzhou Fat-Tailed Sheep Using Whole-Genome Resequencing. Animals 2020, 10, 944. [Google Scholar] [CrossRef]
- Zhao, F.; Xie, R.; Fang, L.; Xiang, R.; Yuan, Z.; Liu, Y.; Wang, L. Analysis of 206 Whole-genome Resequencing Reveals Selection Signatures Associated with Breed-specific Traits in Hu Sheep. Evol. Appl. 2024, 17, e13697. [Google Scholar] [CrossRef] [PubMed]
- Jiao, J.; Wang, T.; Zhou, J.; Degen, A.A.; Gou, N.; Li, S.; Bai, Y.; Jing, X.; Wang, W.; Shang, Z. Carcass Parameters and Meat Quality of Tibetan Sheep and Small-tailed Han Sheep Consuming Diets of Low-protein Content and Different Energy Yields. Anim. Physiol. Nutr. 2020, 104, 1010–1023. [Google Scholar] [CrossRef] [PubMed]
- Varcoe, T.J.; Gatford, K.L.; Voultsios, A.; Salkeld, M.D.; Boden, M.J.; Rattanatray, L.; Kennaway, D.J. Rapidly Alternating Photoperiods Disrupt Central and Peripheral Rhythmicity and Decrease Plasma Glucose, but Do Not Affect Glucose Tolerance or Insulin Secretion in Sheep. Exp. Physiol. 2014, 99, 1214–1228. [Google Scholar] [CrossRef] [PubMed]
- Hergenhan, S.; Holtkamp, S.; Scheiermann, C. Molecular Interactions Between Components of the Circadian Clock and the Immune System. J. Mol. Biol. 2020, 432, 3700–3713. [Google Scholar] [CrossRef]
- Barrett, T.; Troup, D.B.; Wilhite, S.E.; Ledoux, P.; Rudnev, D.; Evangelista, C.; Kim, I.F.; Soboleva, A.; Tomashevsky, M.; Edgar, R. NCBI GEO: Mining Tens of Millions of Expression Profiles—Database and Tools Update. Nucleic Acids Res. 2007, 35, D760–D765. [Google Scholar] [CrossRef] [PubMed]
- Gurzov, E.N.; Eizirik, D.L. Bcl-2 Proteins in Diabetes: Mitochondrial Pathways of β-Cell Death and Dysfunction. Trends Cell Biol. 2011, 21, 424–431. [Google Scholar] [CrossRef] [PubMed]
- Lin, Y.; Li, J.; Wu, D.; Wang, F.; Fang, Z.; Shen, G. Identification of Hub Genes in Type 2 Diabetes Mellitus Using Bioinformatics Analysis. Diabetes Metab. Syndr. Obes. 2020, 13, 1793–1801. [Google Scholar] [CrossRef] [PubMed]
- Boyle, W.J.; Simonet, W.S.; Lacey, D.L. Osteoclast Differentiation and Activation. Nature 2003, 423, 337–342. [Google Scholar] [CrossRef] [PubMed]
- Chen, C.-Y.; Logan, R.W.; Ma, T.; Lewis, D.A.; Tseng, G.C.; Sibille, E.; McClung, C.A. Effects of Aging on Circadian Patterns of Gene Expression in the Human Prefrontal Cortex. Proc. Natl. Acad. Sci. USA 2016, 113, 206–211. [Google Scholar] [CrossRef] [PubMed]
- Gallego, M.; Virshup, D.M. Post-Translational Modifications Regulate the Ticking of the Circadian Clock. Nat. Rev. Mol. Cell Biol. 2007, 8, 139–148. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Li, K.; Zhang, K.; Li, Y.; Gu, H.; Liu, H.; Yang, Z.; Cai, D. The Circadian Physiology: Implications in Livestock Health. Int. J. Mol. Sci. 2021, 22, 2111. [Google Scholar] [CrossRef]
- Huang, Y.; Su, P.; Akhatayeva, Z.; Pan, C.; Zhang, Q.; Lan, X. Novel InDel Variations of the Cry2 Gene Are Associated with Litter Size in Australian White Sheep. Theriogenology 2022, 179, 155–161. [Google Scholar] [CrossRef]
- Samsa, W.E.; Vasanji, A.; Midura, R.J.; Kondratov, R.V. Deficiency of Circadian Clock Protein BMAL1 in Mice Results in a Low Bone Mass Phenotype. Bone 2016, 84, 194–203. [Google Scholar] [CrossRef]
- Xu, C.; Ochi, H.; Fukuda, T.; Sato, S.; Sunamura, S.; Takarada, T.; Hinoi, E.; Okawa, A.; Takeda, S. Circadian Clock Regulates Bone Resorption in Mice. J. Bone Miner. Res. 2016, 31, 1344–1355. [Google Scholar] [CrossRef] [PubMed]
- Yuan, G.; Hua, B.; Yang, Y.; Xu, L.; Cai, T.; Sun, N.; Yan, Z.; Lu, C.; Qian, R. The Circadian Gene Clock Regulates Bone Formation Via PDIA3. J. Bone Miner. Res. 2017, 32, 861–871. [Google Scholar] [CrossRef] [PubMed]
- Wu, X.; Xie, C.; Long, C.; Li, J.; Zhou, X.; Fan, Z.; Blachier, F.; Yin, Y. Effects of a Daily Three-meal Pattern with Different Dietary Protein Contents on Pig Growth Performance, Carcass and Muscle Quality Traits. J. Sci. Food Agric. 2018, 98, 415–421. [Google Scholar] [CrossRef] [PubMed]
- Cardoso, T.F.; Quintanilla, R.; Tibau, J.; Gil, M.; Mármol-Sánchez, E.; González-Rodríguez, O.; González-Prendes, R.; Amills, M. Nutrient Supply Affects the mRNA Expression Profile of the Porcine Skeletal Muscle. BMC Genom. 2017, 18, 603. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Jiang, E.; Zhang, K.; Zhang, S.; Jiang, F.; Song, E.; Chen, H.; Guo, P.; Lan, X. Genetic Variations within the Bovine CRY2 Gene Are Significantly Associated with Carcass Traits. Animals 2022, 12, 1616. [Google Scholar] [CrossRef]
- Zhang, K.; Mi, F.; Li, X.; Wang, Z.; Jiang, F.; Song, E.; Guo, P.; Lan, X. Detection of Genetic Variation in Bovine CRY1 Gene and Its Associations with Carcass Traits. Anim. Biotechnol. 2022, 34, 3387–3394. [Google Scholar] [CrossRef]
- Zheng, B.; Albrecht, U.; Kaasik, K.; Sage, M.; Lu, W.; Vaishnav, S.; Li, Q.; Sun, Z.S.; Eichele, G.; Bradley, A.; et al. Nonredundant Roles of the mPer1 and mPer2 Genes in the Mammalian Circadian Clock. Cell 2001, 105, 683–694. [Google Scholar] [CrossRef] [PubMed]
- Gao, Y.; Huang, B.; Bai, F.; Wu, F.; Zhou, Z.; Lai, Z.; Li, S.; Qu, K.; Jia, Y.; Lei, C.; et al. Two Novel SNPs in RET Gene Are Associated with Cattle Body Measurement Traits. Animals 2019, 9, 836. [Google Scholar] [CrossRef] [PubMed]
- Zhao, H.; He, S.; Zhu, Y.; Cao, X.; Luo, R.; Cai, Y.; Xu, H.; Sun, X. A Novel 29 Bp Insertion/Deletion (Indel) Variant of the <I>LHX3</I> Gene and Its Influence on Growth Traits in Four Sheep Breeds of Various Fecundity. Arch. Anim. Breed. 2017, 60, 79–85. [Google Scholar] [CrossRef][Green Version]
- Nei, M. Analysis of Gene Diversity in Subdivided Populations. Proc. Natl. Acad. Sci. USA 1973, 70, 3321–3323. [Google Scholar] [CrossRef] [PubMed]
- He, L.; Bi, Y.; Wang, R.; Pan, C.; Chen, H.; Lan, X.; Qu, L. Detection of a 4 Bp Mutation in the 3′UTR Region of Goat Sox9 Gene and Its Effect on the Growth Traits. Animals 2020, 10, 672. [Google Scholar] [CrossRef]
- Zhou, Q.; Hu, H.; Yang, Y.; Kang, Y.; Lan, X.; Wu, X.; Guo, Z.; Pan, C. Insertion/Deletion (Indel) Variant of the Goat RORA Gene Is Associated with Growth Traits. Anim. Biotechnol. 2023, 34, 2175–2182. [Google Scholar] [CrossRef] [PubMed]
- Fu, L.; Patel, M.S.; Bradley, A.; Wagner, E.F.; Karsenty, G. The Molecular Clock Mediates Leptin-Regulated Bone Formation. Cell 2005, 122, 803–815. [Google Scholar] [CrossRef] [PubMed]
- Zhang, T.; Liu, M.; Yang, Y.; Wang, K.; Zhao, H.; Pan, C. An Upstream Deletion Polymorphism within the Goat Period Circadian Regulator 1 (PER1) Gene Was Associated with Growth Traits. Anim. Biotechnol. 2023, 34, 819–824. [Google Scholar] [CrossRef] [PubMed]
- Ko, C.H.; Takahashi, J.S. Molecular Components of the Mammalian Circadian Clock. Hum. Mol. Genet. 2006, 15, R271–R277. [Google Scholar] [CrossRef]
- Dunlap, J.C. Molecular Bases for Circadian Clocks. Cell 1999, 96, 271–290. [Google Scholar] [CrossRef] [PubMed]
- Dall’Ara, I.; Ghirotto, S.; Ingusci, S.; Bagarolo, G.; Bertolucci, C.; Barbujani, G. Demographic History and Adaptation Account for Clock Gene Diversity in Humans. Heredity 2016, 117, 165–172. [Google Scholar] [CrossRef] [PubMed]
- Zhao, L.; Zhang, D.; Li, X.; Zhang, Y.; Zhao, Y.; Xu, D.; Cheng, J.; Wang, J.; Li, W.; Lin, C.; et al. Comparative Proteomics Reveals Genetic Mechanisms of Body Weight in Hu Sheep and Dorper Sheep. J. Proteom. 2022, 267, 104699. [Google Scholar] [CrossRef] [PubMed]
- Shaul, O. How Introns Enhance Gene Expression. Int. J. Biochem. Cell Biol. 2017, 91, 145–155. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Guo, X.-J.; Li, H.-Y.; Gou, P. Characteristics of Inositol Phosphorylceramide Synthase and Effects of Aureobasidin A on Growth and Pathogenicity of Botrytis Cinerea. J. Gen. Appl. Microbiol. 2015, 61, 108–116. [Google Scholar] [CrossRef]
Genes | Variant ID | Primer Names | Primer Sequences (5′–3′) | Product Sizes (bp) | Notes |
---|---|---|---|---|---|
PER3 | rs600537720 | P4-Ins-22-bp | F: CAATTTCCCATGATACATAC R: TCAGCTTTACATTAGTCCTT | 168 | Polymorphism |
CLOCK | rs604230640 | P13-Del-12-bp | F: AGTTCTGTGGGTGAAAGTAT R: AGGCTGAACATTCTCCATTA | 126 | Polymorphism |
Breeds | Loci | Sizes | Genotypic Frequencies | Allelic Frequencies | Population Parameters | HWE | ||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
N | II | ID | DD | I | D | Ho | He | Ne | PIC | p-Value | ||
HS | P13-Del-12-bp | 192 | 0.344 | 0.609 | 0.047 | 0.648 | 0.352 | 0.544 | 0.456 | 1.839 | 0.352 | 0.649 |
TS | P13-Del-12-bp | 156 | 0.417 | 0.468 | 0.115 | 0.651 | 0.349 | 0.546 | 0.454 | 1.833 | 0.351 | 0.647 |
STHS | P13-Del-12-bp | 173 | 0.665 | 0.260 | 0.075 | 0.795 | 0.205 | 0.674 | 0.326 | 1.484 | 0.273 | 0.507 |
LTHS | P13-Del-12-bp | 57 | 0.456 | 0.491 | 0.052 | 0.702 | 0.298 | 0.582 | 0.418 | 1.719 | 0.331 | 0.609 |
Breeds | Loci | Sizes | Genotypic Frequencies | Allelic Frequencies | Population Parameters | HWE | ||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
N | II | ID | DD | I | D | Ho | He | Ne | PIC | p-Value | ||
HS | P4-Ins-22-bp | 192 | 0.510 | 0.385 | 0.104 | 0.703 | 0.297 | 0.583 | 0.418 | 1.717 | 0.330 | 0.608 |
TS | P4-Ins-22-bp | 156 | 0.731 | 0.244 | 0.026 | 0.853 | 0.147 | 0.749 | 0.250 | 1.335 | 0.219 | 0.417 |
STHS | P4-Ins-22-bp | 173 | 0.557 | 0.305 | 0.138 | 0.699 | 0.301 | 0.579 | 0.421 | 1.727 | 0.332 | 0.612 |
LTHS | P4-Ins-22-bp | 57 | 0.579 | 0.351 | 0.070 | 0.754 | 0.246 | 0.629 | 0.371 | 1.590 | 0.302 | 0.558 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, Z.; Yi, X.; Yang, M.; Sun, X.; Wang, S. Detection of Insertion/Deletions (InDel) Within Five Clock Genes and Their Associations with Growth Traits in Four Chinese Sheep Breeds. Vet. Sci. 2025, 12, 39. https://doi.org/10.3390/vetsci12010039
Wang Z, Yi X, Yang M, Sun X, Wang S. Detection of Insertion/Deletions (InDel) Within Five Clock Genes and Their Associations with Growth Traits in Four Chinese Sheep Breeds. Veterinary Sciences. 2025; 12(1):39. https://doi.org/10.3390/vetsci12010039
Chicago/Turabian StyleWang, Ziteng, Xiaohua Yi, Mengzhe Yang, Xiuzhu Sun, and Shuhui Wang. 2025. "Detection of Insertion/Deletions (InDel) Within Five Clock Genes and Their Associations with Growth Traits in Four Chinese Sheep Breeds" Veterinary Sciences 12, no. 1: 39. https://doi.org/10.3390/vetsci12010039
APA StyleWang, Z., Yi, X., Yang, M., Sun, X., & Wang, S. (2025). Detection of Insertion/Deletions (InDel) Within Five Clock Genes and Their Associations with Growth Traits in Four Chinese Sheep Breeds. Veterinary Sciences, 12(1), 39. https://doi.org/10.3390/vetsci12010039