Next Article in Journal
Rearing in a Physically Enriched Environment Affects Shoaling and Stress Responses of Zebrafish (Danio rerio) Exposed to Novel Conditions
Previous Article in Journal
A New Graphical Method for Displaying Two-Dimensional Echocardiography Results in Dogs: Comprehensive Analysis of Results of Diagnostic Imaging Organized in a BOX (CARDIOBOX)
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Detection of Insertion/Deletions (InDel) Within Five Clock Genes and Their Associations with Growth Traits in Four Chinese Sheep Breeds

1
College of Animal Science and Technology, Northwest A&F University, Yangling 712100, China
2
College of Grassland Agriculture, Northwest A&F University, Yangling 712100, China
*
Author to whom correspondence should be addressed.
Vet. Sci. 2025, 12(1), 39; https://doi.org/10.3390/vetsci12010039
Submission received: 28 November 2024 / Revised: 30 December 2024 / Accepted: 7 January 2025 / Published: 9 January 2025
(This article belongs to the Section Veterinary Biomedical Sciences)

Simple Summary

Circadian clock genes are involved in and regulate many physiological processes in an organism. It is advantageous to find the potential molecular markers that are associated with the growth and development of sheep through molecular breeding. In this study, 23 loci of five clock genes were detected in four Chinese sheep breeds. We found two loci of the CLOCK gene and PER3 genes, respectively, which were significantly associated with sheep growth traits. In conclusion, the two molecular markers in CLOCK and PER3 could potentially be used for marker-assisted selection of growth traits in local Chinses sheep breeds. These novel findings may provide a theoretical basis for molecular breeding and genetic selection of sheep.

Abstract

Organisms have the capacity to detect day–night fluctuations through oscillators regulated by circadian clock genes, which are crucial for regulating various biological processes. Numerous studies have demonstrated a marked association between these genes and various growth traits of sheep. This study identified polymorphisms at 23 potential loci within five clock genes in four Chinese sheep breeds. Only two polymorphic insertion/deletions (InDels) were detected in CLOCK and PER3 genes, respectively. The distribution of these two loci in four Chinese sheep breeds and their association with growth traits were further explored. A 12 bp deletion was found in the intron of the CLOCK gene (rs604230640), which was significantly associated with body height (p < 0.05), body oblique length (p < 0.05) and cannon girth (p < 0.05) in Hu sheep (HS). A 22 bp insertion in the intron of the PER3 gene (rs600537720) with a dominant genotype of insertion/insertion (II) was found to have a significant association with chest depth (p < 0.05) in Small-Tail Han sheep (STHS), tail width (p < 0.05) in Tong Sheep (TS), and in Lanzhou fat-tailed sheep (LFTS). In conclusion, this study has elucidated the polymorphisms of CLOCK and PER3 genes and has examined the influence of these two genes on the growth traits of sheep. Concurrently, the two molecular markers identified in CLOCK and PER3 could potentially serve in the marker-assisted selection of growing-related traits in local Chinese sheep breeds.

1. Introduction

Growth traits, which are key phenotypic traits reflecting growth, body structure, and the development of tissues and organs, are crucial indicators of the growth and development of meat sheep. These traits are closely associated with production performance, disease resistance and livestock adaptability [1]. Investigating the growth and development of sheep to improve the productivity and efficiency of mutton production is essential for bolstering the competitiveness of the meat sheep industry [2,3].
Nowadays, classical breeding methods are supported by various molecular genetics tools to accelerate the achievement of breeding goals [4]. An InDel locus can produce a polymorphism marker with a certain length, and it is one of the most abundant variation types in animal and plant genomes [5]. It has been demonstrated in numerous studies that Indel polymorphisms are associated with growth traits in domestic animals [6,7,8,9]. Marker-assisted selection (MAS) is an alternative to DNA mutations, which is independent of the microenvironment [10]. InDel genetic markers are numerous, accurate and highly stable, and they also have STR and SNP characteristics. Among the main genetic variants, InDel detection is the most convenient, as it does not require special equipment or technical conditions. Molecular marker technology is continuously evolving, and is addressing the shortcomings of traditional breeding methods, such as a long cycle and the unstable inheritance of good traits. Consequently, breeding improvement can be advanced more effectively. Additionally, InDel detection is widely used in the screening of key economic traits in animals [11]. Based on the feasibility of this detection, we could use the MAS method to continue to improve the growth traits of the Chinese sheep population.
Sheep have long been an important part of the global agricultural economy [12]. There are abundant local sheep breeds in China. Tong sheep (TS), Hu sheep (HS), Small-Tail Han sheep (STHS) and Lanzhou fat-tailed sheep (LFTS) are all representative breeds of high-quality sheep. Some previous studies indicated that Mongolian sheep were the origin of these four sheep [13,14]. Tong sheep, a breed of fat-tailed sheep in China, are distinguished by their high-quality mutton, semi fine wool, and pearl-like suede. The fat-tailed characteristic makes it highly adaptable to harsh environments [15]. Lanzhou fat-tailed sheep, an excellent sheep breed with good meat productivity, crude feed tolerance, and high disease resistance, are mainly distributed in Gansu province [16]. Hu sheep have a number of excellent characteristics, such as good meat quality, hyper-prolificacy, and beautiful wavy lambskins. Nowadays, the breed has developed breed-specific features and is distributed across almost all of China [17]. Small-tailed Han sheep, the typical mutton breed in northern China, are known for their high lambing rate, good quality of fur and meat, and strong resistance to diseases [18]. It is worth noting that sheep can not only produce economic products such as mutton, wool, milk and sheep skin, but can also be used as a large circadian animal model for medical research [19].
In mammals, the circadian clock is composed of the central clock in the suprachiasmatic nucleus (SCN) of the brain and peripheral clocks found throughout nearly every tissue and organ system. The core clock genes primarily consist of clock gene encoding positive regulators (circadian locomotor output cycles kaput, CLOCK), hydrocarbon receptor nuclear translocation protein-like 1 gene (brain and muscle Arnt-like 1, BMAL1), cycle gene encoding negative regulators (period, PER) and the cryptochrome gene (cryptochrome, CRY) [20]. The CLOCK gene includes a protein, known as CLOCK, which engages in interactions with various other proteins, notably BMAL1, for the purpose of governing the circadian rhythm. In concert, these proteins adhere to distinct sections of DNA, thereby aiding in the regulation of the functionality of other genes. This orchestration instigates oscillations in protein levels, ultimately contributing to forming a stable cycle within the organism [21,22,23]. The synchronized expression of circadian genes is essential for the organization of the 24-hr cycle [24]. Chen et al. found significant age-dependent rhythmic expression of the PER1 and PER2 gene in the prehuman prefrontal cortex [25].
Circadian clocks are typically expressed in proliferating tissues, including the oral cavity, gastrointestinal mucosa, skin, and bone marrow [26]. Extensive research has been conducted on the relationship between ovine circadian genes and reproductive performance, indicating that these genes regulate hormone secretion, metabolism, growth, and reproduction in sheep [27]. CLOCK and PER3 genes are core clock genes that play pivotal roles in skeletal and muscle development, as well as other growth and developmental processes [28,29,30,31,32]. The CRY2 gene was closely associated with reproductive performance and carcass traits in sheep. Variations in the CRY2 gene was significantly associated with the number of lambs born in the first and third litters of Australian white sheep [33]. Recent studies have suggested that the CRY2 gene variant was significantly related to 12 carcass traits, including gross weight, ribeye, high rib, thick flank [34]. Polymorphisms in the CRY1 InDel locus were significantly associated with twenty carcass traits, such as slaughter weight, limb weight, and belly meat weight [35]. Furthermore, Zhou et al. found that the circadian clock RORα in skeletal muscle regulates growth and development, and was significantly correlated with body height, hip cross height, and body length [36].
Our study aims to identify potential InDels of the CLOCK, PER2, PER3, CRY1, and CRY2 genes in four Chinese sheep breeds, and to further analyze their correlation with sheep growth traits. The purpose is to provide a relevant theoretical basis for breeding sheep breeds with excellent growth performance.

2. Materials and Methods

2.1. Ethics Statement

The animal protocols and experimental design adhere to local animal welfare legislation and institutional guidelines. Furthermore, the use of animal testing received approval from the Institutional Animal Care and Use Committee at Northwest A & F University (IACUC-NWAFU) in China.

2.2. Animal Samples, Data Collection, DNA Extraction and Genomic DNA Pools Construction

A comprehensive evaluation was conducted involving a total of 578 samples derived from four local sheep breeds. The breeds examined include Tong sheep (TS), Hu sheep (HS), Small-Tail Han sheep (STHS), and Lanzhou fat-tail sheep (LFTS). Blood samples and body measurements were obtained from four local sheep breeds. All animals utilized were adults, in good health, and unrelated. All animals within a given breed were managed in the same way, and an adequate supply of feed was ensured based on the total metabolic rate (TMR). The growth traits of the sheep were measured, utilizing the measuring tape, including body weight, body height, body oblique length, rump width, sacrum height, back height, hip height, chest depth, chest girth, cannon girth, cross height and so on. Additionally, blood samples were aseptically obtained from the jugular vein of all individuals using EDTA vacutainers. Subsequently, genomic DNA was extracted from the collected blood samples, and the quality and purity of the extracted DNA were assessed using a Nano Drop 10,000 (Thermo Scientific, Waltham, MA, USA). All DNA samples were diluted to 50 ng/µL and subsequently stored at a temperature of −20 °C, as outlined by Gao et al. [37]. The DNA mixture was generated through the random selection of 20 individuals from each breed, ensuring that the DNA was combined in equal proportions.

2.3. Primer Design, PCR Amplification, and InDel Genotyping

The primer design for gene amplification was based on the National Center for Biotechnology Information (NCBI) database’s sheep genome sequences: NC_056059.1 (CLOCK, chromosome 6), NC_056065.1 (PER3, chromosome 12), NC_056054.1 (PER2, chromosome 1), NC_056056.1 (CRY1, chromosome 3) and NC_056068.1 (CRY2, chromosome 15), of the sheep genome (Ovis aries). All primers for InDels of circadian clock genes in essential positions were designed by the NCBI primer-blast (Primer designing tool (nih.gov)). They were produced by Biotech Bioengineering Co. (Shanghai, China). For the PCR, we used 15 μL of the reaction mixture, containing 7.5 μL of 2× San Tap PCR Mix, 1.0 μL of each primer (forward and reverse primer), 0.5 μL of DNA template, and 6 μL of ddO. A touch-down PCR cycling was run for each mixture: initial denaturation at 95 °C for 5 min; followed by 15 cycles of 30 s at 95 °C, 30 s at 60 °C, and 30 s at 72 °C; followed by another 25 cycles of 30 s at 95 °C, 30 s at 53 °C, and 30 s at 72 °C, with a final extension step of 10 min at 72 °C. Subsequently, the PCR products were identified by electrophoresis on a 3.0% agarose gel at 150 V, 200 mA, and 1–1.5 h. The sequencing of PCR products was performed by Biotech Bioengineering Co. (Shanghai, China).

2.4. Statistical Analysis of Population Genetics

Microsoft Excel software was used to collate all individual genotypes at each site and calculate genotype frequency and allele frequency. The Sanger Atlas sequence data and the reference genome were compared with Bioedi [38]. The Hardy–Weinberg equilibrium (HWE), homozygosity (Ho), heterozygosity (He), effective allele numbers (Ne), and polymorphism information content (PIC) were calculated using the online website http://www.Msrcall.com (accessed on 26 July 2022) [39,40]. Chi-squared tests of different genotypic frequencies and breeds were performed by “χ2 calculator”. According to the statistical results, one-way analysis of variance (ANOVA) was performed to analyze the association between body measurements and different genotypes of four sheep breeds using SPSS 25.0 software. The above results were displayed as “mean ± standard error” (Mean ± SE). p < 0.05 indicated that the difference was significant, and p < 0.01 indicated that the difference was extremely significant. The Bonferroni test was performed for multiple comparisons.

3. Results

3.1. Indel Genotyping and Sequencing

Two InDel loci were confirmed from 23 potential loci within five genes (CLOCK, PER2, PER3, CRY1 and CRY2) using 3% gel electrophoresis and Sanger sequencing (Table S1). One InDel locus was detected in CLOCK on chromosome 6 (P13-Del-12-bp) and one InDel locus was identified in PER3 on chromosome 12 (P4-Ins-22-bp) (Table 1). Sanger sequencing revealed that 12 bases were missing in CLOCK, which is located at NC_056059.1 g. 70984174-70984185, with the missing bases ATTATAGCTTAA. At the PER3 locus, 22 bases were inserted at NC_056065.1 g. 43698000-43698021, and the inserted bases were GACATGTTATTATATTGATCCA (Figure 1, Figure 2 and Figure 3). Both InDel loci are located in the intronic regions of the genes. The other 21 InDel loci showed no polymorphism in HS, TS, STHS, and LFTS.

3.2. Genetic Polymorphism Analysis of CLOCK Gene in Hu Sheep, Tong Sheep, Small-Tail Han Sheep, and Lanzhou Fat-Tailed Sheep

The genotypic and allelic frequencies, as well as other genetic parameters, associated with the CLOCK gene InDel locus, were calculated to determine the genotype distribution in HS, TS, STHS, and LFTS (Table 2). However, only HS had the CLOCK 12-bp deletion mutation.
As can be seen from the data, in these four breeds, the “I” allele was more frequent than the “D” allele. Additionally, the PIC in HS, TS, STHS, and LFTS were 0.352, 0.351, 0.273, and 0.331, respectively, which demonstrated a moderate degree of polymorphism (0.25 < PIC < 0.5), indicating that the polymorphism of the CLOCK gene is substantial. The P13-Del-12-bp locus was in HWE (p > 0.05).

3.3. Genetic Polymorphism Analysis of PER3 Gene in Hu Sheep, Tong Sheep, Small-Tail Han Sheep, and Lanzhou Fat-Tailed Sheep

The genotype and allele frequencies and other genetic parameters associated with the PER3 gene InDel locus were calculated (Table 3). TS, STHS, and LFTS had the PER3 22-bp insertion mutation. In these four breeds, the frequency of the II genotype was observed to be higher compared to the other genotypes. In addition, the allele frequency of “I” was more frequent than that of “D”. The frequency of the II genotype in TS was observed to be greater than that in the three other evaluated breeds. Moreover, the 22 bp InDel genotype frequency was found to be in accordance with HWE (p > 0.05) in HS, TS, STHS, and LTHS. Based on PIC values, genetic diversity was low in TS (PIC = 0.219), whereas moderate in HS, STHS, and LFTS (0.25 < PIC < 0.5).

3.4. Association Analysis of Growth Traits in Hu Sheep with the CLOCK Gene

The results of the sequencing showed that only HS had the CLOCK 12-bp deletion mutation. Therefore, an association study was performed to assess the effect of polymorphism on growth traits in HS. In Hu sheep, the 12-bp InDel of CLOCK was significantly associated with body height, body oblique length and cannon girth traits (p = 0.015, p = 0.029, and p = 0.021; Figure 4). The body oblique length and cannon girth traits of DD genotypes were greater than in the ID and II genotypes.

3.5. Association Analysis of Growth Traits in Tong Sheep and Small-Tail Han Sheep with the PER3 Gene

The results of sequencing showed that the 22-bp insertion loci of PER3 were detected in TS and STHS. Subsequently, the association between the PER3 InDel locus and the growth traits of TS and STHS were examined. We conducted a series of experiments, and we propose that the 22-bp InDel of PER3 was significantly associated with tail width in TS (p = 0.012, Figure 5) and chest depth in STHS (p = 0.001, Figure 6). TS, with the DD genotype, had greater tail width than those with the ID and II genotypes. Notably, in STHS, the II genotype had greater chest depth than those with the ID and DD genotypes.

4. Discussion

Our study shows that InDels of the core clock genes CLOCK and PER3 were identified for the first time in four Chinese sheep breeds using sequencing technology. Due to the precision and stability of InDel markers, the CLOCK and PER3 genes can be considered as key genes for affecting growth traits in sheep. This result provides a valuable reference for genetic breeding improvement in sheep.
Existing research indicates that the clock gene RORα in skeletal muscle regulates growth and development, and that this gene is significantly associated with body height, hip cross height, and body length. The clock gene RORα, which encodes ROR, is present in skeletal muscle. According to a study, the P11-28-bp deletion fragment of the RORα gene in goats was significantly associated with body length, hip cross height, and body height [41]. Bone remodeling is a homeostatic function [24], suggesting that the circadian clock could control bone mass. Mice lacking PER and CRY, or lacking PER genes in osteoblasts, display high bone mass [42]. The 9 bp deletion fragment of PER1 gene in sheep was associated with body height, cross height, chest depth, body length index, and cannon girth [43]. In mammals, it has been proved that the variation of circadian clock genes affect growth in mice. Current research on circadian clock genes in sheep focus primarily on reproductive performance and lamb skin quality, while correlation analysis of growth traits has received less attention.
To demonstrate the relationship between clock genes and growth traits, we conducted genotyping for PER2, PER3, CRY1, CRY2 and CLOCK in four local sheep breeds. However, we only identified polymorphic loci in the PER3 and CLOCK genes. The results indicated that there was a 12-bp deletion (P13-Del-12-bp) of CLOCK in HS and a 22-bp insertion (P4-Ins-22-bp) of PER3 in TS, STHS and LTHS. The polymorphic loci of the core circadian clock genes were less typed on 578 sheep in this experiment. We analyzed that this is because most of the core components of the molecular clock maintain rhythmicity in the SCN and peripheral tissues [44]. In some instances, the circadian system genes are evolutionarily conserved [45]. Many biological processes exhibit regular fluctuations throughout the 24-h day, while almost all tissues and organs coordinate such fluctuations and shows a stable state [46]. For instance, in the absence of environmental cues (such as light), the clock can continue to operate with exceptional precision, stability, and persistence [36].
The P13-Del-12-bp locus of CLOCK was detected in four breeds, but after ANOVA analysis of the growth traits of these four breeds, it was found that it was only significantly associated with body height, body oblique length and cannon girth traits in HS (p < 0.05). The body height and cannon girth of individuals with DD and ID genotypes were significantly greater than those with the II genotype, and the body oblique length of the DD genotype was larger than that of the ID and II genotype, which suggested that the deletion of this segment could improve the growth and development rate of HS. However, the number of DD genotype individuals is the smallest, which suggests that the selection of HS is a preference for thin-bone type individuals. HS are mostly breeding ewes, so the selection of reproductive performance may ignore the selection of growth traits. There was no significant association between the P13-Del-12-bp locus and the growth traits of TS and STHS. It is evident that the InDel locus within the same gene varies across different sheep breeds, indicating that the gene is breed specific.
The P4-Ins-22-bp locus of PER3 in TS and the tail width of II and DD genotypes were significantly higher than that of the ID genotype (p < 0.05), while the chest depth of the II and DD genotypes in STHS were significantly higher than that of the type ID genotype (p < 0.01), with no significant association with growth traits in Hu sheep (p > 0.05). By analyzing the effect of tail width on TS, the tail width with the DD genotype was greater than that with the ID and II genotypes. It can be inferred that the insertion of this segment may cause the growth of TS to be slow. When analyzed together with the data from the STHS, it was found that the chest depth of the II genotype was greater than that of the ID and DD genotypes, indicating that the insertion of this segment promotes the growth and development of STHS. The P4-Ins-22-bp locus has opposite effects on tail width in TS and STHS, once again confirming the species specificity of the gene.
In this study, these two loci were in Hardy–Weinberg equilibrium (HWE), demonstrating that our sample of four local sheep breeds was sufficiently robust. This indicates that the majority of loci in the sheep of these four breeds remain in dynamic equilibrium under the influence of artificial selection, migration, and genetic drift, exhibiting moderate polymorphism and high adaptability in the face of environmental changes and thereby ensuring that the study samples are representative of the populations. The dependability of the study sample enables the next step of association with growth traits in sheep [15]. On the other hand, the expected heterozygosity (He) describes the expected number of heterozygous genotypes under Hardy–Weinberg equilibrium and serves as an indicator of genetic variation in a population. Additionally, the number of effective alleles (Ne) and the polymorphic information content (PIC) can also be used to assess the genetic diversity of a population [11]. The P13-Del-12-bp InDel locus in HS, STHS, and LTHS, and the P4-Ins-22-bp InDel locus in four sheep showed moderate genetic polymorphisms (0.25 < PIC < 0.5). The greater the value, the richer the genetic diversity of the population, and the corresponding potential for selection will be greater. Our data showed that the P1-Del-12-bp locus of the CLOCK gene had high genetic diversity in HS, which could be attributed to the introduction of HS from south to north, as well as its high genetic diversity due to a diverse geographic environment and long-term breeding adaptation [47]. Apart from this, the PIC value indicated that the P4-Ins-22-bp locus on TS was 0.219, and exhibited low genetic polymorphisms (PIC < 0.25). We infer that the TS of this test may not have been subjected to extensive breeding selection. (Table 2 and Table 3). Regarding the limitation of this, it could be argued that the long-term isolation of the TS with more inbreeding and limited genetic interactions resulted in a unique genetic background and lower genetic diversity, resulting in a relatively homogeneous pedigree. Based on this, it is suggested that we should increase the selection intensity of the PER3 gene associated with growth traits of TS and increase the population of TS.
The five InDel loci associated with growth traits in HS, TS, and STH, as identified in this experiment, were all located in the intronic region of the genes. Introns enable genes to produce a variety of different splicing modes. In eukaryotes, there are many cis-acting elements in introns. These elements are involved in transcriptional regulation and play a role as promoters, enhancers or suppressors. In recent years, there have been several demonstrations of the ability of introns to enhance gene expression in a variety of organisms, including animals, plants and microorganisms [48]. Concurrently, introns can not only accelerate the rate of transcription and translation, but also exert a repressive influence on the expression of some genes [49]. This can explain the disparate effects of the identical InDel loci on the growth traits of the four breeds of sheep in this experiment. It is also postulated that the insertion or deletion of the InDel loci altered the sequence of the introns, which in turn affected the rate of transcription and translation of the genes, and thus played a role in affecting the growth and development of sheep. A limitation of this study is that there were only 57 LTHS, as this breed is mainly distributed in Gansu province. Due to the limited amount of breeding and the plan of conservation programs for LTHS, the sample size we collected was relatively small, which may mean that the sequencing results for LTHS are not very representative [13]. However, it is undeniable that this study provides direction and a reference basis for further in-depth exploration of the molecular mechanism of clock genes affecting sheep growth traits.

5. Conclusions

In conclusion, our study demonstrated that the 12 bp InDel of the CLOCK gene was significantly associated with body height, body oblique length and cannon girth in Hu sheep. The 22 bp InDel of the PER3 gene was significantly associated with tail width in Tong sheep and chest depth in Small-Tail Han sheep. These findings suggest that the CLOCK and PER3 genes could be used as candidate genes for genetic breeding of sheep growth, providing a theoretical foundation and support for sheep selection and conservation purposes.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/vetsci12010039/s1, Table S1: PCR primer sequences of the sheep CLOCK genes.

Author Contributions

S.W. was in charge of the whole trial. X.S. designed the experiments. Z.W. completed the majority of the experiments and was a major contributor to write the manuscript. X.Y. revised and improved the manuscript. M.Y. participated in sampling and laboratory analyses. All authors have read and agreed to the published version of the manuscript.

Funding

This research was financially supported by the Ministry of Agriculture and Rural Affairs, PRCG government Purchase Service Plan (19240890), and Undergraduate Innovation and Entrepreneurship Training Program (202210712116).

Institutional Review Board Statement

The animal protocols and experimental design are conducted by local animal welfare laws and institutional guidelines. Additionally, animal testing was approved by the Institutional Animal Care and Use Committee of Northwest A&F University (IACUC-NWAFU), in China.

Informed Consent Statement

Informed consent was obtained from all of the animals owners.

Data Availability Statement

Data are contained within this manuscript and Supplementary Materials.

Acknowledgments

We are thankfully for all the teachers and students of Innovative Research Term of Economic Animal Healthy Feeding and Grass Products & Animal Herbage System Lab of Northwest A&F University for their cooperation and support.

Conflicts of Interest

The authors declare that no ethical conflicts of interest or significant financial support could have appeared edition fluence the work reported in this paper.

References

  1. Tao, L.; Liu, Y.F.; Zhang, H.; Li, H.Z.; Zhao, F.P.; Wang, F.Y.; Zhang, R.S.; Di, R.; Chu, M.X. Genome-wide Association Study and Inbreeding Depression on Body Size Traits in Qira Black Sheep (Ovis aries). Anim. Genet. 2021, 52, 560–564. [Google Scholar] [CrossRef]
  2. Dawut, A.; Tian, Y. Competitiveness of Xinjiang’s Mutton Industry Based on Diamond Model. PLoS ONE 2021, 16, e0257669. [Google Scholar] [CrossRef] [PubMed]
  3. Montossi, F.; Font-i-Furnols, M.; Del Campo, M.; San Julián, R.; Brito, G.; Sañudo, C. Sustainable Sheep Production and Consumer Preference Trends: Compatibilities, Contradictions, and Unresolved Dilemmas. Meat Sci. 2013, 95, 772–789. [Google Scholar] [CrossRef] [PubMed]
  4. Grochowska, E.; Lisiak, D.; Akram, M.Z.; Adeniyi, O.O.; Lühken, G.; Borys, B. Association of a Polymorphism in Exon 3 of the IGF1R Gene with Growth, Body Size, Slaughter and Meat Quality Traits in Colored Polish Merino Sheep. Meat Sci. 2021, 172, 108314. [Google Scholar] [CrossRef] [PubMed]
  5. Hyten, D.L.; Cannon, S.B.; Song, Q.; Weeks, N.; Fickus, E.W.; Shoemaker, R.C.; Specht, J.E.; Farmer, A.D.; May, G.D.; Cregan, P.B. High-Throughput SNP Discovery through Deep Resequencing of a Reduced Representation Library to Anchor and Orient Scaffolds in the Soybean Whole Genome Sequence. BMC Genom. 2010, 11, 38. [Google Scholar] [CrossRef] [PubMed]
  6. Wu, M.; Zhao, H.; Tang, X.; Li, Q.; Yi, X.; Liu, S.; Sun, X. Novel InDels of GHR, GHRH, GHRHR and Their Association with Growth Traits in Seven Chinese Sheep Breeds. Animals 2020, 10, 1883. [Google Scholar] [CrossRef]
  7. Yi, X.; He, S.; Wang, S.; Zhao, H.; Wu, M.; Liu, S.; Pan, Y.; Zhang, Y.; Sun, X. Expression of Different Genotypes of Bovine TRDMT1 Gene and Its Polymorphisms Association with Body Measures in Qinchuan Cattle (Bos taurus). Anim. Biotechnol. 2023, 34, 574–584. [Google Scholar] [CrossRef]
  8. Yi, X.; He, S.; Wang, S.; Zhao, H.; Wu, M.; Liu, S.; Sun, X. Detection of Genetic Variation and Activity Analysis of the Promoter Region of the Cattle tRNA-Modified Gene TRDMT1. Arch. Anim. Breed. 2021, 64, 147–155. [Google Scholar] [CrossRef] [PubMed]
  9. Zhao, H.; Wu, M.; Yi, X.; Tang, X.; Chen, P.; Wang, S.; Sun, X. Functional Analysis of Haplotypes in Bovine PSAP Gene and Their Relationship with Beef Cattle Production Traits. Animals 2020, 11, 49. [Google Scholar] [CrossRef] [PubMed]
  10. Xin, D.; Bai, Y.; Bi, Y.; He, L.; Kang, Y.; Pan, C.; Zhu, H.; Chen, H.; Qu, L.; Lan, X. Insertion/Deletion Variants within the IGF2BP2 Gene Identified in Reported Genome-Wide Selective Sweep Analysis Reveal a Correlation with Goat Litter Size. J. Zhejiang Univ. Sci. B 2021, 22, 757–766. [Google Scholar] [CrossRef]
  11. Wang, W.; La, Y.; Zhou, X.; Zhang, X.; Li, F.; Liu, B. The Genetic Polymorphisms of TGFβ Superfamily Genes Are Associated with Litter Size in a Chinese Indigenous Sheep Breed (Hu Sheep). Anim. Reprod. Sci. 2018, 189, 19–29. [Google Scholar] [CrossRef] [PubMed]
  12. Tao, L.; He, X.Y.; Pan, L.X.; Wang, J.W.; Gan, S.Q.; Chu, M.X. Genome-wide Association Study of Body Weight and Conformation Traits in Neonatal Sheep. Anim. Genet. 2020, 51, 336–340. [Google Scholar] [CrossRef]
  13. Zhao, Y.; Zhao, E.; Zhang, N.; Duan, C. Mitochondrial DNA Diversity, Origin, and Phylogenic Relationships of Three Chinese Large-Fat-Tailed Sheep Breeds. Trop. Anim. Health Prod. 2011, 43, 1405–1410. [Google Scholar] [CrossRef] [PubMed]
  14. Sun, W.; Chang, H.; Musa Hussein, H.; Liao, X.; Chu, M.; Kija, J. Microsatellite-Based Genetic Differentiation and Phylogeny of Sheep Breeds in Mongolia Sheep Group of China. Agric. Sci. China 2011, 10, 1080–1087. [Google Scholar] [CrossRef]
  15. Wang, S.; Liu, S.; Yuan, T.; Sun, X. Genetic Effects of FTO Gene Insertion/Deletion (InDel) on Fat-Tail Measurements and Growth Traits in Tong Sheep. Anim. Biotechnol. 2021, 32, 229–239. [Google Scholar] [CrossRef] [PubMed]
  16. Li, J.; Xu, H.; Liu, X.; Xu, H.; Cai, Y.; Lan, X. Insight into the Possible Formation Mechanism of the Intersex Phenotype of Lanzhou Fat-Tailed Sheep Using Whole-Genome Resequencing. Animals 2020, 10, 944. [Google Scholar] [CrossRef]
  17. Zhao, F.; Xie, R.; Fang, L.; Xiang, R.; Yuan, Z.; Liu, Y.; Wang, L. Analysis of 206 Whole-genome Resequencing Reveals Selection Signatures Associated with Breed-specific Traits in Hu Sheep. Evol. Appl. 2024, 17, e13697. [Google Scholar] [CrossRef] [PubMed]
  18. Jiao, J.; Wang, T.; Zhou, J.; Degen, A.A.; Gou, N.; Li, S.; Bai, Y.; Jing, X.; Wang, W.; Shang, Z. Carcass Parameters and Meat Quality of Tibetan Sheep and Small-tailed Han Sheep Consuming Diets of Low-protein Content and Different Energy Yields. Anim. Physiol. Nutr. 2020, 104, 1010–1023. [Google Scholar] [CrossRef] [PubMed]
  19. Varcoe, T.J.; Gatford, K.L.; Voultsios, A.; Salkeld, M.D.; Boden, M.J.; Rattanatray, L.; Kennaway, D.J. Rapidly Alternating Photoperiods Disrupt Central and Peripheral Rhythmicity and Decrease Plasma Glucose, but Do Not Affect Glucose Tolerance or Insulin Secretion in Sheep. Exp. Physiol. 2014, 99, 1214–1228. [Google Scholar] [CrossRef] [PubMed]
  20. Hergenhan, S.; Holtkamp, S.; Scheiermann, C. Molecular Interactions Between Components of the Circadian Clock and the Immune System. J. Mol. Biol. 2020, 432, 3700–3713. [Google Scholar] [CrossRef]
  21. Barrett, T.; Troup, D.B.; Wilhite, S.E.; Ledoux, P.; Rudnev, D.; Evangelista, C.; Kim, I.F.; Soboleva, A.; Tomashevsky, M.; Edgar, R. NCBI GEO: Mining Tens of Millions of Expression Profiles—Database and Tools Update. Nucleic Acids Res. 2007, 35, D760–D765. [Google Scholar] [CrossRef] [PubMed]
  22. Gurzov, E.N.; Eizirik, D.L. Bcl-2 Proteins in Diabetes: Mitochondrial Pathways of β-Cell Death and Dysfunction. Trends Cell Biol. 2011, 21, 424–431. [Google Scholar] [CrossRef] [PubMed]
  23. Lin, Y.; Li, J.; Wu, D.; Wang, F.; Fang, Z.; Shen, G. Identification of Hub Genes in Type 2 Diabetes Mellitus Using Bioinformatics Analysis. Diabetes Metab. Syndr. Obes. 2020, 13, 1793–1801. [Google Scholar] [CrossRef] [PubMed]
  24. Boyle, W.J.; Simonet, W.S.; Lacey, D.L. Osteoclast Differentiation and Activation. Nature 2003, 423, 337–342. [Google Scholar] [CrossRef] [PubMed]
  25. Chen, C.-Y.; Logan, R.W.; Ma, T.; Lewis, D.A.; Tseng, G.C.; Sibille, E.; McClung, C.A. Effects of Aging on Circadian Patterns of Gene Expression in the Human Prefrontal Cortex. Proc. Natl. Acad. Sci. USA 2016, 113, 206–211. [Google Scholar] [CrossRef] [PubMed]
  26. Gallego, M.; Virshup, D.M. Post-Translational Modifications Regulate the Ticking of the Circadian Clock. Nat. Rev. Mol. Cell Biol. 2007, 8, 139–148. [Google Scholar] [CrossRef] [PubMed]
  27. Li, H.; Li, K.; Zhang, K.; Li, Y.; Gu, H.; Liu, H.; Yang, Z.; Cai, D. The Circadian Physiology: Implications in Livestock Health. Int. J. Mol. Sci. 2021, 22, 2111. [Google Scholar] [CrossRef]
  28. Huang, Y.; Su, P.; Akhatayeva, Z.; Pan, C.; Zhang, Q.; Lan, X. Novel InDel Variations of the Cry2 Gene Are Associated with Litter Size in Australian White Sheep. Theriogenology 2022, 179, 155–161. [Google Scholar] [CrossRef]
  29. Samsa, W.E.; Vasanji, A.; Midura, R.J.; Kondratov, R.V. Deficiency of Circadian Clock Protein BMAL1 in Mice Results in a Low Bone Mass Phenotype. Bone 2016, 84, 194–203. [Google Scholar] [CrossRef]
  30. Xu, C.; Ochi, H.; Fukuda, T.; Sato, S.; Sunamura, S.; Takarada, T.; Hinoi, E.; Okawa, A.; Takeda, S. Circadian Clock Regulates Bone Resorption in Mice. J. Bone Miner. Res. 2016, 31, 1344–1355. [Google Scholar] [CrossRef] [PubMed]
  31. Yuan, G.; Hua, B.; Yang, Y.; Xu, L.; Cai, T.; Sun, N.; Yan, Z.; Lu, C.; Qian, R. The Circadian Gene Clock Regulates Bone Formation Via PDIA3. J. Bone Miner. Res. 2017, 32, 861–871. [Google Scholar] [CrossRef] [PubMed]
  32. Wu, X.; Xie, C.; Long, C.; Li, J.; Zhou, X.; Fan, Z.; Blachier, F.; Yin, Y. Effects of a Daily Three-meal Pattern with Different Dietary Protein Contents on Pig Growth Performance, Carcass and Muscle Quality Traits. J. Sci. Food Agric. 2018, 98, 415–421. [Google Scholar] [CrossRef] [PubMed]
  33. Cardoso, T.F.; Quintanilla, R.; Tibau, J.; Gil, M.; Mármol-Sánchez, E.; González-Rodríguez, O.; González-Prendes, R.; Amills, M. Nutrient Supply Affects the mRNA Expression Profile of the Porcine Skeletal Muscle. BMC Genom. 2017, 18, 603. [Google Scholar] [CrossRef] [PubMed]
  34. Li, X.; Jiang, E.; Zhang, K.; Zhang, S.; Jiang, F.; Song, E.; Chen, H.; Guo, P.; Lan, X. Genetic Variations within the Bovine CRY2 Gene Are Significantly Associated with Carcass Traits. Animals 2022, 12, 1616. [Google Scholar] [CrossRef]
  35. Zhang, K.; Mi, F.; Li, X.; Wang, Z.; Jiang, F.; Song, E.; Guo, P.; Lan, X. Detection of Genetic Variation in Bovine CRY1 Gene and Its Associations with Carcass Traits. Anim. Biotechnol. 2022, 34, 3387–3394. [Google Scholar] [CrossRef]
  36. Zheng, B.; Albrecht, U.; Kaasik, K.; Sage, M.; Lu, W.; Vaishnav, S.; Li, Q.; Sun, Z.S.; Eichele, G.; Bradley, A.; et al. Nonredundant Roles of the mPer1 and mPer2 Genes in the Mammalian Circadian Clock. Cell 2001, 105, 683–694. [Google Scholar] [CrossRef] [PubMed]
  37. Gao, Y.; Huang, B.; Bai, F.; Wu, F.; Zhou, Z.; Lai, Z.; Li, S.; Qu, K.; Jia, Y.; Lei, C.; et al. Two Novel SNPs in RET Gene Are Associated with Cattle Body Measurement Traits. Animals 2019, 9, 836. [Google Scholar] [CrossRef] [PubMed]
  38. Zhao, H.; He, S.; Zhu, Y.; Cao, X.; Luo, R.; Cai, Y.; Xu, H.; Sun, X. A Novel 29 Bp Insertion/Deletion (Indel) Variant of the &lt;I&gt;LHX3&lt;/I&gt; Gene and Its Influence on Growth Traits in Four Sheep Breeds of Various Fecundity. Arch. Anim. Breed. 2017, 60, 79–85. [Google Scholar] [CrossRef]
  39. Nei, M. Analysis of Gene Diversity in Subdivided Populations. Proc. Natl. Acad. Sci. USA 1973, 70, 3321–3323. [Google Scholar] [CrossRef] [PubMed]
  40. He, L.; Bi, Y.; Wang, R.; Pan, C.; Chen, H.; Lan, X.; Qu, L. Detection of a 4 Bp Mutation in the 3′UTR Region of Goat Sox9 Gene and Its Effect on the Growth Traits. Animals 2020, 10, 672. [Google Scholar] [CrossRef]
  41. Zhou, Q.; Hu, H.; Yang, Y.; Kang, Y.; Lan, X.; Wu, X.; Guo, Z.; Pan, C. Insertion/Deletion (Indel) Variant of the Goat RORA Gene Is Associated with Growth Traits. Anim. Biotechnol. 2023, 34, 2175–2182. [Google Scholar] [CrossRef] [PubMed]
  42. Fu, L.; Patel, M.S.; Bradley, A.; Wagner, E.F.; Karsenty, G. The Molecular Clock Mediates Leptin-Regulated Bone Formation. Cell 2005, 122, 803–815. [Google Scholar] [CrossRef] [PubMed]
  43. Zhang, T.; Liu, M.; Yang, Y.; Wang, K.; Zhao, H.; Pan, C. An Upstream Deletion Polymorphism within the Goat Period Circadian Regulator 1 (PER1) Gene Was Associated with Growth Traits. Anim. Biotechnol. 2023, 34, 819–824. [Google Scholar] [CrossRef] [PubMed]
  44. Ko, C.H.; Takahashi, J.S. Molecular Components of the Mammalian Circadian Clock. Hum. Mol. Genet. 2006, 15, R271–R277. [Google Scholar] [CrossRef]
  45. Dunlap, J.C. Molecular Bases for Circadian Clocks. Cell 1999, 96, 271–290. [Google Scholar] [CrossRef] [PubMed]
  46. Dall’Ara, I.; Ghirotto, S.; Ingusci, S.; Bagarolo, G.; Bertolucci, C.; Barbujani, G. Demographic History and Adaptation Account for Clock Gene Diversity in Humans. Heredity 2016, 117, 165–172. [Google Scholar] [CrossRef] [PubMed]
  47. Zhao, L.; Zhang, D.; Li, X.; Zhang, Y.; Zhao, Y.; Xu, D.; Cheng, J.; Wang, J.; Li, W.; Lin, C.; et al. Comparative Proteomics Reveals Genetic Mechanisms of Body Weight in Hu Sheep and Dorper Sheep. J. Proteom. 2022, 267, 104699. [Google Scholar] [CrossRef] [PubMed]
  48. Shaul, O. How Introns Enhance Gene Expression. Int. J. Biochem. Cell Biol. 2017, 91, 145–155. [Google Scholar] [CrossRef] [PubMed]
  49. Wang, X.; Guo, X.-J.; Li, H.-Y.; Gou, P. Characteristics of Inositol Phosphorylceramide Synthase and Effects of Aureobasidin A on Growth and Pathogenicity of Botrytis Cinerea. J. Gen. Appl. Microbiol. 2015, 61, 108–116. [Google Scholar] [CrossRef]
Figure 1. The position and gene structure map of PER3 (A) and CLOCK (B).
Figure 1. The position and gene structure map of PER3 (A) and CLOCK (B).
Vetsci 12 00039 g001
Figure 2. The electrophoresis pattern and sequence chromatograms of the CLOCK-P13.
Figure 2. The electrophoresis pattern and sequence chromatograms of the CLOCK-P13.
Vetsci 12 00039 g002
Figure 3. The electrophoresis pattern and sequence chromatograms of the PER3-P4.
Figure 3. The electrophoresis pattern and sequence chromatograms of the PER3-P4.
Vetsci 12 00039 g003
Figure 4. Associations of the 12 bp loci within the CLOCK gene with growth traits in Hu Sheep. (A) Body height (cm), (B) Buttocks width (cm), (C) Body oblique length (cm), (D) Chest girth (cm), (E) Cannon girth (cm), (F) Weight (kg).
Figure 4. Associations of the 12 bp loci within the CLOCK gene with growth traits in Hu Sheep. (A) Body height (cm), (B) Buttocks width (cm), (C) Body oblique length (cm), (D) Chest girth (cm), (E) Cannon girth (cm), (F) Weight (kg).
Vetsci 12 00039 g004
Figure 5. Associations of the 22 bp loci within the PER3 gene with growth traits in Tong sheep. (A) Body height (cm), (B) Body length (cm), (C) Recommend height (cm), (D) Back height (cm), (E) Hip height (cm), (F) Thoracic depth (cm), (G) Chest width (cm), (H) Waist angle width (cm), (I) Hip width (cm), (J) Head length (cm), (K) Maximum width (cm), (L) Head depth (cm), (M) Pipe girth (cm), (N) Wool length (cm), (O) Tail length (cm), (P) Tail width (cm).
Figure 5. Associations of the 22 bp loci within the PER3 gene with growth traits in Tong sheep. (A) Body height (cm), (B) Body length (cm), (C) Recommend height (cm), (D) Back height (cm), (E) Hip height (cm), (F) Thoracic depth (cm), (G) Chest width (cm), (H) Waist angle width (cm), (I) Hip width (cm), (J) Head length (cm), (K) Maximum width (cm), (L) Head depth (cm), (M) Pipe girth (cm), (N) Wool length (cm), (O) Tail length (cm), (P) Tail width (cm).
Vetsci 12 00039 g005
Figure 6. Associations of the 22 bp loci within the PER3 gene with growth traits in Small Tail Han Sheep. (A) Body oblique length (cm), (B) Chest width (cm), (C) Body height (cm), (D) Chest depth (cm), (E) Chest girth (cm), (F) Cannon girth (cm), (G) Cross height (cm).
Figure 6. Associations of the 22 bp loci within the PER3 gene with growth traits in Small Tail Han Sheep. (A) Body oblique length (cm), (B) Chest width (cm), (C) Body height (cm), (D) Chest depth (cm), (E) Chest girth (cm), (F) Cannon girth (cm), (G) Cross height (cm).
Vetsci 12 00039 g006
Table 1. PCR primer sequences of the sheep CLOCK genes.
Table 1. PCR primer sequences of the sheep CLOCK genes.
GenesVariant IDPrimer NamesPrimer Sequences (5′–3′)Product Sizes (bp)Notes
PER3rs600537720P4-Ins-22-bpF: CAATTTCCCATGATACATAC
R: TCAGCTTTACATTAGTCCTT
168Polymorphism
CLOCKrs604230640P13-Del-12-bpF: AGTTCTGTGGGTGAAAGTAT
R: AGGCTGAACATTCTCCATTA
126Polymorphism
Table 2. Genetic parameters of the 22 bp loci within PER3 gene in four sheep breeds.
Table 2. Genetic parameters of the 22 bp loci within PER3 gene in four sheep breeds.
BreedsLociSizesGenotypic FrequenciesAllelic FrequenciesPopulation ParametersHWE
NIIIDDDIDHoHeNePICp-Value
HSP13-Del-12-bp1920.3440.6090.0470.6480.3520.5440.4561.8390.3520.649
TSP13-Del-12-bp1560.4170.4680.1150.6510.3490.5460.4541.8330.3510.647
STHSP13-Del-12-bp1730.6650.2600.0750.7950.2050.6740.3261.4840.2730.507
LTHSP13-Del-12-bp570.4560.4910.0520.7020.2980.5820.4181.7190.3310.609
Table 3. Genetic parameters of the 22 bp loci within PER3 gene in four sheep breeds.
Table 3. Genetic parameters of the 22 bp loci within PER3 gene in four sheep breeds.
BreedsLociSizesGenotypic FrequenciesAllelic FrequenciesPopulation ParametersHWE
NIIIDDDIDHoHeNePICp-Value
HSP4-Ins-22-bp1920.5100.3850.1040.7030.2970.5830.4181.7170.3300.608
TSP4-Ins-22-bp1560.7310.2440.0260.8530.1470.7490.2501.3350.2190.417
STHSP4-Ins-22-bp1730.5570.3050.1380.6990.3010.5790.4211.7270.3320.612
LTHSP4-Ins-22-bp570.5790.3510.0700.7540.2460.6290.3711.5900.3020.558
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Wang, Z.; Yi, X.; Yang, M.; Sun, X.; Wang, S. Detection of Insertion/Deletions (InDel) Within Five Clock Genes and Their Associations with Growth Traits in Four Chinese Sheep Breeds. Vet. Sci. 2025, 12, 39. https://doi.org/10.3390/vetsci12010039

AMA Style

Wang Z, Yi X, Yang M, Sun X, Wang S. Detection of Insertion/Deletions (InDel) Within Five Clock Genes and Their Associations with Growth Traits in Four Chinese Sheep Breeds. Veterinary Sciences. 2025; 12(1):39. https://doi.org/10.3390/vetsci12010039

Chicago/Turabian Style

Wang, Ziteng, Xiaohua Yi, Mengzhe Yang, Xiuzhu Sun, and Shuhui Wang. 2025. "Detection of Insertion/Deletions (InDel) Within Five Clock Genes and Their Associations with Growth Traits in Four Chinese Sheep Breeds" Veterinary Sciences 12, no. 1: 39. https://doi.org/10.3390/vetsci12010039

APA Style

Wang, Z., Yi, X., Yang, M., Sun, X., & Wang, S. (2025). Detection of Insertion/Deletions (InDel) Within Five Clock Genes and Their Associations with Growth Traits in Four Chinese Sheep Breeds. Veterinary Sciences, 12(1), 39. https://doi.org/10.3390/vetsci12010039

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop