Next Article in Journal
Changes in Biomarkers of Inflammation and Oxidative Status in Dogs Subjected to Celiotomy or Video-Assisted Ovariohysterectomy
Previous Article in Journal
Evaluation of Haematological Ratios at: Different Stages of Canine Periodontal Disease
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Veterinary Sciences
Volume 11
Issue 11
10.3390/vetsci11110582
vetsci-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Outbreak of Esophagitis and Ingluvitis Caused by Salmonella Typhimurium in Passeriform Birds of the Genus Sporophila Seized from Wildlife Trafficking

by
Karoline L. Soares
1,
Ricardo B. Lucena
1,*,
Ewerton S. Lima
1,
Millena de O. Firmino
2,
Lilian R. C. Eloy
1,
Raquel Annes F. Silva
3,
Mônica S. Sousa
1,
Isabelle V. Sousa
3,
Weslley Drayton Q. Silva
4,
Artur Cezar de C. Fernandes
1 and
Eduardo M. Ramos-Sanchez
5,*
1
Graduate Program in Animal Science, Center of Agricultural Sciences, Universidade Federal da Paraiba, Rodovia 12, Areia 58397-000, Paraiba, Brazil
2
Productive Unit Coordination, Instituto Federal do Sertão Pernambucano, Campus Floresta, Floresta 56400-000, Pernambuco, Brazil
3
Graduate Program in Animal Health and Science, Center for Rural Health and Technology, Universidade Federal de Campina Grande, Avenida Universitária, s/n Bairro Santa Cecília, Patos 58708-110, Paraiba, Brazil
4
Veterinary Medicine Course, Center of Agricultural Sciences, Universidade Federal da Paraiba, Rodovia 12, Areia 58397-000, Paraiba, Brazil
5
Facultad de Medicina (FAMED), Universidad Nacional Toribio Rodriguez de Mendoza de Amazonas (UNTRM), Chachapoyas 01001, Amazonas, Peru
*
Authors to whom correspondence should be addressed.
Vet. Sci. 2024, 11(11), 582; https://doi.org/10.3390/vetsci11110582
Submission received: 13 September 2024 / Revised: 6 November 2024 / Accepted: 14 November 2024 / Published: 19 November 2024
(This article belongs to the Section Anatomy, Histology and Pathology)
Browse Figures
Versions Notes

Simple Summary

This study reports cases of esophagitis and ingluvitis caused by Salmonella Typhimurium in passerine birds seized from illegal trade, highlighting its relevance to One Health. While few studies document salmonellosis in passerines, this investigation aimed to describe the disease in these species, identify the pathogen in their environment, and assess antimicrobial resistance profiles. Necropsy revealed necrotic lesions in the crop and esophagus, from which Salmonella spp. was isolated. The same pathogen was also found in the quarantine environment. Both environmental and animal strains exhibited resistance to multiple antibiotic classes. Serotyping identified the pathogen as the Typhimurium serovar in two birds. This study underscores the need for understanding circulating pathogens in wildlife to develop mitigation strategies, prevent zoonotic transmission, and address antimicrobial resistance.

Abstract

The occurrence of esophagitis and ingluvitis caused by Salmonella Typhimurium in passerines seized from illegal wildlife trafficking is described. This illegal activity causes stress and leads to lowered immunity in the birds. Additionally, inadequate hygiene conditions predispose the birds to diseases such as salmonellosis. Few studies report the occurrence of Salmonella-induced lesions in the esophagus and crop of passerines; therefore, this study aimed to describe the disease in birds of the genus Sporophila, as well as to investigate the presence of the bacterium in the environment and determine the antimicrobial resistance profile of the isolated bacteria. Three birds of the genus Sporophila were necropsied. In the esophagus and crop, yellowish plaques corresponding to necrosis with bacterial aggregates were observed. Salmonella spp. was isolated from these lesions, with genus confirmation via MALDI-TOF mass spectrometry. Environmental samples were collected from the enclosures and cages where the animals were quarantined, and the same bacterium was isolated. In two birds, the serotype S. Typhimurium was identified. Antibiograms performed on the strains from the birds and the environment revealed resistance to antibiotics in the classes of penicillins, sulfonamides, aminoglycosides, monobactams, tetracyclines, and first and third-generation cephalosporins. To the authors’ knowledge, this is the first report of this agent causing death in Sporophila due to esophagitis and ingluvitis. It is also the first report of salmonellosis in three species of passerines in Brazil. The study underscores the importance of understanding the pathogens circulating in wild animals, especially within the context of One Health.

1. Introduction

Most wildlife trafficking victims in Brazil are birds, with this illegal activity impacting around 20% of native bird species, including some that are endangered [1]. Birds of the genus Sporophila are significant victims of illegal breeding and trafficking, with many of these seized animals being sent to rehabilitation and screening centers for eventual release back into the wild [2]. Trafficked birds often suffer from poor physical conditions and exhibit liver and biochemical issues due to inadequate nutrition [3]. Furthermore, the stress from trafficking, combined with poor hygiene, leads to weakened immunity, making these birds more susceptible to opportunistic infections and diseases such as salmonellosis [4].
Salmonella are Gram-negative bacilli belonging to the Enterobacteriaceae family [5,6]. They are divided into two species, S. bongori and S. enterica [7]. S. enterica is further classified into six subspecies: S. enterica subsp. enterica, S. enterica subsp. salamae, S. enterica subsp. arizonae, S. enterica subsp. diarizonae, S. enterica subsp. houtenae, and S. enterica subsp. indica [5,8]. Based on surface antigen characteristics and biochemical properties, Salmonella are subdivided into serovars [6]. Currently, over 2600 serovars have been identified, with 99% of them belonging to S. enterica subsp. enterica [7,9].
This bacterium can infect humans, domestic animals, wildlife, and even insects, contaminating the environment, water, or food through sick individuals or carriers [4,10,11]. Contamination through the consumption of contaminated eggs and chicken meat makes domestic poultry significant agents in the transmission of salmonellosis to humans [12]. However, recent studies show that wild birds can harbor serovars relevant to the One Health context, acting as vectors for this pathogen to both humans and domestic animals [13,14,15]. Additionally, the circulation of the pathogen in the wild, whether zoonotic or not, can directly impact wild species populations by causing the death of infected individuals [16].
In passerines, the circulation of the bacteria is associated with group feeding practices, especially when humans encourage the congregation of species by providing food in urban and peri-urban environments, or when birds are kept under inadequate conditions in captivity [17]. In these birds, the Typhimurium serovar has been most frequently reported as the cause of outbreaks in Norway [18,19], Sweden [16,20], Switzerland [14], England [21,22,23], Wales [22,23], the United States [24,25,26], Brazil [27], Austria [28], Canada [29], New Zealand [30], Japan [31,32], and Poland [33].
Despite some descriptions, few studies report the occurrence of salmonellosis in free-living passerines [14] or in birds seized from trafficking [3]. Thus, the presence of the pathogen in wild birds may be underdiagnosed, as testing is rarely performed on these birds [17]. Birds that become ill show acute progression and die within 24 h, with reluctance to fly, apathy, and difficulty feeding due to characteristic lesions; necropsy reveals yellowish plaques in the esophagus and crop [14,17]. The aim of this study was to describe the occurrence of salmonellosis in passerines of the Sporophila genus seized from wildlife trafficking and kept in a rehabilitation center, describe the presence of the pathogen in the environment, and examine the antimicrobial resistance profile of the isolated strains.

2. Materials and Methods

2.1. Birds

In 2021, a wildlife screening and rehabilitation center in the state of Paraiba, Brazil, had been experiencing outbreaks of mortality in passerine birds for several weeks. These birds had been rescued a few months earlier and were still undergoing rehabilitation. Over six months, we conducted 101 necropsies on passerines of various species housed in this rehabilitation center. Among these, three birds from the genus Sporophila with a history of regurgitation and weight loss were selected for further examination. All these birds had been confiscated and housed in the same building: Bird 1 was a male adult caboclinho (Sporophila bouvreuil) seized by the environmental police from a residence in the city of João Pessoa; Bird 2 was a male adult papa-capim (Sporophila nigricollis) seized from a residence in the city of Campina Grande; and Bird 3 was a male adult golado (Sporophila albogularis) seized from a residence in João Pessoa, along with six other passerine birds. All birds exhibited symptoms of regurgitation and progressive weight loss, ultimately leading to death within two to four weeks after the onset of clinical signs.

2.2. Necropsy and Histological Evaluation

Necropsies were performed, and tissue samples were collected from the thoracic and abdominal organs, as well as the brain, skin, and bones. All samples were fixed in 10% buffered formalin for subsequent preparation of histological slides, and then stained with standard hematoxylin and eosin (H&E) staining.

2.3. Microbiology

2.3.1. Bird Samples

During necropsy, aseptic samples were collected from lesions in the esophagus and crop of each bird. For microbiological analysis, the samples were cultured on blood agar base enriched with 5% sheep blood and MacConkey agar, then incubated under aerobic conditions at 37 °C. After bacterial growth, identification was performed based on morpho-tinctorial characteristics. For confirmation of the isolate, colonies from the MacConkey agar were subcultured on selective media for the differentiation of Salmonella and Shigella using Hektoen enteric (HE) agar and Salmonella-Shigella (SS) agar, allowing the observation of black colonies that produce hydrogen sulfide (H2S) in both media. After identifying the bacterial isolates, they were selected for antimicrobial susceptibility testing using the disk diffusion method on Mueller-Hinton agar. Disks containing standardized concentrations of antimicrobials were applied, followed by incubation for 24 h. After incubation, the inhibition zones were measured to assess resistance to the tested antimicrobials.

2.3.2. Microbiological Environmental Samples

Microbiological samples were collected from three enclosures (Enclosure 1, Enclosure 2, and Enclosure 3) and three cages (Cage 1, Cage 2, and the cage where passeriform birds were quarantined at the wildlife screening and rehabilitation center). To obtain Salmonella spp. samples from the enclosures, three sterile drag swabs were prepared—one for each enclosure. Gauze pads were attached to a 70 cm cotton string, packaged, and autoclaved. The drag swab was run across the entire floor of the enclosure, and then placed in a glass tube containing Rappaport–Vassiliadis selective enrichment broth. In the cages, Stuart-type swabs were used—one for each cage—and swabbed across the floor and perches.
The drag swabs were incubated at 37 °C for 24 h, after which the samples were cultured on Hektoen enteric agar and Salmonella-Shigella Agar and incubated aerobically at 37 °C, with a reading taken after 24 h. Cultures and isolation from the Stuart-type swabs from the enclosure followed the same protocol used for the bird samples. In samples where Salmonella spp. was isolated, another antibiogram was performed in partnership with the Enterobacteria Laboratory at FIOCRUZ.

2.3.3. Antimicrobial Susceptibility Testing

The antimicrobial discs were placed on the surface of the inoculated agar plates, which were then incubated for 24 h at 37 °C. After incubation, the inhibition zone diameters were measured and interpreted according to CLSI M100 (2023) [34]. The isolates were tested for susceptibility to antimicrobials based on their relevance in both veterinary and human medicine. The antimicrobial agents and their respective concentrations were the following: ampicillin (10 µg), amoxicillin (20 µg), clavulanic acid (10 µg), amoxicillin (10 µg), trimetoprim-sulfametoxazol (25 µg, comprising 1.25 µg of trimethoprim and 23.75 µg of sulfamethoxazole comprising 1.25 µg of trimethoprim and 23.75 µg of sulfamethoxazole), trimethoprim (25 µg), sulfamethoxazole (25 µg), chloramphenicol (30 µg), gentamicin (10 µg), streptomycin (10 µg), meropenem (10 µg), ciprofloxacin (5 µg), nalidixic Acid (30 µg), aztreonam (30 µg), tetracycline (30 µg), cefazolin (30 µg), cephalexin (30 µg), cefoxitin (30 µg), ceftriaxone (30 µg), and cefotaxime (30 µg) [35,36].

2.4. MALDI-TOF Mass Spectrometry

After being isolated in culture media, the colonies from the samples of the three birds were sent in Brain Heart Infusion (BHI) agar with glycerol and subjected to biochemical confirmation through matrix-assisted laser desorption/ionization—time-of-flight (MALDI-TOF mass spectrometry) analysis, using the ribosomal protein extraction method directly on plate according to Barcelos et al. [37].

2.5. Serotyping

Samples in Mueller-Hinton agar were sent to the Enterobacteria Laboratory at FIOCRUZ, Rio de Janeiro, Brazil, where the identification of Salmonella spp. serotypes was performed using the slide agglutination method, which evaluates antigenic differences in the cell capsule (capsular antigens “Vi”), the cell wall (somatic antigens “O”), and the flagella (flagellar antigens “H”), as proposed by White—Kauffmann—Le Minor [38].

2.6. Polymerase Chain Reaction (PCR) and Bacterial DNA Amplification

The strains sent to the Enterobacteria Laboratory at FIOCRUZ were inoculated on Muller Hinton agar. After microbial growth, DNA extraction was performed, followed by the PCR reactions. Escherichia coli K-12 DH5α was used as the negative control for the PCR reactions, while S. Enteritidis S.64 and S. Typhimurium S.190 prototype strains [39] from the Culture Collection of the National Reference Laboratory for Bacterial Enteroinfections/Enterobacteria Laboratory/IOC/FIOCRUZ were used as positive controls. The primers for the genes under investigation are described in Table 1.

2.7. Amplification of Extended Spectrum Beta-Lactamase (ESBL) Genes

Characterization of beta-lactamases was performed using multiplex PCR analysis (Table 2). The Klebsiella pneumoniae strain ATCC 700603 was used as a positive control, and the Esherihia coli strain ATCC 25922 served as a negative control.

3. Results

3.1. Macroscopic and Histopathological Lesions

Upon external examination, all birds were found to be underweight, with body scores ranging from 2 to 3 on a scale of 1 to 5. Bird 2 also exhibited amputation of the carpus, metacarpus, and phalanges of the right wing. In the esophagus of all birds, yellowish plaques measuring 0.1 to 0.4 cm in diameter were observed, involving both the serosal and mucosal layers (Figure 1). These plaques extended into the crop in birds 1 and 3. The plaques had an irregular and shiny surface. Upon sectioning, they were soft, compact, and yellowish.
Histopathological evaluation revealed multifocal to coalescent ulcers of the mucosal surface in the esophagus and crop. Multifocal to coalescent necrosis was observed in the submucosa (Figure 2) or extensive necrosis (Figure 3), accompanied by the presence of heterophils, macrophages, fibrin, and a large number of short rod-shaped bacteria. Numerous blood vessels were occluded by fibrin thrombi, along with a small occasional presence of short rod-shaped bacteria. These lesions extended to the serosa of both organs but were more severe in the crop.

3.2. Microbiology and Antibiogram

Bacterial cultures from the birds and the environment, which were plated on Hektoen enteric (HE) agar and Salmonella-Shigella Agar (SS), exhibited hydrogen sulfide production, characterized by a dark color at the center of the colonies. On MacConkey agar, the Salmonella colonies appeared colorless due to the lack of lactose fermentation. Birds 1, 2, and 3, Enclosure 2, and Cage 2 showed a dark center in the colonies on SS and HE due to hydrogen sulfide production. On MacConkey agar, they were lactose non-fermenters, appearing colorless.
In the antibiogram, samples from three birds, Enclosure 2, and Cage 2 showed resistance to different classes of antibiotics (Table 3).

3.3. MALDI-TOF Mass Spectrometry Results

In the mass spectrometry technique, the genus of the strains isolated from the esophageal and ingluvial lesions of birds 1, 2, and 3 was confirmed (Table 4).

3.4. Serotyping Results

All strains were identified through serotyping as belonging to the genus Salmonella, species enterica, and subspecies enterica. Bird 1 and Enclosure 2 had the somatic antigens O:4 and O:5 identified. In Birds 1 and 2, it was possible to identify all antigens, allowing for the classification of the Typhimurium serotype in samples from these individuals (Table 5).

3.5. Identification of Virulence Genes and Characterization of Extended Spectrum Beta-Lactamase (ESBL) Genes

Variable virulence genes (orgA, invA, ssaQ, mgtC, sopB, stn, and spvC) were identified in Salmonella strains (Table 6). The molecular investigation of β-lactamase production, performed through polymerase chain reaction (PCR), detected the presence of the blaCMY gene in all five tested Salmonella strains.

4. Discussion

The confirmation of mortality in passerine birds with lesions in the upper digestive tract associated with Salmonella infection in this study was possible through a set of diagnostic techniques. This enabled the elucidation of the pathogenesis of the disease characterized by regurgitation, weight loss, and death in three bird species of the genus Sporophila. To the best of the authors’ knowledge, this is the first confirmation of esophagitis and ingluvitis in this bird species. These birds are among the most trafficked wildlife species in Brazil [48], and thus they could be involved in the spread of salmonellosis to other animals or humans.
Our study identified the infection of Salmonella enterica subsp. enterica serovar Typhimurium in both the birds and the environment where they were being rehabilitated. Birds held in rehabilitation screening centers in Brazil, after a quarantine period, may later be released back into the wild [2]. These birds returning to the wild can contaminate the environment and have impacts on species conservation. Many cases of infection by Salmonella enterica subsp. enterica serovar Typhimurium have been described in humans associated with the contamination of animal-origin foods, mainly eggs and chicken meat [49,50]. On the other hand, recent studies show that wild birds can harbor serovars relevant to One Health, as they can be vectors of this agent both to people and to domestic animals [13,14,15,51,52,53].
The history of trafficking and interaction with other species may have contributed to the development of fatal diseases in the birds of this study. This differs from reports of isolation of the Typhimurium serovar in passerines in Brazil, where the agent was isolated from cloacal swabs of asymptomatic carrier birds [27]. We still do not know the main serovar found in Brazilian birds, but studies of avian salmonellosis outbreaks in different countries have proven that Salmonella Typhimurium is the most prevalent serovar in passerines [54]. Infection in these cases is usually related to the aggregation of species at feeding sites provided by people [13,19], adaptation of birds in urban areas [14], or contact with livestock that may harbor the pathogen [17]. These factors are also observed in trafficked birds in Brazil. In addition to contact with people due to trafficking, birds of the genus Sporophila have the habit of feeding on grass seeds and thus may have urban or rural habits [55], which further favors contact with humans and other animals. These factors increase the risk of both contamination and transmission of salmonellosis, since the Typhimurium serovar is considered one of the main causes of disease outbreaks in people, as well as in other animals, such as domestic cats [14,20] due to hunting habits [56]. Additionally, these birds make seasonal long-distance movements (>1000 km) [55], which can result in the dispersion of the agent to other regions.
The isolation of the bacterium in one enclosure and cage at the location where the birds were housed indicates the circulation of the pathogen and its persistence in the environment. This characteristic is due to Salmonella’s ability to form biofilms through microbial clusters that can resist on inert or living surfaces [57]. This pathogen has been isolated in enclosures, cages, and waterers at wildlife screening centers, associated with the high demand of animals that can be carriers of this agent [58,59]. This highlights the importance of monitoring salmonellosis in animals at wildlife screening centers that will be reintroduced into the wild.
The virulence genes identified in the Salmonella isolates from this study, such as invA, ssaQ, mgtC, and sopB, play crucial roles in the bacterium’s ability to invade and survive within the host. Studies have shown that these genes are associated with various Salmonella pathogenicity islands (SPIs), especially in birds, contributing significantly to the pathogen’s ability to cause infections [60,61].
The invA gene is particularly important for its role in enabling the bacterium to invade intestinal epithelial cells, which is a key step in initiating infection, while ssaQ and sopB assist in the secretion of virulence proteins that aid bacterial survival within host cells [60]. Additionally, the stn gene is responsible for enterotoxin production, which contributes to the inflammatory response in the host [62], and spvC is part of a plasmid virulence operon that helps Salmonella evade the host’s immune defenses, thus promoting the spread of infection [63]. Therefore, the presence of genes like stn and spvC in these isolates highlights Salmonella’s enhanced ability to cause disease and underscores the need for monitoring Salmonella in wild bird populations, especially in rehabilitation centers, where cross-species transmission risks are higher.
Although it was not possible to detect all somatic and flagellar antigens of Bird 1 and Enclosure 2, the presence of O:4 and O:5 in these bacteria indicates they belong to serovars of group B, which may or may not be the Typhimurium serovar found in Birds 2 and 3. In Cage 2, it was possible to identify the presence of Salmonella enterica subsp. enterica without determination of the serovar. Salmonella serotypes are defined from an antigenic formula that considers somatic, flagellar, and capsular antigens. The “O” somatic antigens are also called major antigens and divide the bacteria into several serogroups; serogroup B includes strains possessing the O:1, O:5, O:12, and O:27 antigens, among which are the Paratyphi B and Typhimurium serovars [64]. However, due to the phenotypic differentiation of isolates from a specific bird and its corresponding cage, we cannot rule out the possibility of contamination of the cages and surrounding environment by bacteria shed by other birds in the enclosure. This contamination may have resulted from infected birds spreading Salmonella to the shared environment, making it challenging to distinguish the primary source of infection.
Multi-drug resistance was observed in the Salmonella isolates from the three birds, one enclosure, and the cage, both in the evaluation conducted at UFPB and at Fiocruz. Resistance was demonstrated to various classes of antibiotics, including ampicillin, amoxicillin-clavulanate, amoxicillin, streptomycin, and tetracycline. This pattern is consistent with previous research that identified resistance in Salmonella isolates from wild birds in Brazil. For example, studies have shown that wild birds in areas with high human interaction can act as asymptomatic carriers of resistant strains of Salmonella spp., posing a significant risk to public health and food safety [65,66].
Streptomycin, an aminoglycoside antibiotic, is not typically used for treating salmonellosis but is commonly used as a growth promoter in animals, potentially leading to the emergence of resistant isolates throughout the production chain. Drug-resistant strains may contaminate not only meat but also soil and vegetation that could be ingested by other species [67]. Resistance mechanisms to tetracycline have also been linked to its use in livestock and its environmental discharge [67]. All samples in this study were resistant to both streptomycin and tetracycline.
Beta-lactam resistance in this study was observed in derivatives of penicillin, cephalosporins, carbapenems, and monobactams. This resistance can be attributed to multiple mechanisms, including the production of beta-lactamase enzymes by certain strains of Enterobacteriaceae, which can inactivate specific antibiotics [68]. However, not all resistant strains exhibit this enzyme production. Additionally, modifications in penicillin-binding proteins (PBPs) and decreased permeability of the bacterial cell membrane may also play significant roles in beta-lactam resistance [69].
On the other hand, sulfonamide resistance occurs through the inhibition of dihydropteroate synthase, an enzyme involved in bacterial DNA and RNA synthesis. This resistance is frequently linked to the presence of genes that confer resistance to the drug [70].
Generally, the isolates from both the birds and the environment exhibited a resistance profile similar to that reported for S. Typhimurium. An evaluation of 11,447 strains showed the tetra-resistant ASSuT pattern (ampicillin, streptomycin, sulfonamides, tetracycline) and the penta-resistant ACSSuT pattern (ampicillin, chloramphenicol, streptomycin, sulfonamides, tetracycline) [49], similar to the resistance patterns found in this study on a smaller scale.
In addition to the microbiological findings, the esophageal nodules observed in the crop and esophagus of the three birds are considered pathognomonic lesions of salmonellosis in passerines associated with the Typhimurium serovar [13,17]. Similar lesions have been observed in outbreaks of salmonellosis in Carduelis spinus in Austria [28] and Switzerland [14], in Pyrrhula pyrrhula and three species of Carduelis in Norway [19], Passer montanus in Japan [31], as well as Carpodacus purpureus, Coccothraustes vespertinus, and three species of the genus Carduelis in Canada [29]. These organs are the initial site of infection. After the development of these masses, sepsis occurs without intestinal lesions [28]. The reason for the development of lesions in this region is not yet known, but it is believed that there is an affinity for this tissue by the bacteria, associated with the way of contamination through the ingestion of food contaminated by feces [21]. Microscopic lesions are characterized by transmural ulcerative ingluvitis and esophagitis to varying degrees, infiltration of viable and degenerated histiocytes and heterophils, with the presence of intra and extracellular bacterial rods surrounding the necrotic areas and expanding the esophageal wall [14,19].
Death occurs due to septic shock favored by wasting and difficulty of the bird in feeding due to esophageal obstruction caused by the masses. The strains of this serovar seem to be adapted to the groups of birds they can affect, thus they can cause disease with high mortality rates in some groups and others being only asymptomatic carriers [71], which may explain the occurrence of death in animals of the same order in this description. To the authors’ knowledge, until now, there had been no report of this esophageal form of salmonellosis in passerines in Brazil.

5. Conclusions

The reported cases in this study highlight the harmful potential of Salmonella Typhimurium in passerines of the Sporophila genus and underscore the importance of curbing wildlife trafficking, as it was a significant factor in the development of the disease in these species. Furthermore, knowledge of the pathogens circulating in wild animals enables the development of mitigative measures to prevent the loss of individuals and protect against zoonoses, since wild animals can act as vectors or reservoirs of diseases for humans and other animals.

Author Contributions

Conceptualization, K.L.S. and R.B.L.; methodology, K.L.S., E.S.L., E.M.R.-S. and R.B.L.; validation, K.L.S. and R.B.L.; formal analysis, E.M.R.-S. and R.B.L.; investigation, K.L.S., M.d.O.F., E.S.L., R.A.F.S., M.S.S., E.M.R.-S., I.V.S., W.D.Q.S., A.C.d.C.F. and R.B.L.; resources, R.B.L.; data curation, K.L.S., I.V.S., W.D.Q.S., A.C.d.C.F., E.M.R.-S. and R.B.L.; writing—original draft preparation, K.L.S.; writing—review and editing, K.L.S., M.d.O.F., L.R.C.E., E.M.R.-S. and R.B.L.; visualization, K.L.S., E.M.R.-S. and R.B.L.; supervision, E.M.R.-S. and R.B.L.; project administration, K.L.S. and R.B.L.; funding acquisition, R.B.L. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by PROPESQ/PRPG/UFPB, grant “Pró-Publicação Edital–Investigation of the Involvement of Wildlife in the Occurrence of Endemic, Epidemic, and Pandemic Diseases in Northeast Brazil, PROPESQ/PRPG/UFPB, 2021”; The National Council for Scientific and Technological Development (CNPq, Brazil) grant 314413/2020-0; CONCYTEC grant (PE501087383-2024 PROCIENCIA); Consejo Nacional de Ciencia, Tecnología e Innovación Tecnológica CONCYTEC and Programa Nacional de Investigación Científica y Estudios Avanzados PROCIENCIA grant (concurso: E041-2024-01:2024) N° CONTRATOPE501087383-2024. Vicerrectorado de Investigación de la Uni-versidad Nacional Toribio Rodríguez de Mendoza de Amazonas.

Institutional Review Board Statement

The study was conducted in accordance with the Declaration of Instituto Chico Mendes de Conservação da Biodiversidade–ICMBio (protocol code 77213-1 and date of approval 23 December 2020).

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding authors.

Acknowledgments

We express our gratitude to the Enterobacteria Laboratory at the Oswaldo Cruz Foundation, Rio de Janeiro, Brazil (IOC/FIOCRUZ), for conducting the antibiogram, molecular tests, and serological analyses. We also thank the Milk Quality Research Laboratory (Qualileite) at the Faculty of Veterinary Medicine and Animal Science (FMVZ) of the University of São Paulo (USP), São Paulo, Brazil, for performing the MALDI-TOF mass spectrometry analysis. Consejo Nacional de Ciencia, Tecnología e Innovación Tecnológica CONCYTEC and Programa Nacional de Investigación Científica y Estudios Avanzados PROCIENCIA grant (concurso: E041-2024-01:2024) N° CONTRATOPE501087383-2024. Vicerrectorado de Investigación de la Universidad Nacional Toribio Rodríguez de Mendoza de Amazonas.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Regueira, R.F.S.; Bernard, E. Wildlife sinks: Quantifying the impact of illegal bird trade in street markets in Brazil. Biol. Conserv. 2012, 149, 16–22. [Google Scholar] [CrossRef]
  2. Nascimento, C.J.; Oliveira, A.M.; Santos, W.M.; Araújo, J.L.; Rola, L.D.; Guerra, R.R. Body condition, external morphology, parasitology, and histological and biometrical study of the gastro-intestinal tract of Sporophila nigricollis and Sporophila caerulescens seized from trafficking in Northeastern Brazil. Pesqui. Vet. Bras. 2024, 44, e07358. [Google Scholar] [CrossRef]
  3. Siqueira, R.A.S.; de Lucena, R.B.; Cavalcanti, T.A.; de Lima Luna, A.C.; de Oliveira Firmino, M.; Guerra, R.R. Aspectos clínico-patológicos em papagaios-verdadeiros (Amazona aestiva, L. 1758) oriundos de apreensões do tráfico no estado da Paraíba, Brasil. Braz. J. Vet. Med. 2016, 38, 439–444. [Google Scholar]
  4. Campos, J.A.; Guizelini, C.C.; Pavarini, S.P.; Azuaga, L.; Souza, M.L.; Leal, C.R.B.; Ramos, C.A.N.; Gomes, D.C. Pathological Aspects of a Septicemic Salmonellosis Outbreak Caused by Salmonella Serotype Typhimurium in Captive Blue-Fronted Amazon Parrots (Amazona aestiva). Pesqui. Vet. Bras. 2024, 44, e07428. [Google Scholar] [CrossRef]
  5. Tindall, B.J.; Grimont, P.A.D.; Garrity, G.M.; Euzeby, J.P. Nomenclature and Taxonomy of the Genus Salmonella. Int. J. Syst. Evol. Microbiol. 2005, 55, 521–524. [Google Scholar] [CrossRef] [PubMed]
  6. Trabulsi, L.R.; Alterthum, F. Microbiologia, 6th ed.; Editora Atheneu: São Paulo, Brazil, 2015; pp. 351–360. [Google Scholar]
  7. Issenhuth-Jeanjean, S.; Roggentin, P.; Mikoleit, M.; Guibourdenche, M.; De Pinna, E.; Nair, S.; Fields, P.I.; Weill, F. Supplement 2008–2010 (no. 48) to the White-Kauffmann-Le Minor Scheme. Res. Microbiol. 2014, 165, 526–530. [Google Scholar] [CrossRef]
  8. Guibourdenche, M.; Roggentin, P.; Mikoleit, M.; Fields, P.I.; Bockemuhl, J.; Grimont, P.A.D.; Weill, F.X.; Issenhuth-Jeanjean, S. Supplement 2003–2007 (No. 47) to the White-Kauffmann-Le Minor Scheme. Res. Microbiol. 2010, 161, 26–29. [Google Scholar] [CrossRef]
  9. Hassan, A.H.A.; Salam, H.S.H.; Abdel-Latef, G.K. Serological Identification and Antimicrobial Resistance of Salmonella Isolates from Broiler Carcasses and Human Stools in Beni-Suef, Egypt. Beni-Suef Univ. J. Basic Appl. Sci. 2016, 5, 202–207. [Google Scholar] [CrossRef]
  10. Braga, P.R.C.; Basso, R.M.; Martins, L.S.A. Occurrence of Salmonella spp. in Fecal Samples from Foals with and without Diarrhea in the State of São Paulo: Microbiological Diagnosis, Antimicrobial Susceptibility Profile, and Molecular Detection. Pesqui. Vet. Bras. 2023, 43, e07194. [Google Scholar] [CrossRef]
  11. Pinto, P.N.; Torres, A.C.D.; Rodrigues, M.P.; Oliveira, L.B.; Costa, C.S.; Ecco, R.; Freitas Neto, O.C.; Martins, N.R.S. An Outbreak of Fatal Pullorum Disease (Salmonella Pullorum) in Guinea Fowl Keets (Numida meleagris). Pesqui. Vet. Bras. 2023, 43, e07088. [Google Scholar] [CrossRef]
  12. Forsythe, S.J. Microbiologia Segurança Alimentos, 2nd ed.; Artmed: Porto Alegre, Brazil, 2013. [Google Scholar]
  13. Thomas, N.J.; Hunter, D.B.; Atkinson, C.T. Infectious Diseases of Wild Birds; Blackwell Publishing: Ames, IA, USA, 2007; pp. 270–288. [Google Scholar]
  14. Giovannini, S.; Pewsner, M.; Hüssy, D.; Hächler, H.; Degiorgis, M.-P.R.; Hirschheydt, J.; Origgi, F.C. Epidemic of Salmonellosis in Passerine Birds in Switzerland with Spillover to Domestic Cats. Vet. Pathol. 2013, 50, 597–606. [Google Scholar] [CrossRef] [PubMed]
  15. Silva, C.; Calva, E.; Maloy, S. One Health and Food-Borne Disease: Salmonella Transmission between Humans, Animals, and Plants. Microbiol. Spectr. 2014, 2, 1. [Google Scholar] [CrossRef] [PubMed]
  16. Söderlund, R.; Jernberg, C.; Trönnberg, L.; Pääjärvi, A.; Agren, E.; Lahti, E. Linked Seasonal Outbreaks of Salmonella Typhimurium among Passerine Birds, Domestic Cats, and Humans, Sweden, 2009 to 2016. Eurosurveillance 2019, 24, 1900074. [Google Scholar] [CrossRef] [PubMed]
  17. Tizard, I.R. Salmonellosis in Wild Birds. Semin. Avian Exot. Pet Med. 2004, 13, 50–66. [Google Scholar] [CrossRef]
  18. Kapperud, G.; Stenwig, H.; Lassen, J. Epidemiology of Salmonella Typhimurium 0:4-12 Infection in Norway. Am. J. Epidemiol. 1998, 147, 774–782. [Google Scholar] [CrossRef]
  19. Refsump, T.; Vikoren, T.; Handeland, K.; Kapperud, G.; Holstad, G. Epidemiologic and Pathologic Aspects of Salmonella Typhimurium Infection in Passerine Birds in Norway. J. Wildl. Dis. 2003, 39, 64–72. [Google Scholar] [CrossRef]
  20. Tauni, M.A.; Österlund, A. Outbreak of Salmonella Typhimurium in Cats and Humans Associated with Infection in Wild Birds. J. Small Anim. Pract. 2000, 41, 339–341. [Google Scholar] [CrossRef]
  21. Hughes, L.A.; Shopland, S.; Wigley, P.; Bradon, H.; Leatherbarrow, A.H.; Williams, N.J.; Bennett, M.; Pinna, E.; Lawson, B.; Cunningham, A.A.; et al. Characterisation of Salmonella enterica Serotype Typhimurium Isolates from Wild Birds in Northern England from 2005–2006. BMC Vet. Res. 2008, 4, 4. [Google Scholar] [CrossRef]
  22. Lawson, B.; Howard, T.; Kirkwood, J.K.; Macgregor, S.K.; Perkins, M.; Robinson, R.A.; Ward, L.R.; Cunningham, A.A. Epidemiology of Salmonellosis in Garden Birds in England and Wales, 1993 to 2003. EcoHealth 2010, 7, 294–306. [Google Scholar] [CrossRef]
  23. Mather, A.E.; Lawson, B.; Pinna, E.; Wigley, P.; Parkhill, J.; Thomson, N.R.; Page, A.J.; Holmes, M.A.; Paterson, G.K. Genomic Analysis of Salmonella enterica Serovar Typhimurium from Wild Passerines in England and Wales. Appl. Environ. Microbiol. 2016, 82, 6728–6735. [Google Scholar] [CrossRef]
  24. Locke, L.N.; Shillinger, R.B.; Jareed, T. Salmonellosis in Passerine Birds in Maryland and West Virginia. J. Wildl. Dis. 1973, 9, 144–145. [Google Scholar] [CrossRef] [PubMed]
  25. Hall, A.J.; Saito, E.K. Avian Wildlife Mortality Events Due to Salmonellosis in the United States, 1985–2004. J. Wildl. Dis. 2008, 44, 585–593. [Google Scholar] [CrossRef] [PubMed]
  26. Hernandez, S.M.; Keel, K.; Sanchez, S.; Trees, E.; Gerner-Smidt, P.; Adams, J.K.; Cheng, Y.; Ray, A.; Martin, G.; Presotto, A.; et al. Epidemiology of a Salmonella enterica subsp. enterica Serovar Typhimurium Strain Associated with a Songbird Outbreak. Appl. Environ. Microbiol. 2012, 78, 7290–7298. [Google Scholar] [CrossRef] [PubMed]
  27. Matias, C.A.R.; Pereira, I.A.; Araújo, M.S.; Santos, A.F.M.; Lopes, R.P.; Christakis, S.; Rodrigues, D.P.; Siciliano, S. Characteristics of Salmonella spp. Isolated from Wild Birds Confiscated in Illegal Trade Markets, Rio de Janeiro, Brazil. BioMed Res. Int. 2016, 2016, 3416864. [Google Scholar] [CrossRef] [PubMed]
  28. Brunthaler, R.; Spergser, J.; Weissenböck, H. Multiple Epidemics in Austrian Fringillidae Caused by a Single Variant of Salmonella Typhimurium. J. Wildl. Dis. 2021, 57, 891–899. [Google Scholar] [CrossRef]
  29. Daoust, P.Y.; Busby, D.G.; Ferns, L.; Goltz, J.; McBurney, S.; Poppe, C.; Whitney, H. Salmonellosis in Songbirds in the Canadian Atlantic Provinces During Winter-Summer 1997–1998. Can. Vet. J. 2000, 41, 54–59. [Google Scholar]
  30. Alley, M.R.; Connolly, J.H.; Fenwick, S.G.; Mackereth, G.F.; Leyland, M.J.; Rogers, L.E.; Haycock, M.; Nicol, C.; Reed, C.E.M. An Epidemic of Salmonellosis Caused by Salmonella Typhimurium DT160 in Wild Birds and Humans in New Zealand. N. Z. Vet. J. 2002, 50, 170–176. [Google Scholar] [CrossRef]
  31. Une, Y.; Sanbe, A.; Suzuki, S.; Niwa, T.; Kawakami, K.; Kurosawa, R.; Izumiya, H.; Watanabe, H.; Kato, Y. Salmonella enterica Serotype Typhimurium Infection Causing Mortality in Eurasian Tree Sparrows (Passer montanus) in Hokkaido. Jpn. J. Infect. Dis. 2008, 61, 166–167. [Google Scholar] [CrossRef]
  32. Fukui, D.; Takahashi, K.; Kubo, M.; Une, Y.; Kato, Y.; Izumiya, H.; Teraoka, H.; Asakawa, M.; Yanagida, K.; Bando, G. Mass Mortality of Eurasian Tree Sparrows (Passer montanus) from Salmonella Typhimurium DT40 in Japan, Winter 2008–2009. J. Wildl. Dis. 2014, 50, 484–495. [Google Scholar] [CrossRef]
  33. Krawiec, M.; Pietkiewicz, M.; Wieliczko, A. Salmonella spp. as a Cause of Mortality and Clinical Symptoms in Free-Living Garden Bird Species in Poland. Pol. J. Vet. Sci. 2014, 17, 729–731. [Google Scholar] [CrossRef]
  34. CLSI. Performance Standards for Antimicrobial Susceptibility Testing, 33rd ed.; CLSI Supplement M100; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2023. [Google Scholar]
  35. Reis, S.A.; Calaça, K.L.; Nascente, E.D.P.; Damasceno, A.D.; Jayme, V.D.S.; Andrade, M.A. Identification and antimicrobial resistance of Salmonella enterica isolated from live birds at commercial resellers. Ciência Anim. Bras. 2020, 21, e64646. [Google Scholar] [CrossRef]
  36. Cortez, A.L.L.; Carvalho, A.D.F.D.; Ikuno, A.A.; Bürger, K.P.; Vidal-Martins, A.M.C. Resistência antimicrobiana de cepas de Salmonella spp. isoladas de abatedouros de aves. Arq. Inst. Biol. 2021, 73, 157–163. [Google Scholar] [CrossRef]
  37. Barcelos, M.M.; Martins, L.; Grenfell, R.C.; Juliano, L.; Anderson, K.L.; Santos, M.V.; Gonçalves, J.L. Comparison of Standard and On-Plate Extraction Protocols for Identification of Mastitis-Causing Bacteria by MALDI-TOF MS. Braz. J. Microbiol. 2019, 50, 849–857. [Google Scholar] [CrossRef] [PubMed]
  38. Salfinger, Y.; Tortorello, M.L. Compendium of Methods for the Microbiological Examination of Foods, 15th ed.; APHA Press: Washington, DC, USA, 2015; pp. 445–475. [Google Scholar]
  39. Souza, R.D.M. Resistência Antimicrobiana, Genes e Propriedades de Virulência em cepas de Salmonella enterica Sorotipo Enteritidis Isoladas de fontes Animais, Alimento e de Doença Humana no Brasil. Ph.D. Thesis, Universidade do Estado do Rio de Janeiro, Rio de Janeiro, Brazil, 2015. [Google Scholar]
  40. Soumet, C.; Ermel, G.; Rose, N.; Rose, V.; Drouin, P.; Salvat, G.; Colin, P. Evaluation of a multiplex PCR assay for simultaneous identification of Salmonella sp., Salmonella Enteritidis and Salmonella Typhimurium from environmental swabs of poultry houses. Lett. Appl. Microbiol. 1999, 28, 113–117. [Google Scholar] [CrossRef] [PubMed]
  41. Guerra, B.; Laconcha, I.; Soto, S.M.; González-Hevia, M.Á.; Mendoza, M.C. Molecular characterisation of emergent multiresistant Salmonella enterica serotype [4,5,12:i:−] organisms causing human salmonellosis. FEMS Microbiol. Lett. 2000, 190, 341–347. [Google Scholar] [CrossRef]
  42. Soto, S.M.; Rodríguez, I.; Rodicio, M.R.; Vila, J.; Mendoza, M.C. Detection of virulence determinants in clinical strains of Salmonella enterica serovar Enteritidis and mapping on macrorestriction profiles. J. Med. Microbiol. 2006, 55, 365–373. [Google Scholar] [CrossRef]
  43. Bohez, L.; Ducatelle, R.; Pasmans, F.; Botteldoorn, N.; Haesebrouck, F.; Van Immerseel, F. Salmonella enterica serovar Enteritidis colonization of the chicken caecum requires the HilA regulatory protein. Vet. Microbiol. 2006, 116, 202–210. [Google Scholar] [CrossRef]
  44. Kiss, T.; Morgan, E.; Nagy, G. Contribution of SPI-4 genes to the virulence of Salmonella enterica. FEMS Microb. Lett. 2007, 275, 153–159. [Google Scholar] [CrossRef]
  45. Fardini, Y.; Chettab, K.; Grépinet, O.; Rochereau, S.; Trotereau, J.; Harvey, P.; Amy, M.; Bottreau, E.; Bumstead, N.; Barrow, P.A.; et al. The YfgL Lipoprotein is Essential for Type III Secretion System Expression and Virulence of Salmonella enterica Serovar Enteritidis. Infect Immun. 2007, 75, 358–370. [Google Scholar] [CrossRef]
  46. Dallenne, C.; Da Costa, A.; Decré, D.; Favier, C.; Arlet, G. Development of a set of multiplex PCR assays for the detection of genes encoding important β-lactamases in Enterobacteriaceae. J. Antimicrob. Chemother. 2010, 65, 490–495. [Google Scholar] [CrossRef]
  47. Hasman, H.; Mevius, D.; Veldman, K.; Olesen, I.; Aarestrup, F.M. β-Lactamases among extended-spectrum β-lactamase (ESBL)-resistant Salmonella from poultry, poultry products and human patients in The Netherlands. J. Antimicrob. Chemother. 2005, 56, 115–121. [Google Scholar] [CrossRef] [PubMed]
  48. Costa, F.J.V.; Ribeiro, R.E.; Souza, C.A.; Navarro, R.D. Birds Species Trafficked in Brazil: A Meta-Analysis with Emphasis on Threatened Species. Fronteiras 2018, 7, 324–346. [Google Scholar] [CrossRef]
  49. Wang, X.; Biswas, S.; Paudyal, N.; Pan, H.; Li, X.; Fang, W.; Yue, M. Antibiotic Resistance in Salmonella Typhimurium Isolates Recovered from the Food Chain through National Antimicrobial Resistance Monitoring System Between 1996 and 2016. Front. Microbiol. 2019, 10, 985. [Google Scholar] [CrossRef]
  50. Seribelli, A.A.; Cruz, M.F.; Vilela, F.P.; Frazão, M.R.; Paziani, M.H.; Almeida, F.; Medeiros, M.I.C.; Rodrigues, D.P.; Kress, M.R.Z.; Allard, M.W.; et al. Phenotypic and Genotypic Characterization of Salmonella Typhimurium Isolates from Humans and Foods in Brazil. PLoS ONE 2020, 15, e0236868. [Google Scholar] [CrossRef]
  51. Fischer, E.F.; Müller, R.; Todte, M.; Taubert, A.; Hermosilla, C. Role of Free-Ranging Synanthropic Egyptian Geese (Alopochen aegyptiaca) as Natural Host Reservoirs for Salmonella spp. in Germany. Animals 2023, 13, 3403. [Google Scholar] [CrossRef] [PubMed]
  52. Corradini, C.; De Bene, A.F.; Russini, V.; Carfora, V.; Alba, P.; Cordaro, G.; Senese, M.; Terracciano, G.; Fabbri, I.; Di Sirio, A.; et al. Detection of Salmonella Reservoirs in Birds of Prey Hosted in an Italian Wildlife Centre: Molecular and Antimicrobial Resistance Characterisation. Microorganisms 2024, 12, 1169. [Google Scholar] [CrossRef]
  53. Kobuszewska, A.; Wysok, B. Pathogenic Bacteria in Free-Living Birds, and Its Public Health Significance. Animals 2024, 14, 968. [Google Scholar] [CrossRef]
  54. Beleza, A.J.F.; Maciel, W.C.; Lopes, E.S.; Albuquerque, A.H.; Carreira, A.S.; Nogueira, C.H.G.; Bandeira, J.M.; Vasconcelos, R.H.; Teixeira, R.S.C. Evidence of the Role of Free-Living Birds as Disseminators of Salmonella spp. Arq. Inst. Biol. 2020, 87, e0462019. [Google Scholar] [CrossRef]
  55. Silva, J.M.C. Seasonal Movements and Conservation of Seedeaters of the Genus Sporophila in South America. Stud. Avian Biol. 1999, 19, 272–280. [Google Scholar]
  56. Trouwborst, A.; McCormack, P.C.; Camacho, E.M. Domestic Cats and Their Impacts on Biodiversity: A Blind Spot in the Application of Nature Conservation Law. People Nat. 2020, 2, 235–250. [Google Scholar] [CrossRef]
  57. Steenackers, H.; Hermans, K.; Vanderleyden, J.; Keersmaecker, S.C.J. Salmonella Biofilms: An Overview on Occurrence, Structure, Regulation and Eradication. Food Res. Int. 2012, 45, 502–531. [Google Scholar] [CrossRef]
  58. Bueno, D.J.; Rodríguez, F.I.; Machado, L.C.; Soria, M.A.; Procura, F.; Gómez, S.C.; Hoffmann, T.M.; Alcain, A.; Caffer, M.I.; Latorre, J.D.; et al. Study of Salmonella spp. from Cage Papers Belonging to Pet Birds in an Argentinean Canary Breeder Championship. Animals 2024, 14, 1207. [Google Scholar] [CrossRef] [PubMed]
  59. Morais, R.; Costa, C.; Bravo, E.; Santana, A.; Félix, S.; Sant’Ana, G.; Baptista, L.; Sant´Ana, C. Avaliação Sanitária do Setor de Quarentena do Centro de Triagem de Animais Silvestres de Goiânia (Goiás). Rev. Process. Químicos 2013, 7, 73–80. [Google Scholar] [CrossRef]
  60. Shu, G.; Qiu, J.; Zheng, Y.; Chang, L.; Li, H.; Xu, F.; Zhang, W.; Yin, L.; Fu, H.; Yan, Q.; et al. Association between Phenotypes of Antimicrobial Resistance, ESBL Resistance Genes, and Virulence Genes of Salmonella Isolated from Chickens in Sichuan, China. Animals 2023, 13, 2770. [Google Scholar] [CrossRef] [PubMed]
  61. Sorour, H.; Badr, H.; Abdelaty, M.; Roshdy, H.; Mohammed, A.; AbdelRahman, M. Virulence Range and New Pathological Pictures of Salmonella enteridits and Salmonella Typhimurium Isolated from Ducklings in Experimental Infected Chicks. J. Appl. Vet. Sci. 2023, 8, 45–56. [Google Scholar] [CrossRef]
  62. van Asten, A.J.; van Dijk, J.E. Distribution of “Classic” Virulence Factors Among Salmonella spp. FEMS Immunol. Med. Microbiol. 2005, 44, 251–259. [Google Scholar] [CrossRef]
  63. Guiney, D.G.; Fierer, J. The role of the spv genes in Salmonella pathogenesis. Front. Microbiol. 2011, 2, 129. [Google Scholar] [CrossRef]
  64. Silva, N.; Junqueira, V.C.A.; Silveira, N.F.A.; Taniwaki, M.H.; Santos, R.F.S.; Gomes, R.A.R. Manual de Métodos de Análise Microbiológica de Alimentos e Água, 4th ed.; Livraria Varela: São Paulo, Brazil, 2010. [Google Scholar]
  65. Santos, E.J.E.D.; Lopes, A.T.S.; Fehlberg, H.F.; Rocha, J.M.; Brito Júnior, P.D.A.; Bernardes, F.C.S.; Costa, T.D.S.O.; Guilherme, E.A.; Vleeschouwer, K.M.D.; Oliveira, L.D.C.; et al. Low Occurrence of Salmonella spp. in Wild Animals in Bahia, Brazil—Population Assessment and Characterization in the Caatinga and Atlantic Forest Biomes. Animals 2024, 14, 21. [Google Scholar] [CrossRef]
  66. Pissetti, C.; de Freitas Costa, E.; Zenato, K.S.; de Itapema Cardoso, M.R. Critically Important Antimicrobial Resistance Trends in Salmonella Derby and Salmonella Typhimurium Isolated from the Pork Production Chain in Brazil: A 16-Year Period. Pathogens 2022, 11, 905. [Google Scholar] [CrossRef]
  67. McDermott, P.F.; Tyson, G.H.; Kabera, C.; Chen, Y.; Li, C.; Folster, J.P.; Ayers, S.L.; Lam, C.; Tate, H.P.; Zhao, S. Whole-Genome Sequencing for Detecting Antimicrobial Resistance in Nontyphoidal Salmonella. Antimicrob. Agents Chemother. 2016, 60. [Google Scholar] [CrossRef]
  68. Queenan, A.M.; Bush, K. Carbapenemases: The Versatile β-Lactamases. Clin. Microbiol. Rev. 2007, 20, 440–458. [Google Scholar] [CrossRef] [PubMed]
  69. Zapun, A.; Contreras-Martel, C.; Vernet, T. Penicillin-binding proteins and β-lactam resistance. FEMS Microbiol. Rev. 2008, 32, 361–385. [Google Scholar] [CrossRef] [PubMed]
  70. Antunes, P.; Machado, J.; Sousa, J.C.; Peixe, L. Dissemination of Sulfonamide Resistance Genes (sul1, sul2, and sul3) in Portuguese Salmonella enterica Strains and Relation with Integrons. Antimicrob. Agents Chemother. 2005, 49, 836–839. [Google Scholar] [CrossRef] [PubMed]
  71. Nascimento, E.R.; Pereira, V.D.A.; Berchieri Jr, A.; Silva, E.N.; Di Fábio, J.; Sesti, L.; Zuanaze, M.A.F. Doenças das Aves, 2nd ed.; Fundação APINCO de Ciência e Tecnologia Avícola: Campinas, Brazil, 2009; pp. 435–471. [Google Scholar]
Vetsci 11 00582 g001
Figure 1. Body score of Sporophila genus birds and macroscopic appearance of esophagitis and ingluvitis caused by Salmonella Typhimurium. (A) Bird 1, male adult caboclinho (Sporophila bouvreuil), body score of 2 (on a scale of 1–5). (B) Bird 1, yellowish plaque 0.4 cm in diameter extending from the serosa to the mucosa of the esophagus and crop. (C) Bird 2, male adult papa-capim (Sporophila nigricollis), body score of 2 (on a scale of 1–5). (D) Bird 2, multifocal to coalescent yellowish plaques ranging from 0.1 cm to 0.3 cm in diameter on the mucosa and serosa of esophagus and crop. (E) Bird 3, male adult golado (Sporophila albogularis), body score of 3 (on a scale of 1–5). (F) Bird 3, multifocal to coalescent yellowish plaques ranging from 0.2 cm to 0.3 cm in diameter on the mucosa and serosa of the esophagus and crop.
Figure 1. Body score of Sporophila genus birds and macroscopic appearance of esophagitis and ingluvitis caused by Salmonella Typhimurium. (A) Bird 1, male adult caboclinho (Sporophila bouvreuil), body score of 2 (on a scale of 1–5). (B) Bird 1, yellowish plaque 0.4 cm in diameter extending from the serosa to the mucosa of the esophagus and crop. (C) Bird 2, male adult papa-capim (Sporophila nigricollis), body score of 2 (on a scale of 1–5). (D) Bird 2, multifocal to coalescent yellowish plaques ranging from 0.1 cm to 0.3 cm in diameter on the mucosa and serosa of esophagus and crop. (E) Bird 3, male adult golado (Sporophila albogularis), body score of 3 (on a scale of 1–5). (F) Bird 3, multifocal to coalescent yellowish plaques ranging from 0.2 cm to 0.3 cm in diameter on the mucosa and serosa of the esophagus and crop.
Vetsci 11 00582 g001
Vetsci 11 00582 g002
Figure 2. Histopathology of esophagitis caused by Salmonella Typhimurium in a Caboclinho (Sporophila bouvreuil). (A–C) The crop exhibits multifocal areas of ulceration on the mucosal surface and necrosis in the submucosa (arrow), associated with heterophils, fibrin, and bacterial aggregates (asterisk). Observed under a 4× objective lens (A), 10× objective lens (B), and 40× objective lens (C). All images stained with hematoxylin and eosin.
Figure 2. Histopathology of esophagitis caused by Salmonella Typhimurium in a Caboclinho (Sporophila bouvreuil). (A–C) The crop exhibits multifocal areas of ulceration on the mucosal surface and necrosis in the submucosa (arrow), associated with heterophils, fibrin, and bacterial aggregates (asterisk). Observed under a 4× objective lens (A), 10× objective lens (B), and 40× objective lens (C). All images stained with hematoxylin and eosin.
Vetsci 11 00582 g002
Vetsci 11 00582 g003
Figure 3. Histopathology of ingluvitis caused by Salmonella Typhimurium in a Papa-capim (Sporophila nigricollis). (A–C) The crop exhibits an extensive area of ulceration with adjacent necrosis, associated with heterophils, macrophages, fibrin, and bacterial aggregates. Observed under a 4× objective lens (A), 10× objective lens (B), and 40× objective lens (C). All images stained with hematoxylin and eosin.
Figure 3. Histopathology of ingluvitis caused by Salmonella Typhimurium in a Papa-capim (Sporophila nigricollis). (A–C) The crop exhibits an extensive area of ulceration with adjacent necrosis, associated with heterophils, macrophages, fibrin, and bacterial aggregates. Observed under a 4× objective lens (A), 10× objective lens (B), and 40× objective lens (C). All images stained with hematoxylin and eosin.
Vetsci 11 00582 g003
Table 1. Primers used for the identification of virulence genes of Salmonella Typhimurium causing esophagitis and ingluvitis in birds of the genus Sporophila.
Table 1. Primers used for the identification of virulence genes of Salmonella Typhimurium causing esophagitis and ingluvitis in birds of the genus Sporophila.
GeneOligonucleotide Sequence (5′-3′)bpReference
sefAF: AGGTTCAGGCAGCGGTTACT312[40]
R: GGGACATTTAGCGTTTCTTG
invAF: TGCCTACAAGCATGAAATGG500[41]
R: AAACTGGACCACGGTACAA
slyAF: GCCAAAACTGAAGCTACAGGTG700
R: GTATCGACCACCACGATGGTT
phoP/QF: ATGCAAAGCCCGACCATGACG299
R: GTATCGACCACCACGATGGTT
orgAF: GATAAGGCGAAATCGTCAAATG540[42]
R: GTAAGGCCAGTAGCAAAATTG
mgtCF: TGACTATCAATGCTCCAGTGAAT655
R: ATTTACTGGCCGCTATGCTGTTG
spvCF: ACTCCTTGCACAACCAAATGCGGA424
R: TGTCTTCTGCATTTCGCCACCATCA
stnF: TTAGGTTGATGCTTATGATGGACACCC617
R: CGTGATGAATAAAGATACTCATAGG
ssaQF: GAATAGCGAATGAAGAGCGTCC677
R: CATCGTGTTATCCTCTGTCAGC
sopBF: GATGTGATTAATGAAGAAATGCC1170[43]
R: GCAAACCATAAAAACTACACTCA
HilAF:GGATCAGGTTCAATCCGAGA500
R: AGTAAGGCGCAATGCTGTTT
sipAF: CAAACGTTGATACCCCTGCT766
R: CGGTCGTACCGGCTTTATTA
SiiEF: GCGCAAAAGTTTCTCTTTCCGGG608[44]
R:TTTCTGGTTAGTTATCGGCAGAGTAAACTCTTCT
sseAF: TTCACCAAATCCGGGCTA135[45]
R: TCTCGGCCTCCTGGTTAA
SsrBF: CTTAGTCTACCTGGCATCAATGGC177
R: CGCTAACAGAACTTGCTGACTACTGC
F: forward primer; R: reverse primer; pb: base pair.
Table 2. Primers to identify extended spectrum beta-lactamase (ESBL) genes in Salmonella Typhimurium causing esophagitis and ingluvitis in birds of the genus Sporophila.
Table 2. Primers to identify extended spectrum beta-lactamase (ESBL) genes in Salmonella Typhimurium causing esophagitis and ingluvitis in birds of the genus Sporophila.
GeneOligonucleotide Sequence (5′-3′)bpReference
blaTEMF: CATTTCCGTGTCGCCCTTATTC800[39,46]
R: CGTTCATCCATAGTTGCCTGAC
blaSHVF: AGCCGCTTGAGCAAATTAAAC713
R: ATCCCGCAGATAAATCACCAC
blaOXAF: GGCACCAGATTCAACTTTCAAG564
R: GACCCCAAGTTTCCTGTAAGTG
blaCTX-M-1F: CGTTAACGGCACGATGAC688
R: CGATATCGTTGGTGGTRCCAT
blaCTX-M-2F: TTAGGTTGATGCTTATGATGGACACCC404
R: CGATATCGTTGGTGGTRCCAT
blaCTX-M-9F: TCAAGCCTGCCGATCTGGT561
R: TGATTCTCGCCGCTGAAG
blaCTX-M8/25F: AACRCRCAGACGCTCTAC326
F: TCGAGCCGGAASGTGTYAT
blaCMY-2R: GCACTTAGCCACCTATACGGCAG920[47]
F: GCTTTTCAAGAATGCGCCAGG
F: forward primer; R: reverse primer; pb: base pair.
Table 3. Antibiogram of bacterial cultures from birds of the genus Sporophila, necropsied with esophagitis and ingluvitis lesions caused by Salmonella Typhimurium, as well as cultures from the enclosures and cages where these birds were quarantined.
Table 3. Antibiogram of bacterial cultures from birds of the genus Sporophila, necropsied with esophagitis and ingluvitis lesions caused by Salmonella Typhimurium, as well as cultures from the enclosures and cages where these birds were quarantined.
Class            AntibioticBird 1Bird 2Bird 3Encl. 2Cag. 2
AmpicillinRRRRR
Amoxicillin + ClavulanateRRRRR
AmoxicillinRRRRR
SulfonamidesTrimethoprim-sulfamethoxazoleSSRSS
TrimethoprimSSRSS
SulfamethoxazoleSSSSS
Phenicoles         ChloramphenicolSSSSS
GentamicinSSSSS
StreptomycinRRRRR
Carbapenems       MeropenemSSSSS
Nalidixic AcidSSSSS
CiprofloxacinSSSSS
Monobactams       AztreonamRSSSS
Tetracycline          TetracyclineRRRRR
CefazolinSSSRR
Cephalosporins 1st
Cephalexin RRSSS
Cephalosporins 2st      CefoxitinSSSSS
CeftriaxoneSSSSS
CefotaximeRSSSS
Table 4. Results of the matrix-assisted laser desorption ionization-time of flight (MALDI-TOF mass spectrometry) technique on bacterial cultures from birds of the genus Sporophila, necropsied with esophagitis and ingluvitis lesions caused by Salmonella Typhimurium.
Table 4. Results of the matrix-assisted laser desorption ionization-time of flight (MALDI-TOF mass spectrometry) technique on bacterial cultures from birds of the genus Sporophila, necropsied with esophagitis and ingluvitis lesions caused by Salmonella Typhimurium.
Bird 1Bird 2Bird 3
Identified BacteriumSalmonella sp. Enterococcus faecalisSalmonella sp.Salmonella sp.
Bird 1: Sporophila bouvreuil; Bird 2: Sporophila nigricollis; Bird 3: Sporophila albogularis.
Table 5. Serotyping of bacterial cultures from birds of the genus Sporophila, necropsied with lesions of esophagitis and ingluvitis caused by Salmonella Typhimurium, as well as cultures from the enclosures and cages where these birds were quarantined.
Table 5. Serotyping of bacterial cultures from birds of the genus Sporophila, necropsied with lesions of esophagitis and ingluvitis caused by Salmonella Typhimurium, as well as cultures from the enclosures and cages where these birds were quarantined.
SampleSerotyping
Bird 1Salmonella enterica subesp. enterica (O:4,5) *
Bird 2Salmonella ser. Typhimurium
Bird 3Salmonella ser. Typhimurium
Cage 2Salmonella enterica subesp. enterica *
Enclosure 2Salmonella enterica subesp. enterica (O:4,5) *
*: Flagellar structure not identifiable.
Table 6. Virulence genes in bacterial cultures from birds of the genus Sporophila, necropsied with lesions of esophagitis and ingluvitis caused by Salmonella Typhimurium, as well as cultures from the enclosure and cage where these birds were quarantined.
Table 6. Virulence genes in bacterial cultures from birds of the genus Sporophila, necropsied with lesions of esophagitis and ingluvitis caused by Salmonella Typhimurium, as well as cultures from the enclosure and cage where these birds were quarantined.
SampleGenes
Bird 1orgA, inA, ssaQ, mgtC, sopB, stn, spvC
Bird 2orgA, inA, ssaQ, mgtC, sopB, stn, spvC
Bird 3orgA, inA, ssaQ, mgtC, sopB, stn, spvC
Cage 2orgA, inA, ssaQ, mgtC, sopB, stn, spvC
Enclosure 2orgA, inA, ssaQ, mgtC, sopB, stn, spvC
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Soares, K.L.; Lucena, R.B.; Lima, E.S.; Firmino, M.d.O.; Eloy, L.R.C.; Silva, R.A.F.; Sousa, M.S.; Sousa, I.V.; Silva, W.D.Q.; Fernandes, A.C.d.C.; et al. Outbreak of Esophagitis and Ingluvitis Caused by Salmonella Typhimurium in Passeriform Birds of the Genus Sporophila Seized from Wildlife Trafficking. Vet. Sci. 2024, 11, 582. https://doi.org/10.3390/vetsci11110582

AMA Style

Soares KL, Lucena RB, Lima ES, Firmino MdO, Eloy LRC, Silva RAF, Sousa MS, Sousa IV, Silva WDQ, Fernandes ACdC, et al. Outbreak of Esophagitis and Ingluvitis Caused by Salmonella Typhimurium in Passeriform Birds of the Genus Sporophila Seized from Wildlife Trafficking. Veterinary Sciences. 2024; 11(11):582. https://doi.org/10.3390/vetsci11110582

Chicago/Turabian Style

Soares, Karoline L., Ricardo B. Lucena, Ewerton S. Lima, Millena de O. Firmino, Lilian R. C. Eloy, Raquel Annes F. Silva, Mônica S. Sousa, Isabelle V. Sousa, Weslley Drayton Q. Silva, Artur Cezar de C. Fernandes, and et al. 2024. "Outbreak of Esophagitis and Ingluvitis Caused by Salmonella Typhimurium in Passeriform Birds of the Genus Sporophila Seized from Wildlife Trafficking" Veterinary Sciences 11, no. 11: 582. https://doi.org/10.3390/vetsci11110582

APA Style

Soares, K. L., Lucena, R. B., Lima, E. S., Firmino, M. d. O., Eloy, L. R. C., Silva, R. A. F., Sousa, M. S., Sousa, I. V., Silva, W. D. Q., Fernandes, A. C. d. C., & Ramos-Sanchez, E. M. (2024). Outbreak of Esophagitis and Ingluvitis Caused by Salmonella Typhimurium in Passeriform Birds of the Genus Sporophila Seized from Wildlife Trafficking. Veterinary Sciences, 11(11), 582. https://doi.org/10.3390/vetsci11110582

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop