Outbreak of Esophagitis and Ingluvitis Caused by Salmonella Typhimurium in Passeriform Birds of the Genus Sporophila Seized from Wildlife Trafficking
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Birds
2.2. Necropsy and Histological Evaluation
2.3. Microbiology
2.3.1. Bird Samples
2.3.2. Microbiological Environmental Samples
2.3.3. Antimicrobial Susceptibility Testing
2.4. MALDI-TOF Mass Spectrometry
2.5. Serotyping
2.6. Polymerase Chain Reaction (PCR) and Bacterial DNA Amplification
2.7. Amplification of Extended Spectrum Beta-Lactamase (ESBL) Genes
3. Results
3.1. Macroscopic and Histopathological Lesions
3.2. Microbiology and Antibiogram
3.3. MALDI-TOF Mass Spectrometry Results
3.4. Serotyping Results
3.5. Identification of Virulence Genes and Characterization of Extended Spectrum Beta-Lactamase (ESBL) Genes
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Regueira, R.F.S.; Bernard, E. Wildlife sinks: Quantifying the impact of illegal bird trade in street markets in Brazil. Biol. Conserv. 2012, 149, 16–22. [Google Scholar] [CrossRef]
- Nascimento, C.J.; Oliveira, A.M.; Santos, W.M.; Araújo, J.L.; Rola, L.D.; Guerra, R.R. Body condition, external morphology, parasitology, and histological and biometrical study of the gastro-intestinal tract of Sporophila nigricollis and Sporophila caerulescens seized from trafficking in Northeastern Brazil. Pesqui. Vet. Bras. 2024, 44, e07358. [Google Scholar] [CrossRef]
- Siqueira, R.A.S.; de Lucena, R.B.; Cavalcanti, T.A.; de Lima Luna, A.C.; de Oliveira Firmino, M.; Guerra, R.R. Aspectos clínico-patológicos em papagaios-verdadeiros (Amazona aestiva, L. 1758) oriundos de apreensões do tráfico no estado da Paraíba, Brasil. Braz. J. Vet. Med. 2016, 38, 439–444. [Google Scholar]
- Campos, J.A.; Guizelini, C.C.; Pavarini, S.P.; Azuaga, L.; Souza, M.L.; Leal, C.R.B.; Ramos, C.A.N.; Gomes, D.C. Pathological Aspects of a Septicemic Salmonellosis Outbreak Caused by Salmonella Serotype Typhimurium in Captive Blue-Fronted Amazon Parrots (Amazona aestiva). Pesqui. Vet. Bras. 2024, 44, e07428. [Google Scholar] [CrossRef]
- Tindall, B.J.; Grimont, P.A.D.; Garrity, G.M.; Euzeby, J.P. Nomenclature and Taxonomy of the Genus Salmonella. Int. J. Syst. Evol. Microbiol. 2005, 55, 521–524. [Google Scholar] [CrossRef] [PubMed]
- Trabulsi, L.R.; Alterthum, F. Microbiologia, 6th ed.; Editora Atheneu: São Paulo, Brazil, 2015; pp. 351–360. [Google Scholar]
- Issenhuth-Jeanjean, S.; Roggentin, P.; Mikoleit, M.; Guibourdenche, M.; De Pinna, E.; Nair, S.; Fields, P.I.; Weill, F. Supplement 2008–2010 (no. 48) to the White-Kauffmann-Le Minor Scheme. Res. Microbiol. 2014, 165, 526–530. [Google Scholar] [CrossRef]
- Guibourdenche, M.; Roggentin, P.; Mikoleit, M.; Fields, P.I.; Bockemuhl, J.; Grimont, P.A.D.; Weill, F.X.; Issenhuth-Jeanjean, S. Supplement 2003–2007 (No. 47) to the White-Kauffmann-Le Minor Scheme. Res. Microbiol. 2010, 161, 26–29. [Google Scholar] [CrossRef]
- Hassan, A.H.A.; Salam, H.S.H.; Abdel-Latef, G.K. Serological Identification and Antimicrobial Resistance of Salmonella Isolates from Broiler Carcasses and Human Stools in Beni-Suef, Egypt. Beni-Suef Univ. J. Basic Appl. Sci. 2016, 5, 202–207. [Google Scholar] [CrossRef]
- Braga, P.R.C.; Basso, R.M.; Martins, L.S.A. Occurrence of Salmonella spp. in Fecal Samples from Foals with and without Diarrhea in the State of São Paulo: Microbiological Diagnosis, Antimicrobial Susceptibility Profile, and Molecular Detection. Pesqui. Vet. Bras. 2023, 43, e07194. [Google Scholar] [CrossRef]
- Pinto, P.N.; Torres, A.C.D.; Rodrigues, M.P.; Oliveira, L.B.; Costa, C.S.; Ecco, R.; Freitas Neto, O.C.; Martins, N.R.S. An Outbreak of Fatal Pullorum Disease (Salmonella Pullorum) in Guinea Fowl Keets (Numida meleagris). Pesqui. Vet. Bras. 2023, 43, e07088. [Google Scholar] [CrossRef]
- Forsythe, S.J. Microbiologia Segurança Alimentos, 2nd ed.; Artmed: Porto Alegre, Brazil, 2013. [Google Scholar]
- Thomas, N.J.; Hunter, D.B.; Atkinson, C.T. Infectious Diseases of Wild Birds; Blackwell Publishing: Ames, IA, USA, 2007; pp. 270–288. [Google Scholar]
- Giovannini, S.; Pewsner, M.; Hüssy, D.; Hächler, H.; Degiorgis, M.-P.R.; Hirschheydt, J.; Origgi, F.C. Epidemic of Salmonellosis in Passerine Birds in Switzerland with Spillover to Domestic Cats. Vet. Pathol. 2013, 50, 597–606. [Google Scholar] [CrossRef] [PubMed]
- Silva, C.; Calva, E.; Maloy, S. One Health and Food-Borne Disease: Salmonella Transmission between Humans, Animals, and Plants. Microbiol. Spectr. 2014, 2, 1. [Google Scholar] [CrossRef] [PubMed]
- Söderlund, R.; Jernberg, C.; Trönnberg, L.; Pääjärvi, A.; Agren, E.; Lahti, E. Linked Seasonal Outbreaks of Salmonella Typhimurium among Passerine Birds, Domestic Cats, and Humans, Sweden, 2009 to 2016. Eurosurveillance 2019, 24, 1900074. [Google Scholar] [CrossRef] [PubMed]
- Tizard, I.R. Salmonellosis in Wild Birds. Semin. Avian Exot. Pet Med. 2004, 13, 50–66. [Google Scholar] [CrossRef]
- Kapperud, G.; Stenwig, H.; Lassen, J. Epidemiology of Salmonella Typhimurium 0:4-12 Infection in Norway. Am. J. Epidemiol. 1998, 147, 774–782. [Google Scholar] [CrossRef]
- Refsump, T.; Vikoren, T.; Handeland, K.; Kapperud, G.; Holstad, G. Epidemiologic and Pathologic Aspects of Salmonella Typhimurium Infection in Passerine Birds in Norway. J. Wildl. Dis. 2003, 39, 64–72. [Google Scholar] [CrossRef]
- Tauni, M.A.; Österlund, A. Outbreak of Salmonella Typhimurium in Cats and Humans Associated with Infection in Wild Birds. J. Small Anim. Pract. 2000, 41, 339–341. [Google Scholar] [CrossRef]
- Hughes, L.A.; Shopland, S.; Wigley, P.; Bradon, H.; Leatherbarrow, A.H.; Williams, N.J.; Bennett, M.; Pinna, E.; Lawson, B.; Cunningham, A.A.; et al. Characterisation of Salmonella enterica Serotype Typhimurium Isolates from Wild Birds in Northern England from 2005–2006. BMC Vet. Res. 2008, 4, 4. [Google Scholar] [CrossRef]
- Lawson, B.; Howard, T.; Kirkwood, J.K.; Macgregor, S.K.; Perkins, M.; Robinson, R.A.; Ward, L.R.; Cunningham, A.A. Epidemiology of Salmonellosis in Garden Birds in England and Wales, 1993 to 2003. EcoHealth 2010, 7, 294–306. [Google Scholar] [CrossRef]
- Mather, A.E.; Lawson, B.; Pinna, E.; Wigley, P.; Parkhill, J.; Thomson, N.R.; Page, A.J.; Holmes, M.A.; Paterson, G.K. Genomic Analysis of Salmonella enterica Serovar Typhimurium from Wild Passerines in England and Wales. Appl. Environ. Microbiol. 2016, 82, 6728–6735. [Google Scholar] [CrossRef]
- Locke, L.N.; Shillinger, R.B.; Jareed, T. Salmonellosis in Passerine Birds in Maryland and West Virginia. J. Wildl. Dis. 1973, 9, 144–145. [Google Scholar] [CrossRef] [PubMed]
- Hall, A.J.; Saito, E.K. Avian Wildlife Mortality Events Due to Salmonellosis in the United States, 1985–2004. J. Wildl. Dis. 2008, 44, 585–593. [Google Scholar] [CrossRef] [PubMed]
- Hernandez, S.M.; Keel, K.; Sanchez, S.; Trees, E.; Gerner-Smidt, P.; Adams, J.K.; Cheng, Y.; Ray, A.; Martin, G.; Presotto, A.; et al. Epidemiology of a Salmonella enterica subsp. enterica Serovar Typhimurium Strain Associated with a Songbird Outbreak. Appl. Environ. Microbiol. 2012, 78, 7290–7298. [Google Scholar] [CrossRef] [PubMed]
- Matias, C.A.R.; Pereira, I.A.; Araújo, M.S.; Santos, A.F.M.; Lopes, R.P.; Christakis, S.; Rodrigues, D.P.; Siciliano, S. Characteristics of Salmonella spp. Isolated from Wild Birds Confiscated in Illegal Trade Markets, Rio de Janeiro, Brazil. BioMed Res. Int. 2016, 2016, 3416864. [Google Scholar] [CrossRef] [PubMed]
- Brunthaler, R.; Spergser, J.; Weissenböck, H. Multiple Epidemics in Austrian Fringillidae Caused by a Single Variant of Salmonella Typhimurium. J. Wildl. Dis. 2021, 57, 891–899. [Google Scholar] [CrossRef]
- Daoust, P.Y.; Busby, D.G.; Ferns, L.; Goltz, J.; McBurney, S.; Poppe, C.; Whitney, H. Salmonellosis in Songbirds in the Canadian Atlantic Provinces During Winter-Summer 1997–1998. Can. Vet. J. 2000, 41, 54–59. [Google Scholar]
- Alley, M.R.; Connolly, J.H.; Fenwick, S.G.; Mackereth, G.F.; Leyland, M.J.; Rogers, L.E.; Haycock, M.; Nicol, C.; Reed, C.E.M. An Epidemic of Salmonellosis Caused by Salmonella Typhimurium DT160 in Wild Birds and Humans in New Zealand. N. Z. Vet. J. 2002, 50, 170–176. [Google Scholar] [CrossRef]
- Une, Y.; Sanbe, A.; Suzuki, S.; Niwa, T.; Kawakami, K.; Kurosawa, R.; Izumiya, H.; Watanabe, H.; Kato, Y. Salmonella enterica Serotype Typhimurium Infection Causing Mortality in Eurasian Tree Sparrows (Passer montanus) in Hokkaido. Jpn. J. Infect. Dis. 2008, 61, 166–167. [Google Scholar] [CrossRef]
- Fukui, D.; Takahashi, K.; Kubo, M.; Une, Y.; Kato, Y.; Izumiya, H.; Teraoka, H.; Asakawa, M.; Yanagida, K.; Bando, G. Mass Mortality of Eurasian Tree Sparrows (Passer montanus) from Salmonella Typhimurium DT40 in Japan, Winter 2008–2009. J. Wildl. Dis. 2014, 50, 484–495. [Google Scholar] [CrossRef]
- Krawiec, M.; Pietkiewicz, M.; Wieliczko, A. Salmonella spp. as a Cause of Mortality and Clinical Symptoms in Free-Living Garden Bird Species in Poland. Pol. J. Vet. Sci. 2014, 17, 729–731. [Google Scholar] [CrossRef]
- CLSI. Performance Standards for Antimicrobial Susceptibility Testing, 33rd ed.; CLSI Supplement M100; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2023. [Google Scholar]
- Reis, S.A.; Calaça, K.L.; Nascente, E.D.P.; Damasceno, A.D.; Jayme, V.D.S.; Andrade, M.A. Identification and antimicrobial resistance of Salmonella enterica isolated from live birds at commercial resellers. Ciência Anim. Bras. 2020, 21, e64646. [Google Scholar] [CrossRef]
- Cortez, A.L.L.; Carvalho, A.D.F.D.; Ikuno, A.A.; Bürger, K.P.; Vidal-Martins, A.M.C. Resistência antimicrobiana de cepas de Salmonella spp. isoladas de abatedouros de aves. Arq. Inst. Biol. 2021, 73, 157–163. [Google Scholar] [CrossRef]
- Barcelos, M.M.; Martins, L.; Grenfell, R.C.; Juliano, L.; Anderson, K.L.; Santos, M.V.; Gonçalves, J.L. Comparison of Standard and On-Plate Extraction Protocols for Identification of Mastitis-Causing Bacteria by MALDI-TOF MS. Braz. J. Microbiol. 2019, 50, 849–857. [Google Scholar] [CrossRef] [PubMed]
- Salfinger, Y.; Tortorello, M.L. Compendium of Methods for the Microbiological Examination of Foods, 15th ed.; APHA Press: Washington, DC, USA, 2015; pp. 445–475. [Google Scholar]
- Souza, R.D.M. Resistência Antimicrobiana, Genes e Propriedades de Virulência em cepas de Salmonella enterica Sorotipo Enteritidis Isoladas de fontes Animais, Alimento e de Doença Humana no Brasil. Ph.D. Thesis, Universidade do Estado do Rio de Janeiro, Rio de Janeiro, Brazil, 2015. [Google Scholar]
- Soumet, C.; Ermel, G.; Rose, N.; Rose, V.; Drouin, P.; Salvat, G.; Colin, P. Evaluation of a multiplex PCR assay for simultaneous identification of Salmonella sp., Salmonella Enteritidis and Salmonella Typhimurium from environmental swabs of poultry houses. Lett. Appl. Microbiol. 1999, 28, 113–117. [Google Scholar] [CrossRef] [PubMed]
- Guerra, B.; Laconcha, I.; Soto, S.M.; González-Hevia, M.Á.; Mendoza, M.C. Molecular characterisation of emergent multiresistant Salmonella enterica serotype [4,5,12:i:−] organisms causing human salmonellosis. FEMS Microbiol. Lett. 2000, 190, 341–347. [Google Scholar] [CrossRef]
- Soto, S.M.; Rodríguez, I.; Rodicio, M.R.; Vila, J.; Mendoza, M.C. Detection of virulence determinants in clinical strains of Salmonella enterica serovar Enteritidis and mapping on macrorestriction profiles. J. Med. Microbiol. 2006, 55, 365–373. [Google Scholar] [CrossRef]
- Bohez, L.; Ducatelle, R.; Pasmans, F.; Botteldoorn, N.; Haesebrouck, F.; Van Immerseel, F. Salmonella enterica serovar Enteritidis colonization of the chicken caecum requires the HilA regulatory protein. Vet. Microbiol. 2006, 116, 202–210. [Google Scholar] [CrossRef]
- Kiss, T.; Morgan, E.; Nagy, G. Contribution of SPI-4 genes to the virulence of Salmonella enterica. FEMS Microb. Lett. 2007, 275, 153–159. [Google Scholar] [CrossRef]
- Fardini, Y.; Chettab, K.; Grépinet, O.; Rochereau, S.; Trotereau, J.; Harvey, P.; Amy, M.; Bottreau, E.; Bumstead, N.; Barrow, P.A.; et al. The YfgL Lipoprotein is Essential for Type III Secretion System Expression and Virulence of Salmonella enterica Serovar Enteritidis. Infect Immun. 2007, 75, 358–370. [Google Scholar] [CrossRef]
- Dallenne, C.; Da Costa, A.; Decré, D.; Favier, C.; Arlet, G. Development of a set of multiplex PCR assays for the detection of genes encoding important β-lactamases in Enterobacteriaceae. J. Antimicrob. Chemother. 2010, 65, 490–495. [Google Scholar] [CrossRef]
- Hasman, H.; Mevius, D.; Veldman, K.; Olesen, I.; Aarestrup, F.M. β-Lactamases among extended-spectrum β-lactamase (ESBL)-resistant Salmonella from poultry, poultry products and human patients in The Netherlands. J. Antimicrob. Chemother. 2005, 56, 115–121. [Google Scholar] [CrossRef] [PubMed]
- Costa, F.J.V.; Ribeiro, R.E.; Souza, C.A.; Navarro, R.D. Birds Species Trafficked in Brazil: A Meta-Analysis with Emphasis on Threatened Species. Fronteiras 2018, 7, 324–346. [Google Scholar] [CrossRef]
- Wang, X.; Biswas, S.; Paudyal, N.; Pan, H.; Li, X.; Fang, W.; Yue, M. Antibiotic Resistance in Salmonella Typhimurium Isolates Recovered from the Food Chain through National Antimicrobial Resistance Monitoring System Between 1996 and 2016. Front. Microbiol. 2019, 10, 985. [Google Scholar] [CrossRef]
- Seribelli, A.A.; Cruz, M.F.; Vilela, F.P.; Frazão, M.R.; Paziani, M.H.; Almeida, F.; Medeiros, M.I.C.; Rodrigues, D.P.; Kress, M.R.Z.; Allard, M.W.; et al. Phenotypic and Genotypic Characterization of Salmonella Typhimurium Isolates from Humans and Foods in Brazil. PLoS ONE 2020, 15, e0236868. [Google Scholar] [CrossRef]
- Fischer, E.F.; Müller, R.; Todte, M.; Taubert, A.; Hermosilla, C. Role of Free-Ranging Synanthropic Egyptian Geese (Alopochen aegyptiaca) as Natural Host Reservoirs for Salmonella spp. in Germany. Animals 2023, 13, 3403. [Google Scholar] [CrossRef] [PubMed]
- Corradini, C.; De Bene, A.F.; Russini, V.; Carfora, V.; Alba, P.; Cordaro, G.; Senese, M.; Terracciano, G.; Fabbri, I.; Di Sirio, A.; et al. Detection of Salmonella Reservoirs in Birds of Prey Hosted in an Italian Wildlife Centre: Molecular and Antimicrobial Resistance Characterisation. Microorganisms 2024, 12, 1169. [Google Scholar] [CrossRef]
- Kobuszewska, A.; Wysok, B. Pathogenic Bacteria in Free-Living Birds, and Its Public Health Significance. Animals 2024, 14, 968. [Google Scholar] [CrossRef]
- Beleza, A.J.F.; Maciel, W.C.; Lopes, E.S.; Albuquerque, A.H.; Carreira, A.S.; Nogueira, C.H.G.; Bandeira, J.M.; Vasconcelos, R.H.; Teixeira, R.S.C. Evidence of the Role of Free-Living Birds as Disseminators of Salmonella spp. Arq. Inst. Biol. 2020, 87, e0462019. [Google Scholar] [CrossRef]
- Silva, J.M.C. Seasonal Movements and Conservation of Seedeaters of the Genus Sporophila in South America. Stud. Avian Biol. 1999, 19, 272–280. [Google Scholar]
- Trouwborst, A.; McCormack, P.C.; Camacho, E.M. Domestic Cats and Their Impacts on Biodiversity: A Blind Spot in the Application of Nature Conservation Law. People Nat. 2020, 2, 235–250. [Google Scholar] [CrossRef]
- Steenackers, H.; Hermans, K.; Vanderleyden, J.; Keersmaecker, S.C.J. Salmonella Biofilms: An Overview on Occurrence, Structure, Regulation and Eradication. Food Res. Int. 2012, 45, 502–531. [Google Scholar] [CrossRef]
- Bueno, D.J.; Rodríguez, F.I.; Machado, L.C.; Soria, M.A.; Procura, F.; Gómez, S.C.; Hoffmann, T.M.; Alcain, A.; Caffer, M.I.; Latorre, J.D.; et al. Study of Salmonella spp. from Cage Papers Belonging to Pet Birds in an Argentinean Canary Breeder Championship. Animals 2024, 14, 1207. [Google Scholar] [CrossRef] [PubMed]
- Morais, R.; Costa, C.; Bravo, E.; Santana, A.; Félix, S.; Sant’Ana, G.; Baptista, L.; Sant´Ana, C. Avaliação Sanitária do Setor de Quarentena do Centro de Triagem de Animais Silvestres de Goiânia (Goiás). Rev. Process. Químicos 2013, 7, 73–80. [Google Scholar] [CrossRef]
- Shu, G.; Qiu, J.; Zheng, Y.; Chang, L.; Li, H.; Xu, F.; Zhang, W.; Yin, L.; Fu, H.; Yan, Q.; et al. Association between Phenotypes of Antimicrobial Resistance, ESBL Resistance Genes, and Virulence Genes of Salmonella Isolated from Chickens in Sichuan, China. Animals 2023, 13, 2770. [Google Scholar] [CrossRef] [PubMed]
- Sorour, H.; Badr, H.; Abdelaty, M.; Roshdy, H.; Mohammed, A.; AbdelRahman, M. Virulence Range and New Pathological Pictures of Salmonella enteridits and Salmonella Typhimurium Isolated from Ducklings in Experimental Infected Chicks. J. Appl. Vet. Sci. 2023, 8, 45–56. [Google Scholar] [CrossRef]
- van Asten, A.J.; van Dijk, J.E. Distribution of “Classic” Virulence Factors Among Salmonella spp. FEMS Immunol. Med. Microbiol. 2005, 44, 251–259. [Google Scholar] [CrossRef]
- Guiney, D.G.; Fierer, J. The role of the spv genes in Salmonella pathogenesis. Front. Microbiol. 2011, 2, 129. [Google Scholar] [CrossRef]
- Silva, N.; Junqueira, V.C.A.; Silveira, N.F.A.; Taniwaki, M.H.; Santos, R.F.S.; Gomes, R.A.R. Manual de Métodos de Análise Microbiológica de Alimentos e Água, 4th ed.; Livraria Varela: São Paulo, Brazil, 2010. [Google Scholar]
- Santos, E.J.E.D.; Lopes, A.T.S.; Fehlberg, H.F.; Rocha, J.M.; Brito Júnior, P.D.A.; Bernardes, F.C.S.; Costa, T.D.S.O.; Guilherme, E.A.; Vleeschouwer, K.M.D.; Oliveira, L.D.C.; et al. Low Occurrence of Salmonella spp. in Wild Animals in Bahia, Brazil—Population Assessment and Characterization in the Caatinga and Atlantic Forest Biomes. Animals 2024, 14, 21. [Google Scholar] [CrossRef]
- Pissetti, C.; de Freitas Costa, E.; Zenato, K.S.; de Itapema Cardoso, M.R. Critically Important Antimicrobial Resistance Trends in Salmonella Derby and Salmonella Typhimurium Isolated from the Pork Production Chain in Brazil: A 16-Year Period. Pathogens 2022, 11, 905. [Google Scholar] [CrossRef]
- McDermott, P.F.; Tyson, G.H.; Kabera, C.; Chen, Y.; Li, C.; Folster, J.P.; Ayers, S.L.; Lam, C.; Tate, H.P.; Zhao, S. Whole-Genome Sequencing for Detecting Antimicrobial Resistance in Nontyphoidal Salmonella. Antimicrob. Agents Chemother. 2016, 60. [Google Scholar] [CrossRef]
- Queenan, A.M.; Bush, K. Carbapenemases: The Versatile β-Lactamases. Clin. Microbiol. Rev. 2007, 20, 440–458. [Google Scholar] [CrossRef] [PubMed]
- Zapun, A.; Contreras-Martel, C.; Vernet, T. Penicillin-binding proteins and β-lactam resistance. FEMS Microbiol. Rev. 2008, 32, 361–385. [Google Scholar] [CrossRef] [PubMed]
- Antunes, P.; Machado, J.; Sousa, J.C.; Peixe, L. Dissemination of Sulfonamide Resistance Genes (sul1, sul2, and sul3) in Portuguese Salmonella enterica Strains and Relation with Integrons. Antimicrob. Agents Chemother. 2005, 49, 836–839. [Google Scholar] [CrossRef] [PubMed]
- Nascimento, E.R.; Pereira, V.D.A.; Berchieri Jr, A.; Silva, E.N.; Di Fábio, J.; Sesti, L.; Zuanaze, M.A.F. Doenças das Aves, 2nd ed.; Fundação APINCO de Ciência e Tecnologia Avícola: Campinas, Brazil, 2009; pp. 435–471. [Google Scholar]
Gene | Oligonucleotide Sequence (5′-3′) | bp | Reference |
---|---|---|---|
sefA | F: AGGTTCAGGCAGCGGTTACT | 312 | [40] |
R: GGGACATTTAGCGTTTCTTG | |||
invA | F: TGCCTACAAGCATGAAATGG | 500 | [41] |
R: AAACTGGACCACGGTACAA | |||
slyA | F: GCCAAAACTGAAGCTACAGGTG | 700 | |
R: GTATCGACCACCACGATGGTT | |||
phoP/Q | F: ATGCAAAGCCCGACCATGACG | 299 | |
R: GTATCGACCACCACGATGGTT | |||
orgA | F: GATAAGGCGAAATCGTCAAATG | 540 | [42] |
R: GTAAGGCCAGTAGCAAAATTG | |||
mgtC | F: TGACTATCAATGCTCCAGTGAAT | 655 | |
R: ATTTACTGGCCGCTATGCTGTTG | |||
spvC | F: ACTCCTTGCACAACCAAATGCGGA | 424 | |
R: TGTCTTCTGCATTTCGCCACCATCA | |||
stn | F: TTAGGTTGATGCTTATGATGGACACCC | 617 | |
R: CGTGATGAATAAAGATACTCATAGG | |||
ssaQ | F: GAATAGCGAATGAAGAGCGTCC | 677 | |
R: CATCGTGTTATCCTCTGTCAGC | |||
sopB | F: GATGTGATTAATGAAGAAATGCC | 1170 | [43] |
R: GCAAACCATAAAAACTACACTCA | |||
HilA | F:GGATCAGGTTCAATCCGAGA | 500 | |
R: AGTAAGGCGCAATGCTGTTT | |||
sipA | F: CAAACGTTGATACCCCTGCT | 766 | |
R: CGGTCGTACCGGCTTTATTA | |||
SiiE | F: GCGCAAAAGTTTCTCTTTCCGGG | 608 | [44] |
R:TTTCTGGTTAGTTATCGGCAGAGTAAACTCTTCT | |||
sseA | F: TTCACCAAATCCGGGCTA | 135 | [45] |
R: TCTCGGCCTCCTGGTTAA | |||
SsrB | F: CTTAGTCTACCTGGCATCAATGGC | 177 | |
R: CGCTAACAGAACTTGCTGACTACTGC |
Gene | Oligonucleotide Sequence (5′-3′) | bp | Reference |
---|---|---|---|
blaTEM | F: CATTTCCGTGTCGCCCTTATTC | 800 | [39,46] |
R: CGTTCATCCATAGTTGCCTGAC | |||
blaSHV | F: AGCCGCTTGAGCAAATTAAAC | 713 | |
R: ATCCCGCAGATAAATCACCAC | |||
blaOXA | F: GGCACCAGATTCAACTTTCAAG | 564 | |
R: GACCCCAAGTTTCCTGTAAGTG | |||
blaCTX-M-1 | F: CGTTAACGGCACGATGAC | 688 | |
R: CGATATCGTTGGTGGTRCCAT | |||
blaCTX-M-2 | F: TTAGGTTGATGCTTATGATGGACACCC | 404 | |
R: CGATATCGTTGGTGGTRCCAT | |||
blaCTX-M-9 | F: TCAAGCCTGCCGATCTGGT | 561 | |
R: TGATTCTCGCCGCTGAAG | |||
blaCTX-M8/25 | F: AACRCRCAGACGCTCTAC | 326 | |
F: TCGAGCCGGAASGTGTYAT | |||
blaCMY-2 | R: GCACTTAGCCACCTATACGGCAG | 920 | [47] |
F: GCTTTTCAAGAATGCGCCAGG |
Class Antibiotic | Bird 1 | Bird 2 | Bird 3 | Encl. 2 | Cag. 2 | |
---|---|---|---|---|---|---|
Ampicillin | R | R | R | R | R | |
Amoxicillin + Clavulanate | R | R | R | R | R | |
Amoxicillin | R | R | R | R | R | |
Sulfonamides | Trimethoprim-sulfamethoxazole | S | S | R | S | S |
Trimethoprim | S | S | R | S | S | |
Sulfamethoxazole | S | S | S | S | S | |
Phenicoles Chloramphenicol | S | S | S | S | S | |
Gentamicin | S | S | S | S | S | |
Streptomycin | R | R | R | R | R | |
Carbapenems Meropenem | S | S | S | S | S | |
Nalidixic Acid | S | S | S | S | S | |
Ciprofloxacin | S | S | S | S | S | |
Monobactams Aztreonam | R | S | S | S | S | |
Tetracycline Tetracycline | R | R | R | R | R | |
Cefazolin | S | S | S | R | R | |
Cephalosporins 1st | ||||||
Cephalexin | R | R | S | S | S | |
Cephalosporins 2st Cefoxitin | S | S | S | S | S | |
Ceftriaxone | S | S | S | S | S | |
Cefotaxime | R | S | S | S | S |
Bird 1 | Bird 2 | Bird 3 | |
---|---|---|---|
Identified Bacterium | Salmonella sp. Enterococcus faecalis | Salmonella sp. | Salmonella sp. |
Bird 1: Sporophila bouvreuil; Bird 2: Sporophila nigricollis; Bird 3: Sporophila albogularis. |
Sample | Serotyping |
---|---|
Bird 1 | Salmonella enterica subesp. enterica (O:4,5) * |
Bird 2 | Salmonella ser. Typhimurium |
Bird 3 | Salmonella ser. Typhimurium |
Cage 2 | Salmonella enterica subesp. enterica * |
Enclosure 2 | Salmonella enterica subesp. enterica (O:4,5) * |
Sample | Genes |
---|---|
Bird 1 | orgA, inA, ssaQ, mgtC, sopB, stn, spvC |
Bird 2 | orgA, inA, ssaQ, mgtC, sopB, stn, spvC |
Bird 3 | orgA, inA, ssaQ, mgtC, sopB, stn, spvC |
Cage 2 | orgA, inA, ssaQ, mgtC, sopB, stn, spvC |
Enclosure 2 | orgA, inA, ssaQ, mgtC, sopB, stn, spvC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Soares, K.L.; Lucena, R.B.; Lima, E.S.; Firmino, M.d.O.; Eloy, L.R.C.; Silva, R.A.F.; Sousa, M.S.; Sousa, I.V.; Silva, W.D.Q.; Fernandes, A.C.d.C.; et al. Outbreak of Esophagitis and Ingluvitis Caused by Salmonella Typhimurium in Passeriform Birds of the Genus Sporophila Seized from Wildlife Trafficking. Vet. Sci. 2024, 11, 582. https://doi.org/10.3390/vetsci11110582
Soares KL, Lucena RB, Lima ES, Firmino MdO, Eloy LRC, Silva RAF, Sousa MS, Sousa IV, Silva WDQ, Fernandes ACdC, et al. Outbreak of Esophagitis and Ingluvitis Caused by Salmonella Typhimurium in Passeriform Birds of the Genus Sporophila Seized from Wildlife Trafficking. Veterinary Sciences. 2024; 11(11):582. https://doi.org/10.3390/vetsci11110582
Chicago/Turabian StyleSoares, Karoline L., Ricardo B. Lucena, Ewerton S. Lima, Millena de O. Firmino, Lilian R. C. Eloy, Raquel Annes F. Silva, Mônica S. Sousa, Isabelle V. Sousa, Weslley Drayton Q. Silva, Artur Cezar de C. Fernandes, and et al. 2024. "Outbreak of Esophagitis and Ingluvitis Caused by Salmonella Typhimurium in Passeriform Birds of the Genus Sporophila Seized from Wildlife Trafficking" Veterinary Sciences 11, no. 11: 582. https://doi.org/10.3390/vetsci11110582
APA StyleSoares, K. L., Lucena, R. B., Lima, E. S., Firmino, M. d. O., Eloy, L. R. C., Silva, R. A. F., Sousa, M. S., Sousa, I. V., Silva, W. D. Q., Fernandes, A. C. d. C., & Ramos-Sanchez, E. M. (2024). Outbreak of Esophagitis and Ingluvitis Caused by Salmonella Typhimurium in Passeriform Birds of the Genus Sporophila Seized from Wildlife Trafficking. Veterinary Sciences, 11(11), 582. https://doi.org/10.3390/vetsci11110582