Sarcocystis Species Richness in Sheep and Goats from Lithuania
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection
2.2. Microscopic Examination for the Presence of Sarcocysts in Goat Tissues
2.3. Molecular Analysis of Sarcocysts Excised from Goat Tissues
2.4. Acid-Pepsin Digestion of Muscle Samples from Sheep and Goats
2.5. Molecular Detection of Specific Sarcocystis spp. in the Tissue Digests
2.6. Phylogenetic and Statistical Analysis
3. Results
3.1. Morphological Observations and Molecular Identification of Sarcocysts Present in Goat Tissues
3.2. Molecular Identification of Sarcocystis spp. in the Digested Samples of Sheep and Goats Using Species-Specific PCR
3.3. The Detection Rates of Sarcocystis spp. in Sheep Tissues by Direct and Nested PCR
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Dubey, J.P.; Calero-Bernal, R.; Rosenthal, B.M.; Speer, C.A.; Fayer, R. Sarcocystosis of Animals and Humans, 2nd ed.; CRC Press: Boca Raton, FL, USA, 2016. [Google Scholar]
- Martínez-Navalón, B.; Anastasio-Giner, B.; Cano-Fructuoso, M.; Sanchez-Martínez, P.; Llopis-Morant, A.; Perez-Castarlenas, B.; Goyena, E.; de Larrea, E.B. Sarcocystis Infection: A Major Cause of Carcass Condemnation in Adult Sheep in Spain. Span. J. Agric. Res. 2012, 10, 388. [Google Scholar] [CrossRef] [Scilit]
- Dong, H.; Su, R.; Wang, Y.; Tong, Z.; Zhang, L.; Yang, Y.; Hu, J. Sarcocystis species in wild and domestic sheep (Ovis ammon and Ovis aries) from China. BMC Vet. Res. 2018, 14, 377. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Amairia, S.; Amdouni, Y.; Rouatbi, M.; Rjeibi, M.R.; Awadi, S.; Gharbi, M. First detection and molecular identification of Sarcocystis spp. in small ruminants in North-West Tunisia. Transbound. Emerg. Dis. 2018, 65, 441–446. [Google Scholar] [CrossRef] [Scilit]
- Bittencourt, M.V.; Meneses, I.D.S.; Ribeiro-Andrade, M.; de Jesus, R.F.; de Araújo, F.R.; Gondim, L.F.P. Sarcocystis spp. in sheep and goats: Frequency of infection and species identification by morphological, ultrastructural, and molecular tests in Bahia, Brazil. Parasitol. Res. 2016, 115, 1683–1689. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gjerde, B.; de la Fuente, C.; Alunda, J.M.; Luzón, M. Molecular characterization of five Sarcocystis species in domestic sheep (Ovis aries) from Spain. Parasitol. Res. 2020, 119, 215–231. [Google Scholar] [CrossRef] [Scilit]
- Hu, J.J.; Huang, S.; Wen, T.; Esch, G.W.; Liang, Y.; Li, H.L. Sarcocystis spp. in Domestic Sheep in Kunming City, China: Prevalence, Morphology, and Molecular Characteristics. Parasite 2017, 24, 30. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Saito, M.; Shibata, Y.; Kubo, M.; Itagaki, H. Sarcocystis mihoensis n. sp. from Sheep in Japan. J. Vet. Med. Sci. 1997, 59, 103–106. [Google Scholar] [CrossRef] [Scilit]
- Wang, G.; Wei, T.; Wang, X.; Li, W.; Zhang, P.; Dong, M.; Xiao, H. The Morphology and Life Cycle of Sarcocystis microps n. sp. in Sheep of Qinghai in China. China Vet. Technol. 1988, 6, 9–11. [Google Scholar]
- Lindsay, D.S.; Dubey, J.P. Neosporosis, Toxoplasmosis, and Sarcocystosis in Ruminants: An Update. Vet. Clin. N. Am. Exot. Anim. Pract. 2020, 36, 205–222. [Google Scholar] [CrossRef] [Scilit]
- Hong, E.J.; Sim, C.; Chae, J.S.; Kim, H.C.; Park, J.; Choi, K.S.; Yu, D.H.; Park, C.H.; Yoo, J.G.; Park, B.K. Ultrastructural and molecular identification of Sarcocystis tenella (Protozoa, Apicomplexa) in naturally infected Korean native goats. Vet. Med. 2016, 61, 374–381. [Google Scholar] [CrossRef] [Scilit]
- Gjerde, B. Sarcocystis species in red deer revisited: With a re-description of two known species as Sarcocystis elongata n. sp. and Sarcocystis truncata n. sp. based on mitochondrial cox1 sequences. Parasitology 2014, 141, 441–452. [Google Scholar] [CrossRef] [Scilit]
- El-Morsey, A.; Abdo, W.; Sultan, K.; Elhawary, N.M.; AbouZaid, A.A. Ultrastructural and Molecular Identification of the sarcocysts of Sarcocystis tenella and Sarcocystis arieticanis Infecting Domestic Sheep (Ovis aries) from Egypt. Acta Parasitol. 2019, 64, 501–513. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Metwally, D.M.; Al-Damigh, M.A.; Al-Turaiki, I.M.; El-Khadragy, M.F. Molecular Characterization of Sarcocystis Species Isolated from Sheep and Goats in Riyadh, Saudi Arabia. Animals 2019, 9, 256. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Formisano, P.; Aldridge, B.; Alony, Y.; Beekhuis, L.; Davies, E.; Del Pozo, J.; Dunn, K.; English, K.; Morrison, L.; Sargison, N.; et al. Identification of Sarcocystis capracanis in cerebrospinal fluid from sheep with neurological disease. Vet. Parasitol. 2013, 193, 252–255. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kalantari, N.; Khaksar, M.; Ghaffari, S.; Hamidekish, S.M. Molecular Analysis of Sarcocystis Spp. Isolated from Sheep (Ovis aries) in Babol Area, Mazandaran Province, Northern Iran. Iran. J. Parasitol. 2016, 11, 73–80. [Google Scholar] [PubMed]
- Swar, S.O.; Shnawa, B.H. Ultrastructural and Molecular Characterization of Sarcocystis Species Derived from Macroscopic Sarcocysts of Domestic Sheep and Goats in Soran City, Erbil, Iraq. Worlds Vet. J. 2020, 10, 540–550. [Google Scholar] [CrossRef] [Scilit]
- Dakhil, H.G.; Abdallah, B.H.; Abdallah, F.A. Molecular identification of Sarcocystis fusiformis and S. moulei infecting water buffaloes (Bubalus bubalis) in southern Iraq. World J. Pharm. Res. 2017, 6, 215–229. [Google Scholar]
- Kolenda, R.; Schierack, P.; Zieba, F.; Zwijacz-Kozica, T.; Bednarski, M. First Molecular Characterization of Sarcocystis tenella in Tatra Chamois (Rupicapra rupicapra tatrica) in Poland. Parasitol. Res. 2015, 114, 3885–3892. [Google Scholar] [CrossRef] [Scilit]
- Prakas, P.; Rehbein, S.; Rudaitytė-Lukošienė, E.; Butkauskas, D. Molecular Identification of Sarcocystis species in Diaphragm Muscle Tissue of European mouflon (Ovis gmelini musimon) from Austria. Parasitol. Res. 2021, 120, 2695–2702. [Google Scholar] [CrossRef] [Scilit]
- Januškevičius, V.; Januškevičienė, G.; Prakas, P.; Butkauskas, D.; Petkevičius, S. Prevalence and Intensity of Sarcocystis spp. Infection in Animals Slaughtered for Food in Lithuania. Vet. Med. 2019, 64, 149–157. [Google Scholar] [CrossRef] [Scilit]
- Prakas, P.; Strazdaitė-Žielienė, Ž.; Januškevičius, V.; Chiesa, F.; Baranauskaitė, A.; Rudaitytė-Lukošienė, E.; Servienė, E.; Petkevičius, S.; Butkauskas, D. Molecular Identification of Four Sarcocystis species in Cattle from Lithuania, Including S. hominis, and Development of a Rapid Molecular Detection Method. Parasites Vectors 2020, 13, 610. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Marandykina-Prakienė, A.; Butkauskas, D.; Gudiškis, N.; Juozaitytė-Ngugu, E.; Januškevičius, V.; Rudaitytė-Lukošienė, E.; Prakas, P. Molecular Identification of Sarcocystis Species in Sheep from Lithuania. Animals 2022, 12, 2048. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gjerde, B. Phylogenetic Relationships among Sarcocystis Species in Cervids, Cattle and Sheep Inferred from the Mitochondrial Cytochrome C Oxidase Subunit I Gene. Int. J. Parasitol. 2013, 43, 579–591. [Google Scholar] [CrossRef] [Scilit]
- Dubey, J.P. Refinement of pepsin digestion method for isolation of Toxoplasma gondii from infected tissues. Vet. Parasitol. 1998, 74, 75–77. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gjerde, B.; Luzón, M.; Alunda, J.M.; de la Fuente, C. Morphological and molecular characteristics of six Sarcocystis spp. from red deer (Cervus elaphus) in Spain, including Sarcocystis cervicanis and three new species. Parasitol. Res. 2017, 116, 2795–2811. [Google Scholar] [CrossRef] [Scilit]
- Rudaitytė-Lukošienė, E.; Prakas, P.; Strazdaitė-Žielienė, Ž.; Servienė, E.; Januškevičius, V.; Butkauskas, D. Molecular identification of two Sarcocystis species in fallow deer (Dama dama) from Lithuania. Parasitol. Int. 2020, 75, 102044. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Prakas, P.; Rehbein, S.; Rudaitytė-Lukošienė, E.; Butkauskas, D. Molecular identification of Sarcocystis species in sika deer (Cervus nippon) of free-ranging populations in Germany and Austria. Vet. Res. Commun. 2023. [Google Scholar] [CrossRef] [Scilit]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [Scilit]
- Kimura, M. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J. Mol. Evol. 1980, 16, 111–120. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Milne, I.; Wright, F.; Rowe, G.; Marshall, D.F.; Husmeier, D.; McGuire, G. TOPALi: Software for automatic identification of recombinant sequences within DNA multiple alignments. Bioinformatics 2004, 20, 1806–1807. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rubiola, S.; Chiesa, F.; Zanet, S.; Civera, T. Molecular identification of Sarcocystis spp. in cattle: Partial sequencing of Cytochrome C Oxidase subunit 1 (COI). Ital. J. Food Saf. 2019, 7, 7725. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dahlgren, S.S.; Gjerde, B. Sarcocystis in moose (Alces alces): Molecular identification and phylogeny of six Sarcocystis species in moose, and a morphological description of three new species. Parasitol. Res. 2008, 103, 93–110. [Google Scholar] [CrossRef] [Scilit]
- Dahlgren, S.S.; Gjerde, B. Sarcocystis in Norwegian roe deer (Capreolus capreolus): Molecular and morphological identification of Sarcocystis oviformis n. sp. and Sarcocystis gracilis and their phylogenetic relationship with other Sarcocystis species. Parasitol. Res. 2009, 104, 993–1003. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hu, J.J.; Liu, T.T.; Liu, Q.; Esch, G.W.; Chen, J.Q.; Huang, S.; Wen, T. Prevalence, morphology, and molecular characteristics of Sarcocystis spp. in domestic goats (Capra hircus) from Kunming, China. Parasitol. Res. 2016, 115, 3973–3981. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kutty, M.K.; Latif, B.; Muslim, A.; Hussaini, J.; Daher, A.M.; Heo, C.C.; Abdullah, S. Detection of sarcocystosis in goats in Malaysia by light microscopy, histology, and PCR. Trop. Anim. Health Prod. 2015, 47, 751–756. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Latif, B.M.; Al-Delemi, J.K.; Mohammed, B.S.; Al-Bayati, S.M.; Al-Amiry, A.M. Prevalence of Sarcocystis spp. in meat-producing animals in Iraq. Vet. Parasitol. 1999, 84, 85–90. [Google Scholar] [CrossRef] [Scilit]
- Mahran, O. Sarcocystis infection in sheep and goats slaughtered in Shalatin abattoir, Red Sea Governorate, Egypt. Assiut Vet. Med. J. 2009, 55, 1–15. [Google Scholar] [CrossRef] [Scilit]
- Dehaghi, M.M.; Fathi, S.; Asl, E.N. Survey of Sarcocystis infection in slaughtered goats in Kerman Abattoir, Southeast of Iran. J. Anim. Vet. Adv. 2011, 10, 1205–1208. [Google Scholar]
- Morsy, K.; Saleh, A.; Al-Ghamdi, A.; Abdel-Ghaffar, F.; Al-Rasheid, K.; Bashtar, A.R.; Al Quraishy, S.; Mehlhorn, H. Prevalence pattern and biology of Sarcocystis capracanis infection in the Egyptian goats: A light and ultrastructural study. Vet. Parasitol. 2011, 181, 75–82. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Abdel-Hafeez, E.H.; Kamal, A.M.; Abdelgelil, N.H.; Abdel-Fatah, M. Parasites transmitted to human by ingestion of different types of meat, El-Minia city, El-Minia governorate, Egypt. J. Egypt. Soc. Parasitol. 2015, 45, 671–680. [Google Scholar] [CrossRef] [Scilit]
- Salehi, M.; Spotin, A.; Rostamian, M.; Adami, M. Prevalence and Molecular Assessment of Sarcocystis Infection in Livestock in Northeast Iran. Comp. Immunol. Microbiol. Infect. Dis. 2022, 80, 101738. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- El-Kady, A.M.; Hussein, N.M.; Hassan, A.A. First molecular characterization of Sarcocystis spp. in cattle in Qena Governorate, Upper Egypt. J. Parasit. Dis. 2018, 42, 114–121. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dahlgren, S.S.; Gjerde, B. Molecular characterization of five Sarcocystis species in red deer (Cervus elaphus), including Sarcocystis hjorti n. sp., reveals that these species are not intermediate host specific. Parasitology 2010, 137, 815–840. [Google Scholar] [CrossRef] [Scilit]
- Sarafraz, N.; Spotin, A.; Haniloo, A.; Fazaeli, A. Prevalence and molecular analysis of Sarcocystis infections in cattle in Northwest Iran and the first global report of S. gigantea in cattle. Comp. Immunol. Microbiol. Infect. Dis. 2020, 73, 101566. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Veronesi, F.; Di Palma, S.; Gabrielli, S.; Morganti, G.; Milardi, G.L.; Middleton, B.; Lepri, E. Sarcocystis gigantea infection associated with granulomatous eosinophilic myositis in a horse. J. Vet. Diagn. Investig. 2020, 32, 611–615. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Calero-Bernal, R.; Verma, S.K.; Seaton, C.T.; Sinnett, D.; Ball, E.; Dunams, D.; Rosenthal, B.M.; Dubey, J.P. Sarcocystis cruzi infection in wood bison (Bison bison athabascae). Vet. Parasitol. 2015, 210, 102–105. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hoeve-Bakker, B.J.A.; van der Giessen, J.W.B.; Franssen, F.F.J. Molecular identification targeting cox1 and 18S genes confirms the high prevalence of Sarcocystis spp. in cattle in the Netherlands. Int. J. Parasitol 2019, 49, 859–866. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rahdar, M.; Kardooni, T. Molecular identification of Sarcocystis spp. in sheep and cattle by PCR-RFLP from Southwest of Iran. Jundishapur J. Microbiol. 2017, 10, 12798. [Google Scholar] [CrossRef] [Scilit]
- Delgado-de Las Cuevas, G.E.; Prakas, P.; Rudaitytė-Lukošienė, E.; García-Gil, M.L.; Martínez-González, M.; Butkauskas, D.; Mowery, J.D.; Dubey, J.P.; Habela, M.A.; Calero-Bernal, R. First description of Sarcocystis species infecting Barbary sheep (Ammotragus lervia). Parasitol. Res. 2021, 120, 2881–2886. [Google Scholar] [CrossRef] [Scilit]


| Sarcocystis Species | Primer Name | Orientation | Primer Sequence | Ta (°C) | Fragment Size (bp) | Molecular Target |
|---|---|---|---|---|---|---|
| S. arieticanis | SF1 1 | Forward | ATGGCGTACAACAATCATAAAGAA | 53 | 913 | cox1 |
| SsunR3 2 | Reverse | CCGTTGGWATGGCRATCAT | ||||
| Arieticanis7F 3 | Forward | TAATTTCCTCGGTACTGTACTGTTTG | 61 | 290 | ||
| Arieticanis7R 3 | Reverse | TACTTACGCATTGCGATATTACG | ||||
| S. gigantea | V2gig1 2 | Forward | GCACTTCGAGCATTCTTGG | 57 | 548 | |
| V2gig2 4 | Reverse | ATCTACATCCACCGTAGGAACCTTA | ||||
| V2gig3 4 | Forward | CAGCAAGTACCAAGTTCTGTACGTC | 62 | 322 | ||
| V2gig4 2 | Reverse | GGTGCCGAGTACCGAGATACAT | ||||
| S. medusiformis | V2medu1 2 | Forward | TTAATGGCATATCGTACTACCTATTG | 56 | 729 | |
| V2medu2 2 | Reverse | CCCATGCATCAACCTCCAG | ||||
| V2medu3 2 | Forward | GTATCCTGGGGGCCATTAACTT | 61 | 389 | ||
| V2medu4 2 | Reverse | CCAAACCAGTGTTCCGAGTATTG | ||||
| S. mihoensis | V2miho1 2 | Forward | ATCTTTACACTGCACGGTTTGTTT | 60 | 844 | |
| V2miho2 2 | Reverse | AGTCGTTATGTCGGAAGTCAACAG | ||||
| V2miho3 2 | Forward | GATGTTACCTCGGGTAAATGCTCTT | 60 | 526 | ||
| V2miho4 2 | Reverse | AAAAACATGTCTAGCTCCTAACACC | ||||
| S. tenella | SF1 1 | Forward | ATGGCGTACAACAATCATAAAGAA | 53 | 913 | |
| SsunR3 2 | Reverse | CCGTTGGWATGGCRATCAT | ||||
| Tenella8F 3 | Forward | ATACCGCTCTACGCTGGATCTAC | 59 | 421 | ||
| Tenella8R 3 | Reverse | AACCATCGTACAATCCAAAACTAAA | ||||
| S. capracanis | VocaF1 3 | Forward | GTAAACTTCCTGGGTACTGTGCTGT | 60 | 531 | |
| VocaR1 3 | Reverse | CCAGTAATCCGCTGTCAAGATAC | ||||
| V2ca3 3 | Forward | ATACCGATCTTTACGGGAGCAGTA | 58 | 330 | ||
| V2ca4 3 | Reverse | GGTCACCGCAGAGAAGTACGAT | ||||
| S. hircicanis | V2hirici1 3 | Forward | CCGTAGATGCCATGGGTACTT | 61 | 868 | |
| V2hirici2 3 | Reverse | GTAGATATCCAGTGACGTGGTGAG | ||||
| V2hirici3 4 | Forward | GCCTGGGTATTCTAGGACTGAGTAG | 62 | 354 | ||
| V2hirici4 4 | Reverse | CGAAAACTGCTCTACCGCTCA | ||||
| S. morae | SF1 1 | Forward | ATGGCGTACAACAATCATAAAGAA | 53 | 913 | |
| SsunR3 2 | Reverse | CCGTTGGWATGGCRATCAT | ||||
| V2mor1 3 | Forward | GTGTGCTTGGATCGGTCAAC | 57 | 332 | ||
| V2mor2 3 | Reverse | GCCGAATACCGGCTTACTTC | ||||
| S. moulei | V2moul1 3 | Forward | GGAGATTCTTGTTGAGTGGGTCT | 54 | 790 | 28S rRNA |
| V2moul2 3 | Reverse | GCAAAGCATAATATTTTCTAACGAT | ||||
| V2moul3 4 | Forward | GTGAATGCCCTATGTTGTTGAG | 59 | 496 | ||
| V2moul4 4 | Reverse | ATATGTGAGAGTGTAGCCCGAAGA |
| Species | Host | Information of Sequences | Sequence Similarity, % | |||
|---|---|---|---|---|---|---|
| n | Length (bp) | GenBank Acc. No. | Comparing Sequences of the Same Species | Comparing Obtained Sequences with Those of Most Closely Related Species | ||
| S. tenella | Sheep | 12 | 373 | OR258580-OR258591 | 96.0–100 | 91.7–93.8 S. capracanis |
| S. tenella | Goat | 5 | 373 | OR258594-OR258598 | 95.7–100 | 91.4–93.8 S. capracanis |
| S. arieticanis | Sheep | 12 | 241 | OR258599-OR258604, OR258607-OR258612 | 96.9–100 * | 84.7–86.7 S. hircicanis |
| S. arieticanis | Goat | 1 | 241 | OR258615 | 97.5–100 * | 85.5–86.3 S. hircicanis |
| S. capracanis | Goat | 3 | 284 | OR258616-OR258618 | 97.2–99.7 | 90.4–93.7 S. tenella |
| S. capracanis | Sheep | 27 | 284 | OR258621-OR258641, OR258647-OR258652 | 96.8–100 | 90.5–93.0 S. tenella |
| S. morae | Sheep | 22 | 292 | OR258655-OR258670, OR258672-OR258677 | 95.6–100 | 82.9–85.3 S. cervicanis |
| Sarcocystis sp. OaLT1 | Sheep | 2 | 241 | OR258679-OR258680 | No GenBank records | 80.3–83.8 S. tenella 78.6–81.9 S. capracanis 80.4 S. heydorni |
| Species | Type of Sample | |||||
|---|---|---|---|---|---|---|
| Diaphragm | Heart | Oesophagus | ||||
| Nested | Direct | Nested | Direct | Nested | Direct | |
| S. arieticanis | 44 (93.6) | 28 (59.6) | 39 (83.0) | 5 (10.6) | 39 (83.0) | 9 (19.1) |
| S. tenella | 47 (100) | 18 (38.3) | 45 (95.7) | 18 (38.3) | 40 (85.1) | 16 (34.0) |
| S. capracanis | 20 (42.6) | 10 (21.3) | 11 (23.4) | 5 (10.6) | 13 (27.7) | 6 (12.8) |
| S. morae | 15 (31.9) | 5 (10.6) | 8 (17.0) | 6 (12.8) | 10 (21.3) | 5 (10.6) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Marandykina-Prakienė, A.; Butkauskas, D.; Gudiškis, N.; Juozaitytė-Ngugu, E.; Bagdonaitė, D.L.; Kirjušina, M.; Calero-Bernal, R.; Prakas, P. Sarcocystis Species Richness in Sheep and Goats from Lithuania. Vet. Sci. 2023, 10, 520. https://doi.org/10.3390/vetsci10080520
Marandykina-Prakienė A, Butkauskas D, Gudiškis N, Juozaitytė-Ngugu E, Bagdonaitė DL, Kirjušina M, Calero-Bernal R, Prakas P. Sarcocystis Species Richness in Sheep and Goats from Lithuania. Veterinary Sciences. 2023; 10(8):520. https://doi.org/10.3390/vetsci10080520
Chicago/Turabian StyleMarandykina-Prakienė, Alina, Dalius Butkauskas, Naglis Gudiškis, Evelina Juozaitytė-Ngugu, Dovilė Laisvūnė Bagdonaitė, Muza Kirjušina, Rafael Calero-Bernal, and Petras Prakas. 2023. "Sarcocystis Species Richness in Sheep and Goats from Lithuania" Veterinary Sciences 10, no. 8: 520. https://doi.org/10.3390/vetsci10080520
APA StyleMarandykina-Prakienė, A., Butkauskas, D., Gudiškis, N., Juozaitytė-Ngugu, E., Bagdonaitė, D. L., Kirjušina, M., Calero-Bernal, R., & Prakas, P. (2023). Sarcocystis Species Richness in Sheep and Goats from Lithuania. Veterinary Sciences, 10(8), 520. https://doi.org/10.3390/vetsci10080520

