Dihydromyricetin Inhibits Pseudorabies Virus Multiplication In Vitro by Regulating NF-κB Signaling Pathway and Apoptosis
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Compounds
2.2. Cells and Virus
2.3. Cytotoxicity and Inhibitory Activity Assays
2.4. Inhibitory Action Assay
2.5. Transcriptional Levels of Target Genes Assay
2.6. Western Blotting
2.7. Statistical Analysis
3. Results
3.1. Results
3.1.1. Cytotoxicity and Antiviral Activity of Dihydromyricetin
3.1.2. Effect of Dihydromyricetin on Specific Steps of Viral Life Cycle
3.1.3. Effect of Dihydromyricetin on PRV-Activated NF-κB Signaling Pathway
3.1.4. Effect of Dihydromyricetin on PRV-Changed Cell Apoptotic Process
3.1.5. Effect of Dihydromyricetin on Gene Expressions of Cytokines and Apoptotic Factors
3.2. Figures and Tables

| Primer | Forward (5′→3′) | Reverse (5′→3′) |
|---|---|---|
| β-actin | GGACTTCGAGCAGGAGATGG | AGGAAGGAGGGCTGGAAGAG |
| TNF-α | GAGATCAACCTGCCCGACT | TCACAGGGCAATGATCCCAA |
| IL-1α | AGAATCTCAGAAACCCGACTGTTT | TTCAGCAACACGGGTTCGT |
| IL-1β | GCCCTGTACCCCAACTGGTA | CCAGGAAGACGGGCTTTTG |
| IL-6 | ATTAAGTACATCCTCGGCAAA | GTTTTCTGCCAGTACCTCC |
| Bax | GTTTCATCCAGGATCGAGCA | TGCAGCTCCATGTTACTGTCC |
| Caspase-3 | AAGACCATAGCAAAAGGAGCA | GTTCACAGCAGTCCCCTC |
| Bcl-2 | CTGCACCTGACTCCCTTCACC | TCCCGGTTGACGCTCTCCACA |
| Bcl-xl | GCCACTTACCTGAATGACCA | ATTGTTTCCGTAGAGTTCCAC |

| Compound | CC50 (μM) | IC50 (μM) | SI |
|---|---|---|---|
| Dihydromyricetin | 914.32 ± 1.19 | 161.34 ± 0.86 | 5.68 |



4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Connolly, S.A.; Jardetzky, T.S.; Longnecker, R. The structural basis of herpesvirus entry. Nat. Rev. Genet. 2020, 19, 110–121. [Google Scholar] [CrossRef] [Scilit]
- Wong, G.; Lu, J.; Zhang, W.; Gao, G.F. Pseudorabies virus: A neglected zoonotic pathogen in humans? Emerg. Microbes Infect. 2019, 8, 150–154. [Google Scholar] [CrossRef] [Scilit]
- Liu, Q.; Kuang, Y.; Li, Y.; Guo, H.; Zhou, C.; Guo, S.; Tan, C.; Wu, B.; Chen, H.; Wang, X. The Epidemiology and Variation in Pseudorabies Virus: A Continuing Challenge to Pigs and Humans. Viruses 2022, 14, 1463. [Google Scholar] [CrossRef] [Scilit]
- Pomeranz, L.E.; Reynolds, A.E.; Hengartner, C.J. Molecular Biology of Pseudorabies Virus: Impact on Neurovirology and Veterinary Medicine. Microbiol. Mol. Biol. Rev. MMBR 2005, 69, 462–500. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huang, H.; Koyuncu, O.O.; Enquist, L.W. Pseudorabies Virus Infection Accelerates Degradation of the Kinesin-3 Motor KIF1A. J. Virol. 2020, 94, e01934-19. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cheng, Z.; Kong, Z.; Liu, P.; Fu, Z.; Zhang, J.; Liu, M.; Shang, Y. Natural infection of a variant pseudorabies virus leads to bovine death in China. Transbound. Emerg. Dis. 2019, 67, 518–522. [Google Scholar] [CrossRef] [Scilit]
- Wang, G.-S.; Du, Y.; Wu, J.-Q.; Tian, F.-L.; Yu, X.-J.; Wang, J.-B. Vaccine resistant pseudorabies virus causes mink infection in China. BMC Veter. Res. 2018, 14, 20. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mettenleiter, T.C. Aujeszky’s disease (pseudorabies) virus: The virus and molecular pathogenesis—State of the art, June 1999. Veter.- Res. 2000, 31, 99–115. [Google Scholar] [CrossRef] [Scilit]
- Yang, B.; Luo, G.; Zhang, C.; Feng, L.; Luo, X.; Gan, L. Curcumin protects rat hippocampal neurons against pseudorabies virus by regulating the BDNF/TrkB pathway. Sci. Rep. 2020, 10, 22204. [Google Scholar] [CrossRef] [Scilit]
- Xia, L.; Sun, Q.; Wang, J.; Chen, Q.; Liu, P.; Shen, C.; Sun, J.; Tu, Y.; Shen, S.; Zhu, J.; et al. Epidemiology of pseudorabies in intensive pig farms in Shanghai, China: Herd-level prevalence and risk factors. Prev. Veter.- Med. 2018, 159, 51–56. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Szpara, M.; Kobiler, O.; Enquist, L.W. A Common Neuronal Response to Alphaherpesvirus Infection. J. Neuroimmune Pharmacol. 2010, 5, 418–427. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lu, J.; Yuan, W.; Zhu, Y.; Hou, S.; Wang, X. Latent pseudorabies virus infection in medulla oblongata from quarantined pigs. Transbound. Emerg. Dis. 2020, 68, 543–551. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ekstrand, M.I.; Enquist, L.; Pomeranz, L.E. The alpha-herpesviruses: Molecular pathfinders in nervous system circuits. Trends Mol. Med. 2008, 14, 134–140. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bo, Z.; Li, X. A Review of Pseudorabies Virus Variants: Genomics, Vaccination, Transmission, and Zoonotic Potential. Viruses 2022, 14, 1003. [Google Scholar] [CrossRef] [Scilit]
- Li, H.; Liang, R.; Pang, Y.; Shi, L.; Cui, S.; Lin, W. Evidence for interspecies transmission route of pseudorabies virus via virally contaminated fomites. Veter.- Microbiol. 2020, 251, 108912. [Google Scholar] [CrossRef] [Scilit]
- Hu, F.; Wang, J.; Peng, X.-Y. Bilateral Necrotizing Retinitis following Encephalitis Caused by the Pseudorabies Virus Confirmed by Next-Generation Sequencing. Ocul. Immunol. Inflamm. 2020, 29, 922–925. [Google Scholar] [CrossRef] [Scilit]
- An, T.-Q.; Peng, J.-M.; Tian, Z.-J.; Zhao, H.-Y.; Li, N.; Liu, Y.-M.; Chen, J.-Z.; Leng, C.-L.; Sun, Y.; Chang, D.; et al. Pseudorabies Virus Variant in Bartha-K61–Vaccinated Pigs, China, 2012. Emerg. Infect. Dis. 2013, 19, 1749–1755. [Google Scholar] [CrossRef] [Scilit]
- Liu, J.; Chen, C.; Li, X. Novel Chinese pseudorabies virus variants undergo extensive recombination and rapid interspecies transmission. Transbound. Emerg. Dis. 2020, 67, 2274–2276. [Google Scholar] [CrossRef] [Scilit]
- Li, R.; Hayward, S.D. Potential of protein kinase inhibitors for treating herpesvirus-associated disease. Trends Microbiol. 2013, 21, 286–295. [Google Scholar] [CrossRef] [Scilit]
- Skoreński, M.; Sieńczyk, M. Anti-herpesvirus agents: A patent and literature review (2003 to present). Expert Opin. Ther. Pat. 2014, 24, 925–941. [Google Scholar] [CrossRef] [Scilit]
- Wen, K.; Fang, X.; Yang, J.; Yao, Y.; Nandakumar, K.S.; Salem, M.L.; Cheng, K. Recent Research on Flavonoids and their Biomedical Applications. Curr. Med. Chem. 2021, 28, 1042–1066. [Google Scholar] [CrossRef] [Scilit]
- Ninfali, P.; Antonelli, A.; Magnani, M.; Scarpa, E.S. Antiviral Properties of Flavonoids and Delivery Strategies. Nutrients 2020, 12, 2534. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hassan, S.T.S.; Masarčíková, R.; Berchová-Bímová, K. Bioactive natural products with anti-herpes simplex virus properties. J. Pharm. Pharmacol. 2015, 67, 1325–1336. [Google Scholar] [CrossRef] [Scilit]
- Šudomová, M.; Berchová-Bímová, K.; Mazurakova, A.; Šamec, D.; Kubatka, P.; Hassan, S.T.S. Flavonoids Target Human Herpesviruses That Infect the Nervous System: Mechanisms of Action and Therapeutic Insights. Viruses 2022, 14, 592. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Khan, M.T.H.; Ather, A.; Thompson, K.D.; Gambari, R. Extracts and molecules from medicinal plants against herpes simplex viruses. Antivir. Res. 2005, 67, 107–119. [Google Scholar] [CrossRef] [Scilit]
- Zhang, X.; Chen, S.; Li, X.; Zhang, L.; Ren, L. Flavonoids as Potential Antiviral Agents for Porcine Viruses. Pharmaceutics 2022, 14, 1793. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, J.; Chen, Y.; Luo, H.; Sun, L.; Xu, M.; Yu, J.; Zhou, Q.; Meng, G.; Yang, S. Recent Update on the Pharmacological Effects and Mechanisms of Dihydromyricetin. Front. Pharmacol. 2018, 9, 1204. [Google Scholar] [CrossRef] [Scilit]
- Liu, D.; Mao, Y.; Ding, L.; Zeng, X.-A. Dihydromyricetin: A review on identification and quantification methods, biological activities, chemical stability, metabolism and approaches to enhance its bioavailability. Trends Food Sci. Technol. 2019, 91, 586–597. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhou, D.-Z.; Sun, H.-Y.; Yue, J.-Q.; Peng, Y.; Chen, Y.-M.; Zhong, Z.-J. Dihydromyricetin induces apoptosis and cytoprotective autophagy through ROS-NF-κB signalling in human melanoma cells. Free. Radic. Res. 2017, 51, 517–528. [Google Scholar] [CrossRef] [Scilit]
- Luo, Y.; Lu, S.; Dong, X.; Xu, L.; Sun, G.; Sun, X. Dihydromyricetin protects human umbilical vein endothelial cells from injury through ERK and Akt mediated Nrf2/HO-1 signaling pathway. Apoptosis 2017, 22, 1013–1024. [Google Scholar] [CrossRef] [Scilit]
- Zhou, H.-Y.; Gao, S.-Q.; Gong, Y.-S.; Lin, T.; Tong, S.; Xiong, W.; Shi, C.-Y.; Wang, W.-Q.; Fang, J.-G. Anti-HSV-1 effect of dihydromyricetin from Ampelopsis grossedentata via the TLR9-dependent anti-inflammatory pathway. J. Glob. Antimicrob. Resist. 2020, 23, 370–376. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, X.; Chen, Y.-Q.; Yin, Z.-Q.; Wang, R.; Hu, H.-Y.; Liang, X.-X.; He, C.-L.; Yin, L.-Z.; Ye, G.; Zou, Y.-F.; et al. Kaempferol inhibits Pseudorabies virus replication in vitro through regulation of MAPKs and NF-κB signaling pathways. J. Integr. Agric. 2021, 20, 2227–2239. [Google Scholar] [CrossRef] [Scilit]
- Zhao, X.; Cui, Q.; Fu, Q.; Song, X.; Jia, R.; Yang, Y.; Zou, Y.; Li, L.; He, C.; Liang, X.; et al. Antiviral properties of resveratrol against pseudorabies virus are associated with the inhibition of IκB kinase activation. Sci. Rep. 2017, 7, 8782. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ren, J.; Wang, H.; Zhou, L.; Ge, X.; Guo, X.; Han, J.; Yang, H. Glycoproteins C and D of PRV Strain HB1201 Contribute Individually to the Escape from Bartha-K61 Vaccine-Induced Immunity. Front. Microbiol. 2020, 11, 323. [Google Scholar] [CrossRef] [Scilit]
- He, W.; Auclert, L.Z.; Zhai, X.; Wong, G.; Zhang, C.; Zhu, H.; Xing, G.; Wang, S.; He, W.; Li, K.; et al. Interspecies Transmission, Genetic Diversity, and Evolutionary Dynamics of Pseudorabies Virus. J. Infect. Dis. 2018, 219, 1705–1715. [Google Scholar] [CrossRef] [Scilit]
- Ti, H.; Zhuang, Z.; Yu, Q.; Wang, S. Progress of Plant Medicine Derived Extracts and Alkaloids on Modulating Viral Infections and Inflammation. Drug Des. Dev. Ther. 2021, 15, 1385–1408. [Google Scholar] [CrossRef] [Scilit]
- Li, W.; Xu, C.; Hao, C.; Zhang, Y.; Wang, Z.; Wang, S.; Wang, W. Inhibition of herpes simplex virus by myricetin through targeting viral gD protein and cellular EGFR/PI3K/Akt pathway. Antivir. Res. 2020, 177, 104714. [Google Scholar] [CrossRef] [Scilit]
- Hu, H.; Hu, Z.; Zhang, Y.; Wan, H.; Yin, Z.; Li, L.; Liang, X.; Zhao, X.; Yin, L.; Ye, G.; et al. Myricetin inhibits pseudorabies virus infection through direct inactivation and activating host antiviral defense. Front Microbiol. 2022, 13, 985108. [Google Scholar] [CrossRef] [Scilit]
- Wu, C.-C.; Fang, C.-Y.; Hsu, H.-Y.; Chen, Y.-J.; Chou, S.-P.; Huang, S.-Y.; Cheng, Y.-J.; Lin, S.-F.; Chang, Y.; Tsai, C.-H.; et al. Luteolin inhibits Epstein-Barr virus lytic reactivation by repressing the promoter activities of immediate-early genes. Antivir. Res. 2016, 132, 99–110. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, L.; Wang, R.; Hu, H.; Chen, X.; Yin, Z.; Liang, X.; He, C.; Yin, L.; Ye, G.; Zou, Y.; et al. The antiviral activity of kaempferol against pseudorabies virus in mice. BMC Veter. Res. 2021, 17, 247. [Google Scholar] [CrossRef] [Scilit]
- Chen, X.; Wang, R.; Hu, H.; Zhao, X.; Yin, Z.; Zou, Y.; Li, L.; Jia, R.; Zhang, Y.; Song, X. Antiviral effect of an extract from Kaempferia galanga L. rhizome in mice infected with pseudorabies virus. J. Virol. Methods 2022, 307, 114573. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhou, M.; Abid, M.; Cao, S.; Zhu, S. Progress of Research into Novel Drugs and Potential Drug Targets against Porcine Pseudorabies Virus. Viruses 2022, 14, 1753. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tombácz, D.; Tóth, J.S.; Petrovszki, P.; Boldogkői, Z. Whole-genome analysis of pseudorabies virus gene expression by real-time quantitative RT-PCR assay. BMC Genom. 2009, 10, 491. [Google Scholar] [CrossRef] [Scilit]
- Weller, S.K.; Coen, D.M. Herpes Simplex Viruses: Mechanisms of DNA Replication. Cold Spring Harb. Perspect. Biol. 2012, 4, a013011. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Muylaert, I.; Tang, K.-W.; Elias, P. Replication and Recombination of Herpes Simplex Virus DNA. J. Biol. Chem. 2011, 286, 15619–15624. [Google Scholar] [CrossRef] [Scilit]
- Criddle, A.; Thornburg, T.; Kochetkova, I.; DePartee, M.; Taylor, M.P. gD-Independent Superinfection Exclusion of Alphaherpesviruses. J. Virol. 2016, 90, 4049–4058. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Diwaker, D.; Murray, J.W.; Barnes, J.; Wolkoff, A.W.; Wilson, D.W. Deletion of the Pseudorabies Virus gE/gI-US9p complex disrupts kinesin KIF1A and KIF5C recruitment during egress, and alters the properties of microtubule-dependent transport in vitro. PLOS Pathog. 2020, 16, e1008597. [Google Scholar] [CrossRef] [Scilit]
- Chen, X.; Song, X.; Li, L.; Chen, Y.; Jia, R.; Zou, Y.; Wan, H.; Zhao, L.; Tang, H.; Lv, C.; et al. Resveratrol Inhibits Pseudorabies Virus Replication by Targeting IE180 Protein. Front. Microbiol. 2022, 13, 891978. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.-S.; Liu, S.-S.; Jiang, H.; Deng, H.; Dong, C.; Shen, W.; Chen, H.-F.; Gao, C.; Xiao, S.-B.; Liu, Z.-F.; et al. G2-quadruplex in the 3′UTR of IE180 regulates Pseudorabies virus replication by enhancing gene expression. RNA Biol. 2020, 17, 816–827. [Google Scholar] [CrossRef] [Scilit]
- Scherer, J.; Hogue, I.B.; Yaffe, Z.A.; Tanneti, N.S.; Winer, B.Y.; Vershinin, M.; Enquist, L.W. A kinesin-3 recruitment complex facilitates axonal sorting of enveloped alpha herpesvirus capsids. PLOS Pathog. 2020, 16, e1007985. [Google Scholar] [CrossRef] [Scilit]
- Bui-Nguyen, T.M.; Pakala, S.B.; Sirigiri, R.D.; Xia, W.; Hung, M.-C.; Sarin, S.K.; Kumar, V.; Slagle, B.L.; Kumar, R. NF-κB signaling mediates the induction of MTA1 by hepatitis B virus transactivator protein HBx. Oncogene 2009, 29, 1179–1189. [Google Scholar] [CrossRef] [Scilit]
- Rodríguez, C.I.; Nogal, M.L.; Carrascosa, A.L.; Salas, M.L.; Fresno, M.; Revilla, Y. African Swine Fever Virus IAP-Like Protein Induces the Activation of Nuclear Factor Kappa, B. J. Virol. 2002, 76, 3936–3942. [Google Scholar] [CrossRef] [Scilit]
- de Oliveira, D.E.; Ballon, G.; Cesarman, E. NF-κB signaling modulation by EBV and KSHV. Trends Microbiol. 2010, 18, 248–257. [Google Scholar] [CrossRef] [Scilit]
- Romero, N.; Wuerzberger-Davis, S.M.; Van Waesberghe, C.; Jansens, R.J.; Tishchenko, A.; Verhamme, R.; Miyamoto, S.; Favoreel, H.W. Pseudorabies Virus Infection Results in a Broad Inhibition of Host Gene Transcription. J. Virol. 2022, 96, e0071422. [Google Scholar] [CrossRef] [Scilit]
- Zhang, X.; Xie, J.; Gao, M.; Yan, Z.; Chen, L.; Wei, S.; Feng, R. Pseudorabies Virus ICP0 Abolishes Tumor Necrosis Factor Alpha-Induced NF-κB Activation by Degrading P65. Viruses 2022, 14, 954. [Google Scholar] [CrossRef] [Scilit]
- Romero, N.; Favoreel, H.W. Pseudorabies Virus Infection Triggers NF-κB Activation via the DNA Damage Response but Actively Inhibits NF-κB-Dependent Gene Expression. J. Virol. 2021, 95, e0166621. [Google Scholar] [CrossRef] [Scilit]
- Romero, N.; Van Waesberghe, C.; Favoreel, H.W. Pseudorabies Virus Infection of Epithelial Cells Leads to Persistent but Aberrant Activation of the NF-κB Pathway, Inhibiting Hallmark NF-κB-Induced Proinflammatory Gene Expression. J. Virol. 2020, 94, e00196-20. [Google Scholar] [CrossRef] [Scilit]
- Lawrence, T. The Nuclear Factor NF-kappa B Pathway in Inflammation. Cold Spring Harb. Perspect. Biol. 2009, 1, a001651. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ren, C.-Z.; Hu, W.-Y.; Zhang, J.-W.; Wei, Y.-Y.; Yu, M.-L.; Hu, T.-J. Establishment of inflammatory model induced by Pseudorabies virus infection in mice. J. Veter. Sci. 2021, 22, e20. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sun, W.; Liu, S.; Huang, X.; Yuan, R.; Yu, J. Cytokine storms and pyroptosis are primarily responsible for the rapid death of mice infected with pseudorabies virus. R. Soc. Open Sci. 2021, 8, 210296. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tang, N.; Ma, J.; Wang, K.S.; Mi, C.; Lv, Y.; Piao, L.X.; Xu, G.H.; Li, X.; Lee, J.J.; Jin, X. Dihydromyricetin suppresses TNF-α-induced NF-κB activation and target gene expression. Mol. Cell. Biochem. 2016, 422, 11–20. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Galluzzi, L.; Vitale, I.; Abrams, J.M.; Alnemri, E.S.; Baehrecke, E.H.; Blagosklonny, M.V.; Dawson, T.M.; Dawson, V.L.; El-Deiry, W.S.; Fulda, S.; et al. Molecular definitions of cell death subroutines: Recommendations of the Nomenclature Committee on Cell Death 2012. Cell Death Differ. 2012, 19, 107–120. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tait, S.W.G.; Green, D.R. Mitochondria and cell death: Outer membrane permeabilization and beyond. Nat. Rev. Mol. Cell Biol. 2010, 11, 621–632. [Google Scholar] [CrossRef] [Scilit]
- Orzalli, M.H.; Kagan, J.C. Apoptosis and Necroptosis as Host Defense Strategies to Prevent Viral Infection. Trends Cell Biol. 2017, 27, 800–809. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chang, C.-D.; Lin, P.-Y.; Liao, M.-H.; Chang, C.-I.; Hsu, J.-L.; Yu, F.-L.; Wu, H.-Y.; Shih, W.-L. Suppression of apoptosis by pseudorabies virus Us3 protein kinase through the activation of PI3-K/Akt and NF-κB pathways. Res. Veter. Sci. 2013, 95, 764–774. [Google Scholar] [CrossRef] [Scilit]
- Deruelle, M.J.; De Corte, N.; Englebienne, J.; Nauwynck, H.; Favoreel, H.W. Pseudorabies virus US3-mediated inhibition of apoptosis does not affect infectious virus production. J. Gen. Virol. 2010, 91, 1127–1132. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pontes, M.S.; Van Waesberghe, C.; Nauwynck, H.; Verhasselt, B.; Favoreel, H.W. Pseudorabies virus glycoprotein gE triggers ERK1/2 phosphorylation and degradation of the pro-apoptotic protein Bim in epithelial cells. Virus Res. 2016, 213, 214–218. [Google Scholar] [CrossRef] [Scilit]
- Sun, W.; Liu, S.; Lu, A.; Yang, F.; Duan, J. In vitro anti-PRV activity of dihydromyricetin from Ampelopsis grossedentata. Nat. Prod. Res. 2022, 36, 4448–4451. [Google Scholar] [CrossRef] [Scilit]
- Spitz, A.Z.; Gavathiotis, E. Physiological and pharmacological modulation of BAX. Trends Pharmacol. Sci. 2021, 43, 206–220. [Google Scholar] [CrossRef] [Scilit]
- Dewson, G.; Ma, S.; Frederick, P.; Hockings, C.; Tan, I.; Kratina, T.; Kluck, R.M. Bax dimerizes via a symmetric BH3: Groove interface during apoptosis. Cell Death Differ. 2011, 19, 661–670. [Google Scholar] [CrossRef] [Scilit]
- Boohaker, R.J.; Zhang, G.; Carlson, A.L.; Nemec, K.N.; Khaled, A.R. BAX supports the mitochondrial network, promoting bioenergetics in nonapoptotic cells. Am. J. Physiol. Physiol. 2011, 300, C1466–C1478. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Flores-Romero, H.; Garcia-Porras, M.; Basañez, G. Membrane insertion of the BAX core, but not latch domain, drives apoptotic pore formation. Sci. Rep. 2017, 7, 16259. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, Y.; Wang, W.; Qiu, E. Protection of oxidative stress induced apoptosis in osteosarcoma cells by dihydromyricetin through down-regulation of caspase activation and up-regulation of BcL-2. Saudi J. Biol. Sci. 2017, 24, 837–842. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhao, X.; Chen, Y.; Zhang, W.; Zhang, H.; Hu, Y.; Yang, F.; Zhang, Y.; Song, X. Dihydromyricetin Inhibits Pseudorabies Virus Multiplication In Vitro by Regulating NF-κB Signaling Pathway and Apoptosis. Vet. Sci. 2023, 10, 111. https://doi.org/10.3390/vetsci10020111
Zhao X, Chen Y, Zhang W, Zhang H, Hu Y, Yang F, Zhang Y, Song X. Dihydromyricetin Inhibits Pseudorabies Virus Multiplication In Vitro by Regulating NF-κB Signaling Pathway and Apoptosis. Veterinary Sciences. 2023; 10(2):111. https://doi.org/10.3390/vetsci10020111
Chicago/Turabian StyleZhao, Xufan, Yaqin Chen, Wenrui Zhang, Hui Zhang, Yilong Hu, Fengyu Yang, Yingying Zhang, and Xu Song. 2023. "Dihydromyricetin Inhibits Pseudorabies Virus Multiplication In Vitro by Regulating NF-κB Signaling Pathway and Apoptosis" Veterinary Sciences 10, no. 2: 111. https://doi.org/10.3390/vetsci10020111
APA StyleZhao, X., Chen, Y., Zhang, W., Zhang, H., Hu, Y., Yang, F., Zhang, Y., & Song, X. (2023). Dihydromyricetin Inhibits Pseudorabies Virus Multiplication In Vitro by Regulating NF-κB Signaling Pathway and Apoptosis. Veterinary Sciences, 10(2), 111. https://doi.org/10.3390/vetsci10020111

