Characterization of Two Porcine Parainfluenza Virus 1 Isolates and Human Parainfluenza Virus 1 Infection in Weaned Nursery Pigs
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Viruses and Cell Culture
2.2. Whole-Genome Sequencing
2.3. Phylogenetic Analysis
2.4. PPIV1 Antibody Detection by wv-ELISA
2.5. HPIV1 Antibody Detection by ELISA
2.6. PPIV1 Serum Virus Neutralization (SVN)
2.7. Animal Study Design
2.8. Sample Processing
2.9. Nucleic Acid Extraction and Detection of PPIV1 and HPIV1 by RT-qPCR
2.10. Macroscopic and Microscopic Lesions and Immunohistochemistry Scores
2.11. Statistical Analysis
3. Results
3.1. Phylogenetic Analysis
3.2. Clinical Performance and Average Daily Gain
3.3. Viral Shedding Detection in Nasal Swabs
3.4. Virus Detection in Tissues
3.5. Porcine and Human Parainfluenza Virus Humoral Antibody Response
3.6. Macroscopic and Microscopic Lesions at 5 DPI
3.7. Immunohistochemistry Results at 5 DPI
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Henrickson, K.J.; Savatski, L.L. Antigenic structure, function, and evolution of the hemagglutinin-neuraminidase protein of human parainfluenza virus type 1. J. Infect. Dis. 1997, 176, 867–875. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Coelingh, K.L.V.W.; Winter, C.; Murphy, B.R. Antigenic variation in the hemagglutinin-neuraminidase protein of human parainfluenza type 3 virus. Virology 1985, 143, 569–582. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Walker, P.J.; Siddell, S.G.; Lefkowitz, E.J.; Mushegian, A.R.; Adriaenssens, E.M.; Dempsey, D.M.; Dutilh, B.E.; Harrach, B.; Harrison, R.L.; Hendrickson, R.C.; et al. Changes to virus taxonomy and the Statutes ratified by the International Committee on Taxonomy of Viruses (2020). Arch. Virol. 2020, 165, 2737–2748. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Henrickson, K.J. Parainfluenza viruses. Clin. Microbiol. Rev. 2003, 16, 242–264. [Google Scholar] [CrossRef] [Scilit]
- Ellis, J.A. Bovine Parainfluenza-3 Virus. Veter. Clin. North Am. Food Anim. Pr. 2010, 26, 575–593. [Google Scholar] [CrossRef] [Scilit]
- Counihan, M.E.; Shay, D.; Holman, R.C.; Lowther, S.A.; Anderson, L.J. Human parainfluenza virus-associated hospitalizations among children less than five years of age in the United States. Pediatr. Infect. Dis. J. 2001, 20, 646–653. [Google Scholar] [CrossRef] [Scilit]
- Karp, D.; Willis, J.; Wilfert, C.M. Parainfluenza virus II and the immunocompromised host. Am. J. Dis. Child. 1974, 127, 592–593. [Google Scholar] [CrossRef] [Scilit]
- Lau, S.K.; Woo, P.C.; Wu, Y.; Wong, A.Y.; Wong, B.H.; Lau, C.C.; Fan, R.Y.; Cai, J.P.; Tsoi, H.-W.; Chan, K.H.; et al. Identification and characterization of a novel paramyxovirus, porcine parainfluenza virus 1, from deceased pigs. J. Gen. Virol. 2013, 94, 2184–2190. [Google Scholar] [CrossRef] [Scilit]
- Agüero, B.; Mena, J.; Berrios, F.; Tapia, R.; Salinas, C.; Dutta, J.; van Bakel, H.; Mor, S.; Brito, B.; Medina, R.; et al. First report of porcine respirovirus 1 in South America. Veter. Microbiol. 2020, 246, 108726. [Google Scholar] [CrossRef] [Scilit]
- Palinski, R.M.; Chen, Z.; Henningson, J.N.; Lang, Y.; Rowland, R.R.R.; Fang, Y.; Prickett, J.; Gauger, P.C.; Hause, B.M. Widespread detection and characterization of porcine parainfluenza virus 1 in pigs in the USA. J. Gen. Virol. 2016, 97, 281–286. [Google Scholar] [CrossRef] [Scilit]
- Park, J.Y.; Welch, M.W.; Harmon, K.M.; Zhang, J.; Piñeyro, P.E.; Li, G.; Hause, B.M.; Gauger, P.C. Detection, isolation, and in vitro characterization of porcine parainfluenza virus type 1 isolated from respiratory diagnostic specimens in swine. Veter. Microbiol. 2019, 228, 219–225. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schuele, L.; Lizarazo-Forero, E.; Cassidy, H.; Strutzberg-Minder, K.; Boehmer, J.; Schuetze, S.; Loebert, S.; Lambrecht, C.; Harlizius, J.; Friedrich, A.W.; et al. First detection of porcine respirovirus 1 in Germany and the Netherlands. Transbound. Emerg. Dis. 2021, 68, 3120–3125. [Google Scholar] [CrossRef] [Scilit]
- Dénes, L.; Cságola, A.; Schönhardt, K.; Halas, M.; Solymosi, N.; Balka, G. First report of porcine parainfluenza virus 1 (species Porcine respirovirus 1) in Europe. Transbound. Emerg. Dis. 2020, 68, 1731–1735. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Welch, M.; Park, J.; Harmon, K.; Zhang, J.; Piñeyro, P.; Giménez-Lirola, L.; Zhang, M.; Wang, C.; Patterson, A.; Gauger, P.C. Pathogenesis of a novel porcine parainfluenza virus type 1 isolate in conventional and colostrum deprived/caesarean derived pigs. Virology 2021, 563, 88–97. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lower, A. Porcine Parainfluenza Virus–Practitioner Perspective. In Proceedings of the AASV 49th Annual Meeting, San Diego, CA, USA, 3 March 2018. [Google Scholar]
- Zhang, J.; Zheng, Y.; Xia, X.-Q.; Chen, Q.; Bade, S.A.; Yoon, K.-J.; Harmon, K.M.; Gauger, P.C.; Main, R.G.; Li, G. High-throughput whole genome sequencing of Porcine reproductive and respiratory syndrome virus from cell culture materials and clinical specimens using next-generation sequencing technology. J. Vet. Diagn. Investig. 2016, 29, 41–50. [Google Scholar] [CrossRef] [Scilit]
- Chen, Q.; Li, G.; Stasko, J.; Thomas, J.T.; Stensland, W.R.; Pillatzki, A.E.; Gauger, P.C.; Schwartz, K.J.; Madson, D.; Yoon, K.-J.; et al. Isolation and Characterization of Porcine Epidemic Diarrhea Viruses Associated with the 2013 Disease Outbreak among Swine in the United States. J. Clin. Microbiol. 2014, 52, 234–243. [Google Scholar] [CrossRef] [Scilit]
- Welch, M.; Krueger, K.; Zhang, J.; Piñeyro, P.; Magtoto, R.; Wang, C.; Giménez-Lirola, L.; Strait, E.; Mogler, M.; Gauger, P. Detection of porcine parainfluenza virus type-1 antibody in swine serum using whole-virus ELISA, indirect fluorescence antibody and virus neutralizing assays. BMC Veter-Res. 2022, 18, 110. [Google Scholar] [CrossRef] [Scilit]
- Dymond, J.S. Chapter Twenty Three-Explanatory Chapter: Quantitative PCR. In Methods in Enzymology; Lorsch, J., Ed.; Academic Press: Cambridge, MA, USA, 2013; Volume 529, pp. 279–289. [Google Scholar]
- Halbur, P.G.; Paul, P.S.; Frey, M.L.; Landgraf, J.; Eernisse, K.; Meng, X.-J.; Lum, M.A.; Andrews, J.J.; Rathje, J.A. Comparison of the Pathogenicity of Two US Porcine Reproductive and Respiratory Syndrome Virus Isolates with that of the Lelystad Virus. Vet. Pathol. 1995, 32, 648–660. [Google Scholar] [CrossRef] [Scilit]
- Stadejek, T.; Cybulski, P.; Gauger, P.C.; Woźniak, A. European and American Strains of Porcine Parainfluenza Virus 1 (PPIV-1) Belong to Two Distinct Genetic Lineages. Pathogens 2022, 11, 375. [Google Scholar] [CrossRef] [Scilit]
- Yamaguchi, R.; Iwai, H.; Ueda, K. Variation of Virulence and Other Properties among Sendai Virus Strains. Microbiol. Immunol. 1988, 32, 235–240. [Google Scholar] [CrossRef] [Scilit]
- Frost, H.M.; Robinson, C.C.; Dominguez, S.R. Epidemiology and Clinical Presentation of Parainfluenza Type 4 in Children: A 3-Year Comparative Study to Parainfluenza Types 1–3. J. Infect. Dis. 2013, 209, 695–702. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sawicki, L. Influence of Age of Mice on the Recovery from Experimental Sendai Virus Infection. Nature 1961, 192, 1258–1259. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Brownstein, D.G. Genetics of natural resistance to Sendai virus infection in mice. Infect. Immun. 1983, 41, 308–312. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Neill, J.D.; Ridpath, J.F.; Valayudhan, B.T. Identification and genome characterization of genotype B and genotype C bovine parainfluenza type 3 viruses isolated in the United States. BMC Vet. Res. 2015, 11, 112. [Google Scholar] [CrossRef] [Scilit]
- Reed, G.; Jewett, P.H.; Thompson, J.; Tollefson, S.; Wright, P.F. Epidemiology and clinical impact of parainfluenza virus infections in otherwise healthy infants and young children <5 years old. J. Infect. Dis. 1997, 175, 807–813. [Google Scholar] [CrossRef] [Scilit]
- Frank, J.A.; Warren, R.W.; Tucker, J.A.; Zeller, J.; Wilfert, C.M. Disseminated Parainfluenza Infection in a Child with Severe Combined Immunodeficiency. Arch. Pediatr. Adolesc. Med. 1983, 137, 1172–1174. [Google Scholar] [CrossRef] [Scilit]
- Reisinger, R.C.; Heddleston, K.L.; A Manthei, C. A myxovirus (SF-4) associated with shipping fever of cattle. J. Am. Vet. Med. Assoc. 1959, 135, 147–152. [Google Scholar]
- Hoerlein, A.B.; E Mansfield, M.; Abinanti, F.R.; Huebner, R.J. Studies of shipping fever of cattle. I. Para-influenza 3 virus antibodies in feeder calves. J. Am. Vet. Med. Assoc. 1959, 135, 153–160. [Google Scholar]
- Betts, A.O.; Jennings, A.R.; Omar, A.R.; Page, Z.E.; Spence, J.B.; Walker, R.G. Pneumonia in calves caused by parainfluenza virus Type 3. Vet. Rec. 1964, 76, 382–384. [Google Scholar]
- Dawson, P.S.; Darbyshire, J.H.; Lamont, P.H. The inoculation of calves with parainfluenza 3 virus. Res. Vet. Sci. 1965, 6, 108–113. [Google Scholar] [CrossRef] [Scilit]
- Omar, A.; Jennings, A.; Betts, A. The Experimental Disease Produced in Calves by the J121 Strain of Parainfluenza Virus Type 3. Res. Vet. Sci. 1966, 7, 379–392. [Google Scholar] [CrossRef] [Scilit]
- Bryson, D.G.; McNulty, M.S.; Ball, H.J.; Neill, S.D.; Connor, T.J.; Cush, P.F. Experimental production of penumonia in calves by intranasal inoculation of parainfluenza type III virus. Vet. Rec. 1979, 105, 566–573. [Google Scholar] [PubMed]
- Qiao, D.; Janke, B.H.; Elankumaran, S. Complete Genome Sequence and Pathogenicity of Two Swine Parainfluenzavirus 3 Isolates from Pigs in the United States. J. Virol. 2010, 84, 686–694. [Google Scholar] [CrossRef] [Scilit]
- Qiao, D.; Janke, B.H.; Elankumaran, S. Molecular characterization of glycoprotein genes and phylogenetic analysis of two swine paramyxoviruses isolated from United States. Virus Genes 2009, 39, 53–65. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Thibault, P.A.; Watkinson, R.E.; Moreira-Soto, A.; Drexler, J.F.; Lee, B. Zoonotic Potential of Emerging Paramyxoviruses: Knowns and Unknowns. Adv. Virus Res. 2017, 98, 1–55. [Google Scholar] [CrossRef] [Scilit]
- Karron, R.A.; Wright, P.F.; Hall, S.L.; Makhene, M.; Thompson, J.; Burns, B.A.; Tollefson, S.; Steinhoff, M.C.; Wilson, M.H.; Harris, D.O.; et al. A Live Attenuated Bovine Parainfluenza Virus Type 3 Vaccine Is Safe, Infectious, Immunogenic, and Phenotypically Stable in Infants and Children. J. Infect. Dis. 1995, 171, 1107–1114. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Strating, A. Measles vaccine in dogs: Efficacy against aerosol challenge with virulent canine distemper virus. J. Am. Vet. Med. Assoc. 1975, 167, 59–62. [Google Scholar]






| Group | Virus | GenBank | N | Necropsy (N) | |
|---|---|---|---|---|---|
| 5 DPI | 28 DPI | ||||
| Ctrl | NA | NA | 6 | 4 | 2 |
| HPIV1 | Strain C35 ATCC® VR-94™ | JQ901971 | 8 | 5 | 3 |
| IA17 | USA/IA84915LG/2017 | MG753974 | 8 | 5 | 3 |
| MN16 | USA/MN25890NS/2016 | MF681710 | 8 | 5 | 3 |
| Primer NAME | Sequence (5′-3′) |
|---|---|
| HPIV1-For | TCGGTGCTGTTATTGGTACCAT |
| HPIV1-Rev | TCTCGTGCTTCAGCTAATGCA |
| HPIV1-Probe | FAM-CACTAGGAGTAGCCACAGCTGCCCAGA-Iowa Black |
| MN16 vs. IA17 | MN16 vs. HPIV1 | IA17 vs. HPIV1 | ||||||
|---|---|---|---|---|---|---|---|---|
| Genome Region | Gene [Length (nt), PPIV/HPIV] | Protein [Length (aa), PPIV/HPIV] | Δnt, N (%) § | Δaa, N (%) § | Δnt, N (%) § | Δaa, N (%) § | Δnt, N (%) § | Δaa, N (%) § |
| Whole Genome | 15334/15516 | NA | 285 (1.81%) | NA | 5111 (32.44%) | NA | 5125 (32.53%) | NA |
| Nucleoprotein (NP) | 1581/1575 | 527/525 | 36 (2.28%) | 8 (1.53%) | 466 (29.23%) | 136 (25.78%) | 462 (28.97%) | 135 (25.59%) |
| Phosphoprotein (P) | 1725/1803 | 575/601 | 79 (3.07%) | 32 (3.93%) | 978 (38.07%) | 445 (54.60%) | 986 (38.43%) | 453 (55.58%) |
| Matrix (M) | 1044/1047 | 348/349 | 18 (1.72%) | 3 (0.87%) | 319 (30.46%) | 86 (24.86%) | 324 (30.94%) | 85 (24.57%) |
| Fusion (F) | 1674/1668 | 558/556 | 25 (1.49%) | 13 (2.35%) | 579 (34.38%) | 200 (35.78%) | 578 (34.31%) | 198 (35.40%) |
| Hemagglutinin /Neuraminidase (HN) | 1731/1728 | 577/576 | 34 (1.91%) | 26 (4.98%) | 681 (38.66%) | 349 (67.76%) | 683 (38.77%) | 347 (67.35%) |
| Large Polymerase (L) | 6708/6693 | 2236/2231 | 86 (1.28%) | 57 (2.86%) | 1901 (28.33%) | 962 (48.19%) | 1908 (28.43%) | 967 (48.44%) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Welch, M.; Krueger, K.; Zhang, J.; Neveau, M.; Piñeyro, P.; Magstadt, D.; Main, R.; Gauger, P. Characterization of Two Porcine Parainfluenza Virus 1 Isolates and Human Parainfluenza Virus 1 Infection in Weaned Nursery Pigs. Vet. Sci. 2023, 10, 18. https://doi.org/10.3390/vetsci10010018
Welch M, Krueger K, Zhang J, Neveau M, Piñeyro P, Magstadt D, Main R, Gauger P. Characterization of Two Porcine Parainfluenza Virus 1 Isolates and Human Parainfluenza Virus 1 Infection in Weaned Nursery Pigs. Veterinary Sciences. 2023; 10(1):18. https://doi.org/10.3390/vetsci10010018
Chicago/Turabian StyleWelch, Michael, Karen Krueger, Jianqiang Zhang, Megan Neveau, Pablo Piñeyro, Drew Magstadt, Rodger Main, and Phillip Gauger. 2023. "Characterization of Two Porcine Parainfluenza Virus 1 Isolates and Human Parainfluenza Virus 1 Infection in Weaned Nursery Pigs" Veterinary Sciences 10, no. 1: 18. https://doi.org/10.3390/vetsci10010018
APA StyleWelch, M., Krueger, K., Zhang, J., Neveau, M., Piñeyro, P., Magstadt, D., Main, R., & Gauger, P. (2023). Characterization of Two Porcine Parainfluenza Virus 1 Isolates and Human Parainfluenza Virus 1 Infection in Weaned Nursery Pigs. Veterinary Sciences, 10(1), 18. https://doi.org/10.3390/vetsci10010018

