Next Article in Journal
Effects of Electrical Pulse Width and Output Irradiance on Intense Pulse Light Inactivation
Previous Article in Journal
Bilateral Sensorimotor Cortical Communication Modulated by Multiple Hand Training in Stroke Participants: A Single Training Session Pilot Study
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Bioengineering
Volume 9
Issue 12
10.3390/bioengineering9120729
bioengineering-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

New Insight into Muscle-Type Cofilin (CFL2) as an Essential Mediator in Promoting Myogenic Differentiation in Cattle

by
Yujia Sun
1,2,3,
Tianqi Zhao
1,3,
Yaoyao Ma
1,3,
Xinyi Wu
1,3,
Yongjiang Mao
3,
Zhangping Yang
1,3 and
Hong Chen
2,4,*
1
Joint International Research Laboratory of Agriculture and Agri-Product Safety, The Ministry of Education of China, Institutes of Agricultural Science and Technology Development, Yangzhou University, Yangzhou 225009, China
2
Key Laboratory of Animal Genetics, Breeding and Reproduction of Shaanxi Province, College of Animal Science and Technology, Northwest A&F University, Xianyang 712100, China
3
Key Laboratory of Animal Genetics & Breeding and Molecular Design of Jiangsu Province, Yangzhou University, Yangzhou 225009, China
4
College of Animal Science, Xinjiang Agricultural University, Urumqi 830052, China
*
Author to whom correspondence should be addressed.
Bioengineering 2022, 9(12), 729; https://doi.org/10.3390/bioengineering9120729
Submission received: 2 November 2022 / Revised: 22 November 2022 / Accepted: 23 November 2022 / Published: 25 November 2022
Browse Figures
Review Reports Versions Notes

Abstract

:
Meat quality and meat composition are not separated from the influences of animal genetic improvement systems; the growth and development of skeletal muscle are the primary factors in agricultural meat production and meat quality. Though the muscle-type cofilin (CFL2) gene has a crucial influence on skeletal muscle fibers and other related functions, the epigenetic modification mechanism of the CFL2 gene regulating meat quality remains elusive. After exploring the spatiotemporal expression data of CFL2 gene in a group of samples from fetal bovine, calf, and adult cattle, we found that the level of CFL2 gene in muscle tissues increased obviously with cattle age, whereas DNA methylation levels of CFL2 gene in muscle tissues decreased significantly along with cattle age by BSP and COBRA, although DNA methylation levels and mRNA expression levels basically showed an opposite trend. In cell experiments, we found that bta-miR-183 could suppress primary bovine myoblast differentiation by negatively regulated CFL2. In addition, we packaged recombinant adenovirus vectors for CFL2 gene knockout and overexpression and found that the CFL2 gene could promote the differentiation of primary bovine myoblasts by regulating marker genes MYOD, MYOG and MYH3. Therefore, CFL2 is an essential mediator for promoting myogenic differentiation by regulating myogenic marker genes in cattle myoblasts.

Graphical Abstract

1. Introduction

Meat quality and meat composition are not separated from the influences of animal genetic improvement systems. Previous studies have indicated that meat quality is tightly correlated with muscle composition and structure and the histological properties of muscle fibers [1,2]. It is therefore crucial to further study the molecular genetic mechanism of skeletal muscle growth and development [3]. Moreover, one study examined cofilin gene function as a key regulator of actin assembly on myoblast proliferation and differentiation [4]. In healthy mouse muscle cells, the type of cofilin from non-muscle cofilin transits to muscle cofilin [5]. In our previous study, we found that CFL1-mediated epigenetic regulation mechanisms were involved in the myogenic growth and differentiation [6]. Muscle-type cofilin is a new member of the cofilin protein family, which mainly regulates the expression of skeleton muscle and cardiac muscle. In mammals, muscle-type cofilin is also named CFL2 (cofilin-2, M-cofilin). Studies have shown that CFL2 was mainly detected in adult skeletal muscle and performs an essential role in skeleton muscle development and maintenance [7,8,9].
As the only subtype of mature skeletal muscle, CFL2 also performs a crucial function in maintaining the constitution of muscle fibers. A previous report showed that CFL2 is the primary expressed isoform of cofilin in adult muscle of human and murine, especially in skeletal and cardiac muscles [10]. CFL2 is essential for myoblast proliferation and differentiation by modulating the expression of myogenic transcription factors in C2C12 cells. Mai presented an unusual regulatory pattern, wherein CFL2 mediates myoblasts differentiation in C2C12 cells, significantly, CFL2 depletion suppressed cell differentiation, accelerated cell proliferation and induced cell cycle from the G0/G1 stages to the G2/M stages [11]. Considering CFL2 a candidate gene for nemaline myopathy, some studies have shown that the mutation from G to A in the coding region position 103 of the CFL2 gene can induce the occurrence of human nemaline myopathy, and the CFL2 gene can regulate the expression of key factors CAM and MEF2C in myofibroblast signal pathway, resulting in a change in muscle properties [12]. A CFL2A35T/A35T knock-in mouse model indicated that the expression levels of CFL2 mRNA and full-length transcript decreased significantly in skeletal muscles and muscle biopsy samples of a p.A35T mutation patient, respectively [13]. Sun examined the association of the CFL2 gene polymorphisms with performance traits in Qinchuan (QC) cattle. Base mutations at three single nucleotide polymorphisms sites were found in the coding region, which can significantly affect body length and body mass of cattle, indicating that the CFL2 gene can be used as a genetic marker for growth traits in cattle breeding program [14].
According to the regulation of the CFL2 gene on skeletal muscle fibers and other related functions, it can be observed that the CFL2 gene has an important influence on the growth and development of myocytes. However, if we want to study the way in which it affects skeletal muscle and the specific functional mechanism of muscle, we need to further explore the epigenetic regulation mechanism of CFL2 gene. Epigenetics has been recently undergoing the evolution of research field from diverse and complicated phenomena to profound and defined field [15]. Here, we investigated the regulatory functions of CFL2 from the angle of spatiotemporal expression pattern, DNA methylation and miRNA–target relationship. Our findings have made comprehensive analysis of the molecular regulation mechanisms of CFL2 gene on myogenesis. This has profound significance in understanding the complicated biological characteristics of meat quality and will provide a very strong basis for theoretical research for the subsequent genetic improvement of cattle breeds.

2. Materials and Methods

2.1. Tissue Collection and Cell Culturing

Seven tissue samples (heart, liver, spleen, lung, kidney, fat and longissimus dorsi muscle tissues) were harvested from three critical phases of muscle formation and maturation: 90-day embryonic (FB, fetal bovine, n = 3), 1-month postnatal (calf, n = 3), and 24-month-old (AC, adult cattle, n = 3) samples. All tissue samples used in this study were obtained from a local QC cattle breeding center (Xi’an, China); they were all female cattle and were raised in similar conditions.
The HEK293, 293A and C2C12 cell lines were the preservative cell lines from American ATCC in our laboratory. Primary bovine myoblasts (PBMs) were harvested from fetal bovine longissimus dorsi muscle and cultured by collagenase-I digestion as previously described [13]. Cell lines and PBMs were cultured following our previously established protocols [6].

2.2. Overexpression or Knock-Down Vector Construction of CFL2

CFL2 overexpression primers containing restriction sites KpnI (CFL2-CMV-F) and HindIII (CFL2-CMV- R) (TaKaRa, Dalian, China) were designed and synthesized. CFL2 knock-down primers containing restriction sites BamHI (shCFL2-1F, shCFL2-2F) and HindIII (shCFL2-1R, shCFL2-2R) (TaKaRa, Dalian, China) were designed and synthesized by BlockiT shRNA interference system. All primer information containing negative control (shRNA-NC-F/R, NC) is displayed in Table 1. Adenovirus vectors of pAdEasy-1/pAdtrack-CMV-CFL2 (CFL2-CMV) and pAD/PL-DEST/CMV-GFP/U6-shCFL2 (shCFL2-1 and shCFL2-2) were successfully constructed, and adenovirus recombinants displayed biological activity (Supplementary Data, Figures S1 and S2). The subsequent process for packaging recombinant adenovirus followed a previous protocol [16].

2.3. Cell Treatment and Cell Differentiation

For the biochemical study, differentiation medium (DM, 2% horse serum) replaced growth medium (GM, 10% fetal bovine serum) after the cell density reached 70~80%. C2C12 cells were cultured for 1, 2, 4, 6 and 8 days. In the meantime, plasmid CFL2-CMV, plasmid shCFL2-1, pAdTrack-CMV vector (control group) or siRNA negative control vector (NC) were injected into PBMs by lipofectamineTM 2000 (Invitrogen, Carlsbad, CA, USA) for myoblasts differentiation. PBMs were harvested at 1, 3, 5 and 7 days. HEK293 cells were transfected for 48 h to check the expression efficiency of recombinant adenovirus. Bta-miR-183 mimic (overexpression) or inhibitor (interference) was injected into PBMs and induced differentiation for 4 d.

2.4. Dual Luciferase Reporter Assay

The targeting sites between the CFL2 gene and bta-miR-183 were amplified using CFL2-wild-F/R primers (Table 2). An eight-base deletion of CFL2 3′UTR in the bta-miR-183 binding site was generated with mutagenic primers CFL2-mut-F/R (Table 2). psiCHECK-2 vector (Promega, Madison, WI, USA) wtih restriction enzymes XhoI and NotI (TaKaRa, Dalian, China) was used to produce psiCHECK-2-CFL2-wild or psiCHECK-2-CFL2-mutate (CFL2-Luc or CFL2-del Luc). Bta-miR-183 mimic and inhibitor were purchased from GenePharma (Shanghai, China). The dual-luciferase activity was analyzed by the Dual-Luciferase Reporter (DLR) Assay System (Promega, Madison, WI, USA) according to the manufacturer’s instructions.

2.5. Quantitative Real-Time PCR and Western Blot Assay

Total tissues or cellular RNA were obtained using TRIzol reagent (TaKaRa, Dalian, China), cDNA was synthesized using PrimeScript RT reagent Kit (TaKaRa, Dalian, China), and qRT-PCR was performed using SYBR Green Master Mix Reagen kit (GenStar, Beijing, China). U6 or GAPDH were synthesized to normalize the mRNA or protein level. All primers used for quantitative real-time PCR (qRT-PCR) are listed in Table 3.
The Western blot (WB) experiment was examined as supplementary data. The primary antibodies anti-CFL2 (ab14134) and anti-GAPDH (ab9485) were purchased from Abcam (Cambridge, UK), secondary antibody anti-immune rabbit IgG-HRP (LK2001) was purchased from Sungene Bio (Tianjin, China) and ECL luminous fluid (Solarbio, Beijing, China) was used to detect the antibody reacting bands.

2.6. Bisulfite Sequencing Polymerase Chain Reaction and Combined Bisulfite Restriction Analysis

Longissimus dorsi DNA were harvested from 90-day embryonic (4 male fetal bovine, FB) and 24-month-old (4 male adult cattle, AB) tissues by methylSEQr Bisulfite Conversion Kit (Applied Biosystems, Foster City, CA, USA) according to the manufacturer’s instructions. The Bisulfite Sequencing Polymerase Chain Reaction (BSP) primers from the CFL2 differentially methylated region (DMR) were designed by online software MethPrimer [17] (Table 4). All experiments performed 15 cloning sets (sequenced 5 clones, n = 3).
The combined bisulfite restriction analysis (COBRA) was performed as supplementary data. We performed COBRA analysis (on the same batch PCR products which were treated for BSP sequencing) using restriction enzymes HinfI (“GANTC”) for CFL2 DMR.

2.7. Statistical Data Analysis

All data were presented as the mean ± SE (standard error). The outcomes were resolved by the 2−ΔΔCt method [18] and assessed by SPSS statistics V18.0. One-way ANOVA was performed for multiple comparisons using GraphPad Prism V8.0 (GraphPad Software, San Diego, CA, USA). p-value < 0.05 or <0.01 were judged as statistical differences or significant differences, respectively.
BSP data were analyzed by online software QUMA [19] and BiQ Analyzer [20]. The differences of methylation levels were analyzed by SPSS statistics V18.0.

3. Results

3.1. Spatiotemporal Expression Profiles of CFL2 Gene in Different Tissues

In order to investigate the CFL2 role in cattle, our study first detected the mRNA expression levels of CFL2 in seven different tissues of three developmental phases in QC cattle using qRT-PCR. The expressions of the CFL2 gene have the same performance in fetal bovine, calf and adult cattle. CFL2 gene showed the highest expression in muscle tissues, followed by expression in heart and lowest expression in spleen in the three growth and development stages (p < 0.05) (Figure 1A–C). At the fetal bovine stage, the mRNA levels of CFL2 gene among liver, kidney and lung tissues were not significantly different (p > 0.05) (Figure 1A). At the calf stage, the mRNA levels of CFL2 gene in fat and liver were higher than in kidney and lung (p < 0.05) (Figure 1B), whereas at the adult cattle stage, the mRNA levels of the CFL2 gene among the lung, kidney and fat tissues were not statistically different (p > 0.05) (Figure 1C).
We further detected the CFL2 gene mRNA expression level in the same three tissue growth and development stages of QC cattle; the expression trends are shown in Figure 1D. In heart, liver and lung tissues, the expression of CFL2 gene indicated an upward trend in three growth and development stages along with cattle age. Additionally, due to no fat deposition in FB stage, adipose tissues were observed in calf stage and AC stage, and the results revealed that mRNA expression levels of CFL2 gene have an extremely significant increase in adult bovine compared to that of the calf (p < 0.01). In the spleen, the CFL2 gene has a higher expression level in the calf; the mRNA level was unexpectedly upregulated in the calf relative to that of the FB and AC stages (p < 0.05), whereas the mRNA expression level in the AC period presented a diminishing drift compared to those of the FB stage and calf stage in kidney tissues (p < 0.01), and the differences in mRNA expression levels in the fetal bovine and calf period were insignificant (p > 0.05). In muscle tissue, the CFL2 gene mRNA level presented an extremely significantly upward trend with cattle age (p < 0.01) (Figure 1E).

3.2. DNA Methylation Analysis of CFL2 Promoter Region in Muscle Tissues

We explored DNA methylation assays on myogenesis and muscle maturation to demonstrate the impression of CFL2 gene differential methylation level on myoblast differentiation at the FB and AC stages. The CpG islands seated in CFL2 DMR were predicted by MethPrimer [17]; one CpG island of CFL2 gene promoter region was taken as research objective (Figure 2A). We found 8 CpGs at CFL2 DMR (177 bp) by BSP-amplified sequences. Every sample sequenced 15 clones; then, we detected 120 CpGs in every muscle sample at CFL2 DMR. The methylated CpGs percentages of CFL2 gene were 61.7%, 61.7%, 60.8% and 60.0% in the FB group; there were 47.5%, 47.5%, 46.7% and 48.3% in the AC group. Statistical results presented that the FB group (mean 61.1%) had prominently higher methylation levels than the AC group (mean 47.5%) (Figure 2B). In order to improve the specificity and to decrease the false positives of BSP sequencing results, we further detected COBRA assay by using restriction enzymes HinfI (“GANTC”) (Figure 2C). At the fourth and fifth CpG sites, 177 bp PCR fragments of CFL2 DMR were digested with HinfI and obtained 177, 128 and 49 bp fragment bands by COBRA (Figure 2D). The outcomes were in accordance with the results of BSP sequencing.
In cells, methyl moieties may directly regulate the action of transcription factors. To further testify the relationship between DNA methylation level and the expression level of CFL2 gene in muscle tissues at the FB group and the AC group, the following experiment tested the mRNA level of the CFL2 gene. In contrasted with the FB group, the mRNA level of the CFL2 gene in the AC group was statistically higher (p < 0.05) (Figure 2E).

3.3. bta-miR-183 Target Muscle Type CFL2

In addition to influences on muscle, previous study showed that bta-miR-183 represented regulator of proteolysis in muscle, which affects meat tenderness. To verify this hypothesis in C2C12 cell lines, after treating bta-miR-183, mimic or inhibitor, the mRNA level was statistically induced or suppressed (Figure 3A). After performing induction for 4 days for cell differentiation, we found that the mRNA levels of myoblast differentiation marker genes MYOD, MYOG and MYH3 were downregulated by bta-miR-183 mimic (p < 0.05). Interestingly, the mRNA levels of these three marker genes were statistically upregulated by the bta-miR-183 inhibitor (p < 0.01) (Figure 3B,C). These data revealed that bta-miR-183 could suppress PBM differentiation.
To further determine the effect of CFL2 gene on myoblast differentiation, we examined whether bta-miR-183 directly targets and regulates CFL2 expression. As shown in Figure 3D,E, the mRNA and protein levels of CFL2 were prominently upregulated or downregulated after being treated with bta-miR-183 inhibitor or mimicked in PBMs (p < 0.01 or p < 0.05). These results indicated that bta-miR-183 negatively regulated the expression of CFL2. Using the in silico method, we predicted a potential binding site for the bta-miR-183 seed sequence in 3′UTR of CFL2 mRNA in ten different species, which revealed highly conservative bta-miR-183 target sites (Figure 3F). To verify direct interaction sites between bta-miR-183 and CFL2, we generated a luciferase reporter psiCHECK-2 construct containing a CFL2 3′UTR segment or delete binding site for bta-miR-183 (Figure 3G). Compared to only containing the NC vector (p < 0.01), renilla luciferase activity was prominently reduced when bta-miR-183 mimic and CFL2-Luc co-transfected PBMs, while fluorescent reactive was resumed after bta-miR-183 mimic co-transfected with CFL2-del Luc (p > 0.05) (Figure 3H). The base data showed that miR-183 directly binds to CFL2 3′-UTR.

3.4. Effects of CFL2 Gene on Myoblasts Differentiation

To further investigate whether CFL2 influences the expressions of myogenic factors, we generated an adenovirus overexpression and interference construct (Supplementary Data, Figures S1 and S2). mRNA and protein assays demonstrated that CFL2 expression levels were obviously up-regulated or down-regulated after transfection of CFL2-CMV or shCFL2 in HEK293 cells (p < 0.01); meanwhile, shCFL2-1 had stronger knock-down effects than shCFL2-2 (Figure 4A–C). After transfecting CFL2-CMV or shCFL2-1 into C2C12 cells, the marker genes MYH3, MYOG and MYOD were assessed on differentiation day 4. We found the mRNA levels of MYOD and MYH3 were upregulated after being transfected with CFL2-CMV (p < 0.05), while MYOG level was not apparently changed (p > 0.05). After transfecting shCFL2-1, the mRNA expression levels of marker genes were extremely significantly decreased (p < 0.01) (Figure 4D,E). After being induced for 8 days (DM 1–8 d) in C2C12 cells, CFL2 and marker genes of mRNA levels presented upward trends. During this process, the expression level of the MYH3 gene was always lower than that of other genes, and MYOD gene continuously maintained a high expression level, except it was lower than MYOG gene on DM2. The CFL2 gene and the MYOD gene displayed the identical differentiation trends with a downward trend during 6–8 days (DM 6–8 d) in the late differentiation stage (Figure 4F).
In vitro, PBM model is the optimal one for studying myoblast differentiation (Supplementary Data, Figure S3). After transfection with CFL2-CMV, the mRNA level of CFL2 was significantly up-regulated at 3–7 days (p < 0.05 or p < 0.01) (Figure 5A,I) and the mRNA levels of MYOD, MYOG and MYH3 were extremely significantly increased (p < 0.01), except that there was no obvious difference in MYH3 at 1 day (p > 0.05) (Figure 5B–D). After transfection with shCFL2-1, the expression of CFL2 was significantly decreased compared to control group (p < 0.05 or p < 0.01) (Figure 5E), and MYOG was significantly down-regulated during myoblast differentiation (p < 0.05 or p < 0.01) (Figure 5G,J). Meanwhile, the mRNA levels of MYOD and MYH3 showed an obvious decrease after 3 days of myoblast differentiation (p < 0.05 or p < 0.01) (Figure 5F,H).
After transfection with CFL2-CMV, the expression trend of CFL2 was gradually up-regulated during myoblast differentiation (DM 1–7 d) (p < 0.01); meanwhile, MYOD and MYOG showed a significantly upward trend, and MYH3 slightly increased during myoblast differentiation (Figure 5I). After transfection with shCFL2-1, the expression of CFL2 presented a significantly downregulated trend during myoblast differentiation (DM 1–7 d); in the meantime, the expression trends of MYOD, MYOG and MYH3 were significantly downward (p < 0.05 or p < 0.01), and the peak values of CFL2 and MYH3 both occurred at day 5 after induction and then showed a slight increase after induction (Figure 5J). Our findings have made comprehensive analysis of the molecular genetic regulation mechanisms of CFL2 gene on myogenesis.

4. Discussion

The PBM model acts as an optimal model for perusing myoblast differentiation. It is primarily associated with muscle growth and development and can improve muscle quality [21]. During culturing, a change in the serum could stimulate myoblasts to differentiate to myocytes or myotubes; in the meantime, the expression of some genes regulated the phenotypes of meat quality by some special epigenetic mechanisms [22]. Our previous research showed that the CFL2 gene was significantly associated with body mass in bovinae [14], and there is a strong association between skeletal muscle mass, muscle fiber characteristics, meat quality and meat yield of beef cattle. Consequently, it is especially crucial to further expound the epigenetic regulatory network of muscle-related genes.
As a muscle subtype, the CFL2 gene was generally considered to be mainly expressed in mammalian muscle tissue. Our present study reveals the myogenic regulatory characteristics of the CFL2 gene in myoblast differentiation. An analysis of the spatiotemporal expression showed that the CFL2 gene is widely distributed in various organizations. This indicates that the CFL2 gene has a wide range of biological functions, whereas at the three growth and developmental stages, it revealed a vary expression trend in seven tissues. Especially in AC group muscle tissues, the mRNA expression level of the CFL2 gene was increased probably eight times in comparison with the FB group and showed a high expression pattern and a meaningful increasing trend along with the muscle growth and development. These findings seem to be in accordance with earlier research on mice muscle tissue [8] and further demonstrate that the cofilin expression subtype could gradually transition to M-CFL2 along with the growth and development of myocytes [5,23].
Skeletal muscle development can be split into two stages: the prenatal stage that affects the number of muscle fibers and the postnatal stage that generates the size of muscle fibers [24]. The expression change in CFL2 in muscle growth was likely correlated with the regulatory pattern of external epigenetics. Generally, DNA methylation participates in suppression patterns during muscle growth and development in mammals by regulating gene expression. Previous study examined the DNA methylation and mRNA expression of the SERPINA3 gene DMR in muscle tissues and demonstrated that mRNA expression levels of genes could be affected by DNA methylation levels considerably [25], and research has demonstrated that a number of methylated genes could act as candidate beef tenderness biomarkers [26]. In our prior study, there was a negative correlation between DNA methylation status and the expression level of the IGF2 gene in muscle tissues during the FB and AC stages [27]. Compared to the FB group, the CFL2 gene showed an obviously high mRNA expression level and relatively low DNA methylation extent in the AC group in this experiment; here, a detectable trend for mammalian DNA methylation patterns to vary in time and space was observed. In FB and AC, the question arises of how DNA methylated patterns arise in development and maintenance, and how they affect the genetic expression in the whole genome. Though these burning questions cannot be elucidated explicitly now, additional studies have addressed distinct hypotheses experimentally in muscle growth and development [28].
Although miRNAs act as an important factor in myogenesis and pathogenesis of muscle wasting, the regulatory mechanisms of miRNAs are mainly expressed by targeting mRNAs [4,29,30]. There are four miRNAs that have been experimentally validated to be capable of regulating bovine skeletal muscle development by miRNA–mRNA interactions; nine miRNAs have been identified modulating PBMs differentiation through binding functional genes experimentally [31] (Table S1). Owing to the innumerable target genes, the epigenetic mechanisms of miR-183 seemed very complicated and even inconsistent during skeletal muscle differentiation. Several studies have expounded the miR-183 function on the apoptosis, proliferation and invasion of cancers by negatively regulated FOXO1 [32,33,34]. Our previous data exhibited that the FOXO1 gene plays a major part in the bovine myoblast differentiation [22]. Thus, the function of miR-183 in PBMs differentiation is still unknown, and the regulatory relationship between miR-183 and CFL2 has no reports. This research found that miR-183 may suppress PBM differentiation and confirmed the targeting site with CFL2, further clarifying the negative regulation mechanism on the CFL2 gene. These findings enriched the academic theories of miR-183 on meat tenderness [21] and filled the vacancy of miR-183/CFL2 axis in the field of PBM differentiation.
The quality of meat products was mainly affected by the muscle structure and histological characteristics of myofiber, which closely related to muscle cell differentiation [35]. In this experiment, we demonstrated that miR-183 restrained myoblast differentiation and preliminarily confirmed the profile trend of the CFL2 gene and related marker genes’ effects on myoblast differentiation during one week. Muscle differentiation is a complex process that involves a multistage gene expression and regulation [36,37,38]. Many research results have reported that CFL2 intensifies C2C12 cell line differentiation. In C2C12 cells, knock-down CFL2 has given rise to F-actin accumulation, accelerated cell cycle progress and increased cell proliferation [11]. Previous studies showed that miR-325-3p mimic suppressed the expression of CFL2 but elevated the accumulation of F-actin, induced the translocation of nuclear YAP, delayed myogenic differentiation, accelerated the progression of cell cycle and ultimately promoted myoblast proliferation [21]. In this experiment, the expression level of CFL2 increased gradually during C2C12 differentiation, the peak of related marker genes occurred at different time nodes; then, all showed a downward trend after DM6 introduction. Due to the fact that during myogenesis, myoblasts differentiate into myocytes and myotubes exhibit an opposite relationship, when myotubes were completely formed, myoblasts have been fully differentiated, and we inferred that marker genes MYH3, MYOG and MYOD were activated at different myoblast differentiation phases, revealing that CFL2 may be essential for myoblast differentiation.
Earlier work has authenticated an increase in CFL2 mRNA during skeletal muscle myogenesis of mice [39]. Thus, we further confirmed the specific regulatory function of CFL2 in myoblast differentiation by transfected recombinant adenovirus vectors into PBMs. The results of the present study exhibited a significantly higher expression of CFL2 in the late differentiation stage (5–7 d, myotubes to form myofiber) than in the initial differentiation stage (1–3 d, mononucleated fuse to multinucleated myotubes). Subsequently, CFL2 gene overexpression had obviously increased the mRNA level of MYH3, MYOG and MYOD and knock-down CFL2 gene obviously decreased the mRNA levels of MYH3, MYOG and MYOD during PBM differentiation. This means that CFL2 tends to promote myoblasts differentiation. Recent evidence indicates that cofilin family genes (CFL1 and CFL2) participate in actin cytoskeleton remodeling [40]. Notably, the CFL1 and CFL2 genes can be expressed simultaneously in embryonic skeletal muscle, whereas the CFL2 gene replaces the CFL1 gene in the late stage of differentiation [6,8]. This means that cofilin only presents one subtype (CFL1 or CFL2) along with the muscle cell growth and development in healthy mouse [41]. This fact may be related to the myogenic regulatory roles of the CFL2 gene in myoblasts; therefore, we intend to develop a new system for myogenic differentiation monitored by CFL2 from the perspective of molecular genetics and epigenetics. CFL2 depletion inactivated cell differentiation progression and inhibited the expressions of myogenic transcription factors, thereby eventually leading to impaired myogenic differentiation in myoblasts [11,42]. In light of this, we observed that decreased expression of CFL2 significantly suppressed myoblast differentiation. Our research results were consistent with previous results and showed that CFL2 promoted myoblast differentiation, which is also sufficient for the induction of muscle differentiation.

5. Conclusions

In summary, our study reveals that CFL2 was predominantly expressed in adult muscle tissues. It also promoted PBM differentiation by negatively targeting epigenetic modification in cattle. Our results will provide benefits for ameliorating the cattle meat production and meat quality.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/bioengineering9120729/s1, Figure S1: Production of CFL2-CMV recombinant adenovirus in 293A cells. PacI-digested pAdEasy-GFP-CFL2 was transfected into 293A cells and GFP expression was visualized by fluorescence microscopy at the indicated times thereafter. Comet-like adenovirus-producing foci became apparent after 6 days. In total, 80% of cells became round and could receive virus after 10 days. Figure S2: Production of shCFL2-1 recombinant adenovirus in 293A cells. Pac I-digested pAdEasy-GFP-shCFL2-2 was transfected into 293A cells, and GFP expression was visualized by fluorescence microscopy at the indicated times thereafter. Comet-like adenovirus-producing foci became apparent after 6 days. In total, 80% of cells became round and could receive virus after 10 days. Figure S3. Identification of bovine primary myoblast cells (×100). (A) Bovine primary myoblast cells cultered from bovine longissimus muscle. (B) The cells on the day 5 of induced differentiation. Table S1: The published miRNAs to skeletal muscle myoblast development in cattle.

Author Contributions

Conceptualization, Y.S.; Data curation, Y.S.; Validation, T.Z.; Formal analysis, T.Z. and Y.M. (Yaoyao Ma); Investigation, T.Z. and Y.M. (Yaoyao Ma); Writing—original draft preparation, Y.S.; Writing—review and editing, H.C., Z.Y. and Y.M. (Yongjiang Mao); Supervision, H.C.; Project administration, X.W.; Funding acquisition, Y.S. and H.C. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Natural Science Foundation of China (No. 31902147) and the Program of National Beef Cattle and Yak Industrial Technology System (CARS-37).

Institutional Review Board Statement

This study involved animal experimental procedures and was approved by the Institutional Animal Care and Use Committee of Northwest A&F University (Permit number: NWAFAC1019) and Yangzhou University (License number: SYXK [Su] 2017-0044).

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Acknowledgments

We are grateful to Kunpeng Liu (Northwest A&F University) for his technical support.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Li, C.B.; Xu, X.L.; Zhou, G.H.; Xu, S.Q.; Zhang, J.B. Effects of carcass maturity on meat quality characteristics of beef semitendinosus muscle for chinese native yellow steers. Animal 2007, 1, 780–786. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  2. Covington, R.C.; Tuma, H.J.; Grant, D.L.; Dayton, A.D. Various chemical and histological characteristics of beef muscle as related to tenderness. J. Anim. Sci. 1970, 30, 191–196. [Google Scholar] [CrossRef]
  3. Pas, M.T.; Keuning, E.; Hulsegge, B.; Hoving-Bolink, A.H.; Evans, G.; Mulder, H.A. Longissimus muscle transcriptome profiles related to carcass and meat quality traits in fresh meat Pietrain carcasses. J. Anim. Sci. 2010, 88, 4044–4055. [Google Scholar] [CrossRef] [PubMed]
  4. Nguyen, M.T.; Lee, W. Role of MiR-325-3p in the Regulation of CFL2 and Myogenic Differentiation of C2C12 Myoblasts. Cells 2021, 10, 2725. [Google Scholar] [CrossRef] [PubMed]
  5. Ono, S.; Minami, N.; Abe, H.; Obinata, T. Characterization of a novel cofilin isoform that is predominantly expressed in mammalian skeletal muscle. J. Biol. Chem. 1994, 269, 15280–15286. [Google Scholar] [CrossRef]
  6. Sun, Y.; Ma, Y.; Zhao, T.; Li, M.; Mao, Y.; Yang, Z. Epigenetic Regulation Mechanisms of the Cofilin-1 Gene in the Development and Differentiation of Bovine Primary Myoblasts. Genes 2022, 13, 723. [Google Scholar] [CrossRef]
  7. Kanellos, G.; Frame, M.C. Cellular functions of the ADF/cofilin family at a glance. J. Cell Sci. 2016, 129, 3211. [Google Scholar] [CrossRef] [Green Version]
  8. Mohri, K.; Takano-Ohmuro, H.; Nakashima, H.; Hayakawa, K.; Endo, T.; Hanaoka, K.; Obinata, T. Expression of cofilin isoforms during development of mouse striated muscles. J. Muscle Res. Cell Motil. 2000, 21, 49–57. [Google Scholar] [CrossRef]
  9. Ikeda, S.; Cunningham, L.A.; Boggess, D.; Hawes, N.; Hobson, C.D.; Sundberg, J.P.; Naggert, J.K.; Smith, R.S.; Nishina, P.M. Aberrant actin cytoskeleton leads to accelerated proliferation of corneal epithelial cells in mice deficient for destrin (actin depolymerizing factor). Hum. Mol. Genet. 2003, 12, 1029–1037. [Google Scholar] [CrossRef]
  10. Thirion, C.; Stucka, R.; Mendel, B.; Gruhler, A.; Jaksch, M.; Nowak, K.J.; Binz, N.; Laing, N.G.; Lochmüller, H. Characterization of human muscle type cofilin (CFL2) in normal and regenerating muscle. Eur. J. Biochem. 2001, 268, 3473–3482. [Google Scholar] [CrossRef]
  11. Mai, T.N.; Min, K.H.; Kim, D.; Park, S.Y.; Wan, L. CFL2 is an essential mediator for myogenic differentiation in C2C12 myoblasts. Biochem. Biophys. Res. Commun. 2020, 533, 710–716. [Google Scholar]
  12. Agrawal, P.B.; Greenleaf, R.S.; Tomczak, K.K.; Lehtokari, V.-L.; Wallgren-Pettersson, C.; Wallefeld, W.; Laing, N.G.; Darras, B.T.; Maciver, S.K.; Dormitzer, P.R.; et al. Nemaline Myopathy with Minicores Caused by Mutation of the CFL2 Gene Encoding the Skeletal Muscle Actin–Binding Protein, Cofilin-2. Am. J. Hum. Genet. 2007, 80, 162–167. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  13. Rosen, S.M.; Mugdha, J.; Talia, H.; Beggs, A.H.; Agrawal, P.B. Knockin mouse model of the human CFL2 p.A35T mutation results in a unique splicing defect and severe myopathy phenotype. Hum. Mol. Genet. 2020, 29, 1996–2003. [Google Scholar] [CrossRef] [PubMed]
  14. Sun, Y.; Lan, X.; Lei, C.; Zhang, C.; Chen, H. Haplotype combination of the bovine CFL2 gene sequence variants and association with growth traits in Qinchuan cattle. Gene 2015, 563, 136–141. [Google Scholar] [CrossRef] [PubMed]
  15. Goldberg, A.D.; Allis, C.; Bernstein, E.J.C. Epigenetics: A Landscape Takes Shape. Cell 2007, 128, 635–638. [Google Scholar] [CrossRef] [Green Version]
  16. Luo, J.; Deng, Z.L.; Luo, X.; Tang, N.; Song, W.X.; Chen, J.; Sharff, K.A.; Luu, H.H.; Haydon, R.C.; Kinzler, K.W. A protocol for rapid generation of recombinant adenoviruses using the AdEasy system. Nat. Protoc. 2007, 2, 1236. [Google Scholar] [CrossRef] [Green Version]
  17. Li, L.C.; Dahiya, R. MethPrimer: Designing primers for methylation PCRs. Bioinformatics 2002, 18, 1427–1431. [Google Scholar] [CrossRef] [Green Version]
  18. Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative CT method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef]
  19. Kumaki, Y.; Oda, M.; Okano, M. QUMA: Quantification tool for methylation analysis. Nucleic Acids Res. 2008, 36, 170–175. [Google Scholar] [CrossRef]
  20. Bock, C.; Reither, S.; Mikeska, T.; Paulsen, M.; Walter, J.; Lengauer, T. BiQ Analyzer: Visualization and quality control for DNA methylation data from bisulfite sequencing. Bioinformatics 2005, 21, 4067–4068. [Google Scholar] [CrossRef]
  21. Raza, S.H.A.; Kaster, N.; Khan, R.; Abdelnour, S.A.; El-Hack, M.E.A.; Khafaga, A.F.; Taha, A.; Ohran, H.; Swelum, A.A.; Schreurs, N.M.; et al. The Role of MicroRNAs in Muscle Tissue Development in Beef Cattle. Genes 2020, 11, 295. [Google Scholar] [CrossRef] [PubMed]
  22. Sun, Y.; Liu, K.; Huang, Y.; Lan, X.; Chen, H. Differential expression of FOXO1 during development and myoblast differentiation of Qinchuan cattle and its association analysis with growth traits. Sci. China Life Sci. 2018, 61, 826–835. [Google Scholar] [CrossRef] [PubMed]
  23. Gillett, G.T.; Fox, M.F.; Rowe, P.; Casimir, C.M.; Povey, S. Mapping of human non-muscle type cofilin (CFL1) to chromosome 11q13 and muscle-type cofilin (CFL2) to chromosome 14. Ann. Hum. Genet. 2012, 60, 201–211. [Google Scholar] [CrossRef] [PubMed]
  24. Hocquette, J.F. Endocrine and metabolic regulation of muscle growth and body composition in cattle. Anim. Int. J. Anim. Biosci. 2010, 4, 1797–1809. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  25. Wang, D.; Wen, Y.; Zhang, Z.; Yang, S.; Huang, Y. DNA methylation status of SERPINA3 gene involved in mRNA expression in three cattle breeds. Anim. Biotechnol. 2021, 33, 1289–1295. [Google Scholar] [CrossRef] [PubMed]
  26. Zhao, C.; Ji, G.; Carrillo, J.A.; Li, Y.; Tian, F.; Baldwin, R.L.; Zan, L.; Song, J. The Profiling of DNA Methylation and Its Regulation on Divergent Tenderness in Angus Beef Cattle. Front. Genet. 2021, 11, 939. [Google Scholar] [CrossRef]
  27. Huang, Y.Z.; Zhan, Z.Y.; Sun, Y.J.; Cao, X.K.; Li, M.X.; Wang, J.; Lan, X.Y.; Lei, C.Z.; Zhang, C.L.; Chen, H. Intragenic DNA methylation status down-regulates bovine IGF2 gene expression in different developmental stages. Gene 2014, 534, 356–361. [Google Scholar] [CrossRef]
  28. Bird, A. DNA methylation patterns and epigenetic memory. Genes Dev. 2002, 16, 6–21. [Google Scholar] [CrossRef] [Green Version]
  29. Clifford, R.L.; Singer, C.A.; John, A.E. Epigenetics and miRNA emerge as key regulators of smooth muscle cell phenotype and function. Pulm. Pharmacol. Ther. 2013, 26, 75–85. [Google Scholar] [CrossRef] [Green Version]
  30. Sannicandro, A.J.; Soriano-Arroquia, A.; Goljanek-Whysall, K. Micro(RNA)-managing muscle wasting. J. Appl. Physiol. 2019, 127, 619–632. [Google Scholar] [CrossRef]
  31. Hao, D.; Wang, X.; Wang, X.; Thomsen, B.; Yang, Y.; Lan, X.; Huang, Y.; Chen, H. MicroRNA bta-miR-365-3p inhibits proliferation but promotes differentiation of primary bovine myoblasts by targeting the activin A receptor type I. J. Anim. Sci. Biotechnol. 2021, 12, 141–154. [Google Scholar] [CrossRef] [PubMed]
  32. Suzuki, R.; Amatya, V.J.; Kushitani, K.; Kai, Y.; Kambara, T.; Takeshima, Y. miR-182 and miR-183 Promote Cell Proliferation and Invasion by Targeting FOXO1 in Mesothelioma. Front. Oncol. 2018, 8, 446. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  33. Shang, A.; Wang, X.; Gu, C.; Liu, W.; Sun, J.; Zeng, B.; Chen, C.; Ji, P.; Wu, J.; Quan, W. Exosomal miR-183-5p promotes angiogenesis in colorectal cancer by regulation of FOXO1. Aging 2020, 12, 8352–8371. [Google Scholar] [CrossRef] [PubMed]
  34. Yang, R.; Ma, D.; Wu, Y.; Zhang, Y.; Zhang, L. LncRNA SNHG16 Regulates the Progress of Acute Myeloid Leukemia Through miR183-5p–FOXO1 Axis. OncoTargets Ther. 2020, 13, 12943–12954. [Google Scholar] [CrossRef] [PubMed]
  35. Ji, A.; Pc, A.; As, A.; Pg, B.; Cc, A.; Yl, C.; Of, C.; Ab, B. Gestational nutrient restriction under extensive grazing conditions: Effects on muscle characteristics and meat quality in heavy lambs. Meat Sci. 2021, 179, 108532. [Google Scholar]
  36. Wang, J. Checking before changing: Cell cycle checkpoints inhibit muscle differentiation. Cell Cycle 2011, 10, 3234–3235. [Google Scholar] [CrossRef] [Green Version]
  37. Adhikari, A.; Kim, W.; Davie, J. Myogenin is required for assembly of the transcription machinery on muscle genes during skeletal muscle differentiation. PLoS ONE 2021, 16, e0245618. [Google Scholar] [CrossRef]
  38. Jabre, S.; Hleihel, W.; Coirault, C. Nuclear Mechanotransduction in Skeletal Muscle. Cells 2021, 10, 318. [Google Scholar] [CrossRef]
  39. Vartiainen, M.K.; Mustonen, T.; Mattila, P.K.; Ojala, P.J.; Thesleff, I.; Partanen, J.; Lappalainen, P. The three mouse actin-depolymerizing factor/cofilins evolved to fulfill cell-type-specific requirements for actin dynamics. Mol. Biol. Cell 2002, 13, 183–194. [Google Scholar] [CrossRef] [Green Version]
  40. Bernstein, B.W.; Bamburg, J.R. ADF/cofilin: A functional node in cell biology. Trends Cell Biol. 2010, 20, 187–195. [Google Scholar] [CrossRef] [Green Version]
  41. Liu, N.; Bassel-Duby, R. Regulation of Skeletal Muscle Development and Disease by microRNAs. Vertebr. Myogenesis 2015, 56, 165–190. [Google Scholar]
  42. Zhu, H.; Yang, H.; Zhao, S.; Zhang, J.; Liu, D.; Tian, Y.; Shen, Z.; Su, Y. Role of the cofilin 2 gene in regulating the myosin heavy chain genes in mouse myoblast C2C12 cells. Int. J. Mol. Med. 2018, 41, 1096–1102. [Google Scholar] [CrossRef] [PubMed]
Bioengineering 09 00729 g001 550
Figure 1. Spatiotemporal expression profiles of CFL2 gene in cattle tissues. qRT-PCR was used to examine CFL2 gene mRNA levels of spatiality in six tissues at FB stage (A), seven tissues at calf stage (B), seven tissues at AC stage (C); CFL2 mRNA levels in lung tissues were taken as 1. qRT-PCR was used to investigate CFL2 gene mRNA levels of temporally at three developing stages along with cattle age (D,E); CFL2 mRNA levels at FB stage were taken as 1. Due to the no fat deposition in FB stage, CFL2 mRNA levels at calf stage were taken as 1 in adipose tissues. Mean data ± SE of n = 3 independent experiments, each performed in triplicate, and normalized to GAPDH. * p < 0.05 and ** p < 0.01.
Figure 1. Spatiotemporal expression profiles of CFL2 gene in cattle tissues. qRT-PCR was used to examine CFL2 gene mRNA levels of spatiality in six tissues at FB stage (A), seven tissues at calf stage (B), seven tissues at AC stage (C); CFL2 mRNA levels in lung tissues were taken as 1. qRT-PCR was used to investigate CFL2 gene mRNA levels of temporally at three developing stages along with cattle age (D,E); CFL2 mRNA levels at FB stage were taken as 1. Due to the no fat deposition in FB stage, CFL2 mRNA levels at calf stage were taken as 1 in adipose tissues. Mean data ± SE of n = 3 independent experiments, each performed in triplicate, and normalized to GAPDH. * p < 0.05 and ** p < 0.01.
Bioengineering 09 00729 g001
Bioengineering 09 00729 g002 550
Figure 2. DNA methylation analysis of CFL2 promoter region in muscle tissues. Schematic representation of the proximal promoter region (+1 to −3850 base pairs) to predict high-GC-content regions of CFL2 gene. In CFL2 gene promoter region, there were 177 bp CFL2 DMR (A). BSP assay was used to analyze DNA methylation profiles in FB and AC muscle tissues. There are few rows, one for each of the monoclonal bacterial antibodies; there are 8 columns, meaning 8 CpG islands; black circles, meaning methylated CpG region; and white circles, meaning unmethylated CpG region (B). The 177 bp CFL2 DMR contains eight CpG islands, lower strands present bisulfite-converted bases, and yellow highlights and arrows indicate primer sequences using HinfI (“GANTC”) to cut 4th–5th CpG islands for COBRA assay (C). COBRA assay was performed to analyze the DNA methylation patterns in FB and AC muscle tissues, each performed in quadruplicate. M means Marker I (D). We further examined the CFL2 gene mRNA levels in FB and AC muscle tissues. Mean data ± SE of n = 3 independent experiments, each performed in quadruplicate, and normalized to GAPDH, (* p < 0.05) (E).
Figure 2. DNA methylation analysis of CFL2 promoter region in muscle tissues. Schematic representation of the proximal promoter region (+1 to −3850 base pairs) to predict high-GC-content regions of CFL2 gene. In CFL2 gene promoter region, there were 177 bp CFL2 DMR (A). BSP assay was used to analyze DNA methylation profiles in FB and AC muscle tissues. There are few rows, one for each of the monoclonal bacterial antibodies; there are 8 columns, meaning 8 CpG islands; black circles, meaning methylated CpG region; and white circles, meaning unmethylated CpG region (B). The 177 bp CFL2 DMR contains eight CpG islands, lower strands present bisulfite-converted bases, and yellow highlights and arrows indicate primer sequences using HinfI (“GANTC”) to cut 4th–5th CpG islands for COBRA assay (C). COBRA assay was performed to analyze the DNA methylation patterns in FB and AC muscle tissues, each performed in quadruplicate. M means Marker I (D). We further examined the CFL2 gene mRNA levels in FB and AC muscle tissues. Mean data ± SE of n = 3 independent experiments, each performed in quadruplicate, and normalized to GAPDH, (* p < 0.05) (E).
Bioengineering 09 00729 g002
Bioengineering 09 00729 g003 550
Figure 3. Bta-miR-183 target muscle type CFL2. Expression efficiency of miR-183 was examined after treating bta-miR-183 mimic and inhibitor for 48 h in C2C12 cells (A). The expression of myoblast differentiation marker genes MYOD, MYOG, and MYH3 were detected by qRT-PCR after transfecting miR-183 mimic or inhibitor into C2C12 cells and inducing for 4 d with 2% horse serum (B,C). The expression level of miR-183 was normalized to U6, the mRNA levels of CFL2 and three marker genes were normalized to GAPDH. CFL2 mRNA (D) and protein (E) expression in PBMs were detected by qRT-PCR and Western blot after being transfected with miR-183 mimic, miR-183 inhibitor and NC for 48 h. Putative binding sites of miR-183 on the 3′UTR fragments of CFL2 mRNA were detected in different species (F). Computational prediction of the targeting sites of miR-183 on the 3′UTR fragments of CFL2 was conducted in Bos Taurus, and 8 base deletion of CFL2 3′UTR was designed for mutant type (G). PBMs co-transfected with pairwise plasmids (bta-miR-183 mimic and CFL2-Luc, NC and CFL2-Luc, bta-miR-183 mimic and CFL2-del Luc, NC and CFL2-del Luc), and Renilla luciferase activity was normalized to the firefly luciferase activity (H). NC, Negative Control. Mean data ± SE of n = 3 independent experiments, each performed in triplicate. * p < 0.05 and ** p < 0.01.
Figure 3. Bta-miR-183 target muscle type CFL2. Expression efficiency of miR-183 was examined after treating bta-miR-183 mimic and inhibitor for 48 h in C2C12 cells (A). The expression of myoblast differentiation marker genes MYOD, MYOG, and MYH3 were detected by qRT-PCR after transfecting miR-183 mimic or inhibitor into C2C12 cells and inducing for 4 d with 2% horse serum (B,C). The expression level of miR-183 was normalized to U6, the mRNA levels of CFL2 and three marker genes were normalized to GAPDH. CFL2 mRNA (D) and protein (E) expression in PBMs were detected by qRT-PCR and Western blot after being transfected with miR-183 mimic, miR-183 inhibitor and NC for 48 h. Putative binding sites of miR-183 on the 3′UTR fragments of CFL2 mRNA were detected in different species (F). Computational prediction of the targeting sites of miR-183 on the 3′UTR fragments of CFL2 was conducted in Bos Taurus, and 8 base deletion of CFL2 3′UTR was designed for mutant type (G). PBMs co-transfected with pairwise plasmids (bta-miR-183 mimic and CFL2-Luc, NC and CFL2-Luc, bta-miR-183 mimic and CFL2-del Luc, NC and CFL2-del Luc), and Renilla luciferase activity was normalized to the firefly luciferase activity (H). NC, Negative Control. Mean data ± SE of n = 3 independent experiments, each performed in triplicate. * p < 0.05 and ** p < 0.01.
Bioengineering 09 00729 g003
Bioengineering 09 00729 g004 550
Figure 4. Preliminary functional verification of CFL2 gene adenovirus vectors. mRNA expression efficiency of CFL2 was detected after CFL2 gene overexpression (A) or CFL2 gene interference (B) in HEK293 cells. The protein levels of CFL2 gene were examined by Western blot after being treated with shCFL2-1 or shCFL2-2 for 48 h in HEK293 cells (C). The mRNA levels of marker genes were examined after being treated with CFL2-CMV (D) or shCFL2-1. (E) induced C2C12 cells differentiated for 4 days. C2C12 cells were cultured for 8 days after DM replaced GM, and the mRNA change tendency of CFL2 gene and three marker genes was further examined by qRT-PCR (F). GM means growth medium. DM means differentiation medium. CTRL means Control. Mean data ± SE of n = 3 independent experiments, each performed in triplicate, and normalized to GAPDH. * p < 0.05 and ** p < 0.01.
Figure 4. Preliminary functional verification of CFL2 gene adenovirus vectors. mRNA expression efficiency of CFL2 was detected after CFL2 gene overexpression (A) or CFL2 gene interference (B) in HEK293 cells. The protein levels of CFL2 gene were examined by Western blot after being treated with shCFL2-1 or shCFL2-2 for 48 h in HEK293 cells (C). The mRNA levels of marker genes were examined after being treated with CFL2-CMV (D) or shCFL2-1. (E) induced C2C12 cells differentiated for 4 days. C2C12 cells were cultured for 8 days after DM replaced GM, and the mRNA change tendency of CFL2 gene and three marker genes was further examined by qRT-PCR (F). GM means growth medium. DM means differentiation medium. CTRL means Control. Mean data ± SE of n = 3 independent experiments, each performed in triplicate, and normalized to GAPDH. * p < 0.05 and ** p < 0.01.
Bioengineering 09 00729 g004
Bioengineering 09 00729 g005 550
Figure 5. Effects of the CFL2 gene on the differentiation of PBMs. After being treated with CFL2-CMV (A–D) or shCFL2-1 (E–H) induced cells differentiate for 7 days by DM in PBMs; subsequently, the mRNA levels of CFL2 gene and myogenic marker factors MYOD, MYOG and MYH3 were examined once on alternate days. Then, the developmental expression patterns of CFL2 gene and three myogenic marker genes from GM to DM7 were further examined after being treated with CFL2-CMV (I) or shCFL2-1 (J) in PBMs. Mean data ± SE of n = 3 independent experiments, each performed in triplicate, and normalized to GAPDH. * p < 0.05 and ** p < 0.01.
Figure 5. Effects of the CFL2 gene on the differentiation of PBMs. After being treated with CFL2-CMV (A–D) or shCFL2-1 (E–H) induced cells differentiate for 7 days by DM in PBMs; subsequently, the mRNA levels of CFL2 gene and myogenic marker factors MYOD, MYOG and MYH3 were examined once on alternate days. Then, the developmental expression patterns of CFL2 gene and three myogenic marker genes from GM to DM7 were further examined after being treated with CFL2-CMV (I) or shCFL2-1 (J) in PBMs. Mean data ± SE of n = 3 independent experiments, each performed in triplicate, and normalized to GAPDH. * p < 0.05 and ** p < 0.01.
Bioengineering 09 00729 g005
Table
Table 1. Primer information (containing protective bases and restriction sites) for adenovirus vector construction.
Table 1. Primer information (containing protective bases and restriction sites) for adenovirus vector construction.
NamePrimer Sequences (5′-3′)
CFL2-CMV-FCGGggtaccATGGCTTCTGGAGTTAC
CFL2-CMV-RCCCaagcttTCAcatcatcaccatcaccatTAAGGGTTTTCCTTC
shCFL2-1FgatccCTGAAAGTGCACCGTTAAATTCAAGAGATTTAACGGTGCACTTTCAGtttttta
shCFL2-1RagcttaaaaaaCTGAAAGTGCACCGTTAAATCTCTTGAATTTAACGGTGCACTTTCAGg
shCFL2-2FgatccGCTCTAAAGATGCCATTAATTCAAGAGATTAATGGCATCTTTAGAGCtttttta
shCFL2-2RagcttaaaaaaGCTCTAAAGATGCCATTAATCTCTTGAATTAATGGCATCTTTAGAGCg
shRNA-NC-FgatccTTCTCCGAACGTGTCACGTTTCAAGAGAACGTGACACGTTCGGAGAAtttttta
shRNA-NC-RagcttaaaaaaTTCTCCGAACGTGTCACGTTCTCTTGAAACGTGACACGTTCGGAGAAg
Table
Table 2. Primer information (containing protective bases and restriction sites) for dual luciferase report assay.
Table 2. Primer information (containing protective bases and restriction sites) for dual luciferase report assay.
NamePrimer Sequences (5′-3′)
CFL2-wild-FCCGCTCGAGGGAGGCAATGTAGTAGTTTC
CFL2-wild-RATAAGAATGCGGCCGCCAAGGCAGGTGAGGTGTATG
CFL2-mut-FTATAAAGCAGTCAACTGGATCTTAAGGAG
CFL2-mut-RTCCTTAAGATCCAGTTGACTGCTTTATAAG
Table
Table 3. Primer information for qRT-PCR.
Table 3. Primer information for qRT-PCR.
NamePrimer Sequences (5′-3′)
CFL2-FGGTGACATTGGTGATACTG
CFL2-RCATATCGGCAATCATTCAGA
bta-miR-183-RTGTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCAGTGAAT
bta-miR-183-FACACTCCAGCTGGGTATGGCACTGGTAGA
miR-RGCAGGGTCCGAGGTATTC
U6-FGCTTCGGCAGCACATATACTAAAAT
U6-RCGCTTCACGAATTTGCGTGTCAT
GAPDH-FAGATAGCCGTAACTTCTGTGC
GAPDH-RACGATGTCCACTTTGCCAG
Table
Table 4. Primer information of CFL2 DMR for BSP.
Table 4. Primer information of CFL2 DMR for BSP.
NamePrimer Sequence (5′-3′)
CFL2-DMR-FGGAAAATTTTTGAAAATGTTTTTT
CFL2-DMR-RCTTTAAAATCATCCTAACCAATACC
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Sun, Y.; Zhao, T.; Ma, Y.; Wu, X.; Mao, Y.; Yang, Z.; Chen, H. New Insight into Muscle-Type Cofilin (CFL2) as an Essential Mediator in Promoting Myogenic Differentiation in Cattle. Bioengineering 2022, 9, 729. https://doi.org/10.3390/bioengineering9120729

AMA Style

Sun Y, Zhao T, Ma Y, Wu X, Mao Y, Yang Z, Chen H. New Insight into Muscle-Type Cofilin (CFL2) as an Essential Mediator in Promoting Myogenic Differentiation in Cattle. Bioengineering. 2022; 9(12):729. https://doi.org/10.3390/bioengineering9120729

Chicago/Turabian Style

Sun, Yujia, Tianqi Zhao, Yaoyao Ma, Xinyi Wu, Yongjiang Mao, Zhangping Yang, and Hong Chen. 2022. "New Insight into Muscle-Type Cofilin (CFL2) as an Essential Mediator in Promoting Myogenic Differentiation in Cattle" Bioengineering 9, no. 12: 729. https://doi.org/10.3390/bioengineering9120729

APA Style

Sun, Y., Zhao, T., Ma, Y., Wu, X., Mao, Y., Yang, Z., & Chen, H. (2022). New Insight into Muscle-Type Cofilin (CFL2) as an Essential Mediator in Promoting Myogenic Differentiation in Cattle. Bioengineering, 9(12), 729. https://doi.org/10.3390/bioengineering9120729

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop