Platelet-Rich Fibrin-Conditioned Medium as an Alternative to Fetal Bovine Serum Promotes Osteogenesis of Human Dental Pulp Stem Cells
Abstract
1. Introduction
2. Materials and Methods
2.1. The Isolation of Liquid-PRF and Preparation of PRF-Conditioned Medium
2.2. The Isolation and Culturing of Dental Pulp Stem Cells
2.3. Cell Proliferation
2.4. Osteogenic Differentiation
2.5. Flow Cytometry
2.6. Alkaline Phosphatase Staining
2.7. Von Kossa Staining
2.8. Alizarin Red S Staining
2.9. Real-Time Reverse Transcription–Polymerase Chain Reaction (RT-PCR) Analysis
2.10. Statistical Analysis
3. Results
3.1. Characterization of DPSCs in FBS or PRF-CM Conditions
3.2. Comparison of the Proliferation Potential of DPSCs in FBS and PRF-CM
3.3. PRF-CM Promotes Osteogenic Differentiation of DPSCs Compared with FBS
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Gronthos, S.; Mankani, M.; Brahim, J.; Robey, P.G.; Shi, S. Postnatal human dental pulp stem cells (DPSCs) in vitro and in vivo. Proc. Natl. Acad. Sci. USA 2000, 97, 13625–13630. [Google Scholar] [CrossRef] [PubMed]
- Gronthos, S.; Brahim, J.; Li, W.; Fisher, L.W.; Cherman, N.; Boyde, A.; DenBesten, P.; Robey, P.G.; Shi, S. Stem cell properties of human dental pulp stem cells. J. Dent. Res. 2002, 81, 531–535. [Google Scholar] [CrossRef] [PubMed]
- Martellucci, S.; Manganelli, V.; Santacroce, C.; Santilli, F.; Piccoli, L.; Sorice, M.; Mattei, V. Role of Prion protein-EGFR multimolecular complex during neuronal differentiation of human dental pulp-derived stem cells. Prion 2018, 12, 117–126. [Google Scholar] [CrossRef] [PubMed]
- Martellucci, S.; Santacroce, C.; Manganelli, V.; Santilli, F.; Piccoli, L.; Cassetta, M.; Misasi, R.; Sorice, M.; Mattei, V. Isolation, Propagation, and Prion Protein Expression During Neuronal Differentiation of Human Dental Pulp Stem Cells. J. Vis. Exp. 2019, 145, e59282. [Google Scholar] [CrossRef]
- Fujii, Y.; Hatori, A.; Chikazu, D.; Ogasawara, T. Application of Dental Pulp Stem Cells for Bone and Neural Tissue Regeneration in Oral and Maxillofacial Region. Stem Cells Int. 2023, 2023, 2026572. [Google Scholar] [CrossRef]
- Carter, R.A.; Wicks, I.P. Vascular cell adhesion molecule 1 (CD106): A multifaceted regulator of joint inflammation. Arthritis Rheum. 2001, 44, 985–994. [Google Scholar] [CrossRef]
- Sato, M.; Kawase-Koga, Y.; Yamakawa, D.; Fujii, Y.; Chikazu, D. Bone Regeneration Potential of Human Dental Pulp Stem Cells Derived from Elderly Patients and Osteo-Induced by a Helioxanthin Derivative. Int. J. Mol. Sci. 2020, 21, 7731. [Google Scholar] [CrossRef]
- Yamakawa, D.; Kawase-Koga, Y.; Fujii, Y.; Kanno, Y.; Sato, M.; Ohba, S.; Kitaura, Y.; Kashiwagi, M.; Chikazu, D. Effects of Helioxanthin Derivative-Treated Human Dental Pulp Stem Cells on Fracture Healing. Int. J. Mol. Sci. 2020, 21, 9158. [Google Scholar] [CrossRef]
- Chamieh, F.; Collignon, A.M.; Coyac, B.R.; Lesieur, J.; Ribes, S.; Sadoine, J.; Llorens, A.; Nicoletti, A.; Letourneur, D.; Colombier, M.L.; et al. Accelerated craniofacial bone regeneration through dense collagen gel scaffolds seeded with dental pulp stem cells. Sci. Rep. 2016, 6, 38814. [Google Scholar] [CrossRef]
- Bonnamain, V.; Thinard, R.; Sergent-Tanguy, S.; Huet, P.; Bienvenu, G.; Naveilhan, P.; Farges, J.C.; Alliot-Licht, B. Human dental pulp stem cells cultured in serum-free supplemented medium. Front. Physiol. 2013, 4, 357. [Google Scholar] [CrossRef][Green Version]
- Kawase-Koga, Y.; Fujii, Y.; Yamakawa, D.; Sato, M.; Chikazu, D. Identification of neurospheres generated from human dental pulp stem cells in xeno-/serum-free conditions. Regen. Ther. 2020, 14, 128–135. [Google Scholar] [CrossRef] [PubMed]
- Dohle, E.; El Bagdadi, K.; Sader, R.; Choukroun, J.; James Kirkpatrick, C.; Ghanaati, S. Platelet-rich fibrin-based matrices to improve angiogenesis in an in vitro co-culture model for bone tissue engineering. J. Tissue Eng. Regen. Med. 2018, 12, 598–610. [Google Scholar] [CrossRef] [PubMed]
- Farshidfar, N.; Jafarpour, D.; Firoozi, P.; Sahmeddini, S.; Hamedani, S.; de Souza, R.F.; Tayebi, L. The application of injectable platelet-rich fibrin in regenerative dentistry: A systematic scoping review of In vitro and In vivo studies. Jpn. Dent. Sci. Rev. 2022, 58, 89–123. [Google Scholar] [CrossRef] [PubMed]
- Ghanaati, S.; Herrera-Vizcaino, C.; Al-Maawi, S.; Lorenz, J.; Miron, R.J.; Nelson, K.; Schwarz, F.; Choukroun, J.; Sader, R. Fifteen Years of Platelet Rich Fibrin in Dentistry and Oromaxillofacial Surgery: How High is the Level of Scientific Evidence? J. Oral Implantol. 2018, 44, 471–492. [Google Scholar] [CrossRef]
- Arshad, S.; Tehreem, F.; Rehab Khan, M.; Ahmed, F.; Marya, A.; Karobari, M.I. Platelet-Rich Fibrin Used in Regenerative Endodontics and Dentistry: Current Uses, Limitations, and Future Recommendations for Application. Int. J. Dent. 2021, 2021, 4514598. [Google Scholar] [CrossRef]
- Choukroun, J.; Ghanaati, S. Reduction of relative centrifugation force within injectable platelet-rich-fibrin (PRF) concentrates advances patients’ own inflammatory cells, platelets and growth factors: The first introduction to the low speed centrifugation concept. Eur. J. Trauma Emerg. Surg. 2018, 44, 87–95. [Google Scholar] [CrossRef]
- Al-Maawi, S.; Dohle, E.; Lim, J.; Weigl, P.; Teoh, S.H.; Sader, R.; Ghanaati, S. Biologization of Pcl-Mesh Using Platelet Rich Fibrin (Prf) Enhances Its Regenerative Potential In Vitro. Int. J. Mol. Sci. 2021, 22, 2159. [Google Scholar] [CrossRef]
- Masuki, H.; Okudera, T.; Watanebe, T.; Suzuki, M.; Nishiyama, K.; Okudera, H.; Nakata, K.; Uematsu, K.; Su, C.Y.; Kawase, T. Growth factor and pro-inflammatory cytokine contents in platelet-rich plasma (PRP), plasma rich in growth factors (PRGF), advanced platelet-rich fibrin (A-PRF), and concentrated growth factors (CGF). Int. J. Implant Dent. 2016, 2, 19. [Google Scholar] [CrossRef]
- Burnouf, T.; Strunk, D.; Koh, M.B.; Schallmoser, K. Human platelet lysate: Replacing fetal bovine serum as a gold standard for human cell propagation? Biomaterials 2016, 76, 371–387. [Google Scholar] [CrossRef]
- Barro, L.; Burnouf, P.A.; Chou, M.L.; Nebie, O.; Wu, Y.W.; Chen, M.S.; Radosevic, M.; Knutson, F.; Burnouf, T. Human platelet lysates for human cell propagation. Platelets 2021, 32, 152–162. [Google Scholar] [CrossRef]
- Hatori, A.; Fujii, Y.; Kawase-Koga, Y.; Ogasawara, T.; Chikira, J.; Minami, S.; Yamakawa, D.; Chikazu, D. VCAM-1 and GFPT-2: Predictive markers of osteoblast differentiation in human dental pulp stem cells. Bone 2023, 166, 116575. [Google Scholar] [CrossRef] [PubMed]
- Namjoynik, A.; Islam, M.A.; Islam, M. Evaluating the efficacy of human dental pulp stem cells and scaffold combination for bone regeneration in animal models: A systematic review and meta-analysis. Stem Cell. Res. Ther. 2023, 14, 132. [Google Scholar] [CrossRef] [PubMed]
- Bui, H.T.H.; Nguyen, L.T.; Than, U.T.T. Influences of Xeno-Free Media on Mesenchymal Stem Cell Expansion for Clinical Application. Tissue Eng. Regen. Med. 2021, 18, 15–23. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Wu, J.; Lin, X.; Liu, X. Platelet-rich fibrin promotes the proliferation and osteo-/odontoblastic differentiation of human dental pulp stem cells. Curr. Stem Cell Res. Ther. 2022, 18, 560–567. [Google Scholar] [CrossRef] [PubMed]
- Gervois, P.; Ratajczak, J.; Wolfs, E.; Vangansewinkel, T.; Dillen, Y.; Merckx, G.; Bronckaers, A.; Lambrichts, I. Preconditioning of Human Dental Pulp Stem Cells with Leukocyte- and Platelet-Rich Fibrin-Derived Factors Does Not Enhance Their Neuroregenerative Effect. Stem Cells Int. 2019, 2019, 8589149. [Google Scholar] [CrossRef]
- Luzuriaga, J.; Polo, Y.; Pastor-Alonso, O.; Pardo-Rodríguez, B.; Larrañaga, A.; Unda, F.; Sarasua, J.-R.; Pineda, J.R.; Ibarretxe, G. Advances and Perspectives in Dental Pulp Stem Cell Based Neuroregeneration Therapies. Int. J. Mol. Sci. 2021, 22, 3546. [Google Scholar] [CrossRef]
- Mercado-Rubio, M.D.; Pérez-Argueta, E.; Zepeda-Pedreguera, A.; Aguilar-Ayala, F.J.; Peñaloza-Cuevas, R.; Kú-González, A.; Rojas-Herrera, R.A.; Rodas-Junco, B.A.; Nic-Can, G.I. Similar Features, Different Behaviors: A Comparative In VitroStudy of the Adipogenic Potential of Stem Cells from Human Follicle, Dental Pulp, and Periodontal Ligament. J. Pers. Med. 2021, 11, 738. [Google Scholar] [CrossRef]
- Al-Maawi, S.; Dohle, E.; Kretschmer, W.; Rutkowski, J.; Sader, R.; Ghanaati, S. A Standardized g-Force Allows the Preparation of Similar Platelet-Rich Fibrin Qualities Regardless of Rotor Angle. Tissue Eng. Part A 2022, 28, 353–365. [Google Scholar] [CrossRef]
- Wend, S.; Kubesch, A.; Orlowska, A.; Al-Maawi, S.; Zender, N.; Dias, A.; Miron, R.J.; Sader, R.; Booms, P.; Kirkpatrick, C.J.; et al. Reduction of the relative centrifugal force influences cell number and growth factor release within injectable PRF-based matrices. J. Mater. Sci. Mater. Med. 2017, 28, 188. [Google Scholar] [CrossRef]
- El Bagdadi, K.; Kubesch, A.; Yu, X.; Al-Maawi, S.; Orlowska, A.; Dias, A.; Booms, P.; Dohle, E.; Sader, R.; Kirkpatrick, C.J.; et al. Reduction of relative centrifugal forces increases growth factor release within solid platelet-rich-fibrin (PRF)-based matrices: A proof of concept of LSCC (low speed centrifugation concept). Eur. J. Trauma Emerg. Surg. 2019, 45, 467–479. [Google Scholar] [CrossRef]
Gene | Primer Sequences (Forward and Reverse, 5′-3′) | Accession |
---|---|---|
GAPDH | GAAGGTGAAGGTCGGAGTCA | BC023632 |
GAAGATGGTGATGGGATTTC | ||
ALP | ATGAAGGAAAAGCCAAGCAG | NM_000478 |
ATGGAGACATTCTCTCGTTC | ||
RUNX2 | CAGACCAGCAGCACTCCATA | NM_004348 |
CAGCGTCAACACCATCATTC | ||
COLIA1 | GTGCTAAAGGTGCCAATGGT | NM_000088 |
CTCCTCGCTTTCCTTCCTCT | ||
BGLAP | GGCAGCGAGGTAGTGAAGAG | NM_199173 |
AGCAGAGCGACACCCTAGAC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hatori, A.; Yamakawa, D.; Al-Maawi, S.; Dohle, E.; Chikira, J.; Fujii, Y.; Miki, M.; Sader, R.; Chikazu, D.; Ghanaati, S.; et al. Platelet-Rich Fibrin-Conditioned Medium as an Alternative to Fetal Bovine Serum Promotes Osteogenesis of Human Dental Pulp Stem Cells. Bioengineering 2023, 10, 1196. https://doi.org/10.3390/bioengineering10101196
Hatori A, Yamakawa D, Al-Maawi S, Dohle E, Chikira J, Fujii Y, Miki M, Sader R, Chikazu D, Ghanaati S, et al. Platelet-Rich Fibrin-Conditioned Medium as an Alternative to Fetal Bovine Serum Promotes Osteogenesis of Human Dental Pulp Stem Cells. Bioengineering. 2023; 10(10):1196. https://doi.org/10.3390/bioengineering10101196
Chicago/Turabian StyleHatori, Ayano, Daiki Yamakawa, Sarah Al-Maawi, Eva Dohle, Jin Chikira, Yasuyuki Fujii, Megumu Miki, Robert Sader, Daichi Chikazu, Shahram Ghanaati, and et al. 2023. "Platelet-Rich Fibrin-Conditioned Medium as an Alternative to Fetal Bovine Serum Promotes Osteogenesis of Human Dental Pulp Stem Cells" Bioengineering 10, no. 10: 1196. https://doi.org/10.3390/bioengineering10101196
APA StyleHatori, A., Yamakawa, D., Al-Maawi, S., Dohle, E., Chikira, J., Fujii, Y., Miki, M., Sader, R., Chikazu, D., Ghanaati, S., & Kawase-Koga, Y. (2023). Platelet-Rich Fibrin-Conditioned Medium as an Alternative to Fetal Bovine Serum Promotes Osteogenesis of Human Dental Pulp Stem Cells. Bioengineering, 10(10), 1196. https://doi.org/10.3390/bioengineering10101196