Next Article in Journal
Tri-Ortho-Cresyl Phosphate Inhibits Proliferation of Mouse Germ Cells by Activating Endoplasmic Reticulum Stress and Suppressing NTE Activity
Previous Article in Journal
Fatal Outcome Following Polysubstance Use: A Case Report of Rhabdomyolysis, Acute Kidney Injury, and Deep Vein Thrombosis
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Toxics
Volume 14
Issue 4
10.3390/toxics14040274
toxics-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Tributyltin Alters Hepatic Immune Microenvironment to ProMote Liver Fibrosis Progression in Rats

by
Nuo Zhou
1,†,
Xiaoyu Si
2,†,
Wenhuan Yao
3,
Jiliang Si
1,
Dong Cheng
3,* and
Hui Li
3,*
1
School of Public Health, Cheeloo College of Medicine, Shandong University, Jinan 250012, China
2
College of Food and Pharmaceutical Science and Technology, Shandong Vocational Animal Science and Veterinary College, Weifang 261061, China
3
Department of Toxicology, Shandong Center for Disease Control and Prevention, Jinan 250014, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Toxics 2026, 14(4), 274; https://doi.org/10.3390/toxics14040274
Submission received: 18 February 2026 / Revised: 17 March 2026 / Accepted: 23 March 2026 / Published: 25 March 2026
(This article belongs to the Topic Environmental Toxicology and Human Health—2nd Edition)
Browse Figures
Versions Notes

Highlights

What are the main findings?
  • TBT exposure induces hepatic injury in rats, characterized by hepatocyte edema, congestion, and progressive liver fibrosis, but does not promote hepatic lipid accumulation.
  • This fibrotic response is accompanied by an increase in the total number of hepatic macrophages, particularly the CD206+CD68+ M2-like subset.
  • TBT exposure caused a downregulation of pro-inflammatory cytokine gene expression, indicating an immunosuppressive hepatic microenvironment.
What is the implication of the main finding?
  • These findings reveal that TBT-induced hepatic fibrosis occurs in the absence of steatosis, diverging from the classical steatosis-driven model of MAFLD, which appears to be driven by immune modulation via macrophages. These findings might offer valuable new insights into the mechanisms of TBT-induced hepatotoxicity.

Abstract

Tributyltin (TBT) is well known for inducing imposex in mollusks. Studies have shown its hepatotoxicity and immunotoxicity in laboratory animals, with macrophages playing a crucial role in maintaining hepatic homeostasis and influencing disease progression; however, no research has yet explored its effects on hepatotoxicity and immunotoxicity based on hepatic macrophages. To address this gap, weaned rats were treated with corn oil or TBT (0.5, 5, or 50 μg/kg) via oral gavage every three days for 60 days. Liver sections were then subjected to hematoxylin and eosin staining, Oil Red O staining, Sirius Red staining, immunohistochemistry, and immunofluorescence to assess the effects of TBT. Hepatic function and inflammatory state were evaluated by serum biochemistry and quantitative reverse transcription-PCR (qPCR), respectively. Histological examination indicated that TBT exposure did not increase hepatic lipid accumulation but resulted in hepatocyte edema and congestion in the 5 and 50 μg/kg groups, accompanied by progressive hepatic fibrosis. In parallel, 50 μg/kg TBT increased the number of macrophages, driven by an increase in the CD206+CD68+ subset. qPCR analysis revealed a significant decrease in the expression of pro-inflammatory cytokines (such as IL-1β and TNF-α), confirming an immunosuppressive state in the livers of rats exposed to TBT. Moreover, the significant increase in serum ALT activity further revealed hepatic injury induced by 50 μg/kg TBT. In summary, TBT exposure restructures the hepatic immune microenvironment, promoting the progression of liver fibrosis independently of fat accumulation in rats.

Graphical Abstract

1. Introduction

Tributyltin (TBT) has been extensively used as a highly effective biocide in antifouling paints for ships and shipyards [1]. Although banned in antifouling paint since 2008 due to its role in causing imposex in gastropods, TBT has continued to be detected in waters [2,3,4,5], particularly in sediments [6]. Its half-life ranges from one to five years in well-oxygenated surface sediments, but can extend to several decades in fine-grained anoxic sediments [7]. Owing to its lipophilic and ionic characteristics, TBT can bioaccumulate through the food chain, reaching elevated concentrations in marine mammals and humans [1]. One review reported an overall mean concentration of TBT in seafood of 182.33 μg/kg [8]. Human exposure primarily occurs through the consumption of aquatic products and in occupational settings [9]. One survey showed urinary tin detection frequencies of 81.05% in adults and 91.29% in children [10]. Two studies detected elevated butyltin levels in human livers obtained at autopsy [11,12]. A recent case–control study found that TBT elevated the risk (6.44-fold) of human nonsyndromic cleft lip and/or palate (NSCL/P), with median placental TBT concentrations of 8.93 μg/kg in NSCL/P cases (n = 109) and 5.33 μg/kg in controls (n = 128) [13].
TBT can cause immunotoxicity [14], hepatotoxicity [15,16,17], and hepatic steatosis in laboratory animals [18,19,20,21]. Macrophages (MΦs) play a vital role in maintaining hepatic homeostasis and influencing disease progression [22,23]. However, no research has explored the effects of TBT on hepatotoxicity and immunotoxicity based on hepatic MΦs. This study aimed to investigate the effects of TBT on the liver and identify the underlying mechanisms involving hepatic MΦs.

2. Materials and Methods

2.1. Reagents

Tributyltin chloride (CAS 1461-22-9, purity ≥ 97.0%) was obtained from TCI Shanghai Development Co., Ltd. (Shanghai, China). Serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) assay kits were purchased from Leadman Bio Co., Ltd. (Beijing, China).
Primary antibodies, including polyclonal rabbit anti-CD11c (Cat# GB11059), CD206 (Cat# GB113497), and secondary antibodies, including goat anti-mouse-HRP (Cat# GB23301), goat anti-rabbit-Alexa Fluor® 488 (Cat# GB25303), goat anti-mouse-CY3 (Cat# GB21301), as well as BCA Protein Assay kits, were obtained from Wuhan Servicebio Technology Co., Ltd. (Wuhan, China). Monoclonal mouse anti-CD68 (Cat# ab31630) was obtained from Abcam Shanghai Trading Co., Ltd. (Shanghai, China). The Qiagen RNeasy® Plus Mini Kit (Cat# 74134) and QuantiTect SYBR® Green RT-PCR Kits were sourced from Qiagen (Qiagen, Hilden, Germany). All other chemicals used in this study were of analytical grade and were obtained from commercial sources.

2.2. Animals and Treatment

Weaned male Sprague-Dawley (SD) rats (about 28 days old, body weight 77.85 ± 7.36 g) were obtained from Jinan Pengyue Laboratory Animal Breeding Co., Ltd. (Jinan, China, license no. SCXK [(Lu] 20190003). Animals were housed and bred in a specific-pathogen-free environment with controlled temperature (23 °C ± 2 °C) and humidity (55% ± 15%) under a strict 12 h light cycle. All animal experiments were approved by the Ethics Committee of the School of Public Health, Shandong University. After three days of acclimatization, the rats were randomly assigned to four groups (n = 10 per group) according to their body weight to ensure comparable average weights across groups.
The animals received treatments of corn oil (vehicle) or TBT (0.5, 5, or 50 μg/kg) dissolved in corn oil via oral gavage every three days for 60 days, and were euthanized one day following the final gavage. The dosage and exposure frequency in this study were determined based on the FDA’s advice on fish consumption (https://www.fda.gov/food/consumers/social-media-toolkit-fdaepa-advice-about-eating-fish; accessed on 1 October 2021) and data from Ref. [8]. The FDA recommends that Americans consume fish 2 to 3 times per week, with each serving being 4 ounces. Consequently, the exposure frequency in this study was set at every three days, rather than daily.
Given an overall mean concentration of TBT in seafood of 182.33 μg/kg, the average TBT content in a 4-ounce serving of seafood is approximately 20.68 μg. Assuming an adult weighs 60 kg, the TBT intake per serving is approximately 0.345 μg/kg. Since seafood consumption is only one of the routes of TBT exposure, we selected 0.5 μg/kg as the lowest exposure dose. Subsequently, this dose was multiplied by a safety factor of 100 to obtain the maximum exposure dose of 50 μg/kg.

2.3. Preparation of Serum and Tissue Isolation

The rats were anesthetized with urethane (~1.2 g/kg) via intraperitoneal injection, and blood was collected from the ventral aorta as in the previous study [24]. The animals died from excessive blood loss under deep anesthesia. Each experimental group consisted of 10 animals per treatment condition unless otherwise stated. The serum was separated and stored at −80 °C for subsequent analysis. The left lobe of each animal’s liver was excised and fixed in 4% (v/v) paraformaldehyde overnight at 4 °C. The remaining liver samples were cut into smaller pieces, frozen in liquid nitrogen, and stored at −80 °C for additional analysis.

2.4. Histopathological Analysis

Formalin-fixed specimens were processed using standard histological techniques. After being fixed for 12 h, they were embedded in paraffin and sectioned into 4-μm-thick slices. Hematoxylin and eosin (H&E) staining and hepatobiliary pigment staining were performed using standard procedures for morphological observations. Oil Red O staining was carried out on frozen liver sections embedded in optimum cutting temperature compound according to reference [20]. Six samples were randomly selected from each group to evaluate liver fibrosis using Sirius Red staining (SRS) according to reference [25]. The tissue sections were examined under a light microscope (CX21, Olympus Corporation, Tokyo, Japan).

2.5. Serum Biochemistry

Serum ALT and AST levels were measured using an autoanalyzer (Beckman Coulter AU480, Tokyo, Japan) according to the manufacturer’s protocol, employing the aspartate and alanine substrate methods, respectively.

2.6. Immunohistochemistry (IHC)

For IHC staining, serial sections were taken from the tissue samples used for SRS (n = 6 per group). The liver sections were mounted on glass slides and incubated with primary antibodies against CD68 (1:200, at 4 °C overnight), followed by incubation with secondary antibodies for 50 min at 20 °C to 25 °C, and then stained with 3,3-diaminobenzidine. Finally, the sections were lightly counterstained with hematoxylin. Images of five different fields per sample were captured using an optical microscope (CX21, Olympus Corporation, Tokyo, Japan). Positive expressions were analyzed using the IHC Profiler program in ImageJ software (ij153-win-java8, NIH, Bethesda, MD, USA). Histochemical Score (H-Score) was used to assess the CD68 expression in each sample using the following formula: H-Score = 3 × high-positive area % + 2 × positive area % + 1 × low-positive area %.

2.7. Immunohistofluorescence (IHF)

Macrophage (MΦ) phenotype was further characterized using double IHF. For IHF staining, serial sections were prepared from the tissue samples that had been used for SRS (n = 6 per group). After dewaxing and antigen retrieval, the sections were blocked with bovine serum albumin (BSA) for 30 min at 20 °C to 25 °C. Following three washes with phosphate-buffered saline (PBS), the sections were incubated overnight at 4 °C with primary antibodies against CD68 and CD11c, or CD206 (all at a dilution of 1:200). The sections were then incubated with the corresponding fluorescently conjugated secondary antibodies (at a dilution of 1:300) at 20 °C to 25 °C for 1 h in the dark. Subsequently, the sections were counterstained with 4′,6-diamidino-2-phenylindole (DAPI). Finally, the sections were washed with PBS and mounted with an antifade mounting medium (Cat# G1401, Servicebio Technology Co., Ltd., Wuhan, China).
Images were captured from five distinct fields per sample using a fluorescence microscope (BX51, Olympus Corporation, Tokyo, Japan). Positive cells were quantified with ImageJ and normalized to DAPI-stained cells in the same field to determine the average number of positive cells.

2.8. RNA Extraction and Quantitative Reverse Transcription-PCR (qPCR)

Five liver samples were randomly selected from each group to isolate RNA using the Qiagen RNeasy® Kit following the manufacturer’s instructions. After quality assessment, RNA was stored at −80 °C for qPCR. qPCR was conducted according to the protocol outlined in our previous study [26]. The primers used in this qPCR are listed in Table 1. Each sample was analyzed in triplicate, and target gene expression was normalized to that of β-actin in the same sample using the 2−ΔΔCT method [27].

2.9. Statistical Analysis

All statistical analyses were conducted with IBM SPSS Statistics (version 31.0 for Windows; IBM Corp., Chicago, IL, USA). Data distribution normality was evaluated using the Shapiro–Wilk test, and Levene’s test was applied to assess the homogeneity of variances. For datasets exhibiting a normal distribution, a one-way analysis of variance (ANOVA) was performed. Following a significant ANOVA result, post hoc multiple comparisons were carried out using either the least significant difference (LSD) test or Dunnett’s T3 test, with the choice determined by the equality of variances. In cases where the data did not follow a normal distribution, the Kruskal–Wallis test was used instead. All statistical tests were two-tailed, and a p-value < 0.05 was considered to indicate statistical significance.

3. Results

3.1. TBT Caused No Overt Toxicity in Rats

TBT exposure did not impact the body weight of rats during the study (Figure 1A). Hepatosomatic index (HSI) is calculated as (liver weight [g]/body weight [g]) × 100. Liver weight was not significantly different between the TBT-treated groups and the control group (Figure 1B), nor was the HSI (Figure 1C).

3.2. TBT-Induced Hepatic Injury in Rats

HE staining of liver sections is shown in Figure 2A. The extent of liver damage increased with increased doses of TBT. No significant alterations were observed in the liver sections of rats from the control and low-dose groups. Mild hepatocyte edema and congestion were noted in the medium-dose group. Furthermore, in the liver sections of the high-dose group, the lobular structure appeared distorted, the hepatic cords were disorganized, and certain areas of the liver displayed considerable hepatocyte edema and congestion.
To evaluate the impact of TBT on hepatic function, we measured serum ALT and AST activities. The serum ALT levels rose with increasing doses of TBT, showing a significant increase at the dose of 50 μg/kg (p = 0.023, Figure 2B). In contrast, serum AST activity was only modestly affected by TBT exposure (p = 0.146, Figure 2C).

3.3. TBT Promoted the Process of Liver Fibrosis in Rats

SRS was performed to assess fibrotic collagen deposition, revealing stained areas mainly in the vasculature, with minor staining noted in the hepatic sinusoid region (Figure 3). In the control group and the low-dose group, the central vein and the portal area were stained red, but the sinusoidal spaces were relatively narrow, and the sinusoids were not clearly stained. In the middle and high-dose groups, the sinusoidal spaces were relatively enlarged, and some sinusoidal walls were stained red, forming discrete red arcs. In the high-dose group, larger fibrous red-stained areas were also found, with no obvious blood cells within the areas, indicating that this was not the central vein or the portal triad area, but rather possibly newly formed fibrous tissue.

3.4. Exposure to TBT Unaltered Hepatic Lipid Accumulation

Oil Red O staining revealed that the oil droplets were primarily concentrated around the area of the triple duct and gradually tapered toward the central vein (Figure 4). There was no evidence of widespread lipid accumulation in these liver sections (Figure 4A). Furthermore, the area of stained tissue accounted for less than 2% of the corresponding liver tissue area (Figure 4B). These data suggest that TBT exposure did not cause liver fat accumulation in this study.

3.5. TBT Exposure Increased Hepatic MΦ Density

Given that MΦs play essential roles in the disease onset or progression [22], we evaluated the MΦ population in the liver using the specific marker CD68 [28]. The majority of CD68+ cells were stellate or spindle-shaped and preferentially localized along the sinusoidal area of the periportal zone (Figure 5A). Figure 5B depicts the expression of CD68 in different treatment groups. Quantitative analysis revealed that the H-score significantly increased by 28.48% in the 50 μg/kg TBT-treated group compared to the control group (p = 0.003; Figure 5C), indicating that TBT increases the number of hepatic MΦs in rats.

3.6. TBT Unalters M1Φs, but Increases M2Φs in Hepatic Tissue of Rats

MΦs can be categorized into two primary populations: the classically activated M1-type MΦs (M1Φs) and the alternatively activated M2-type MΦs (M2Φs) [29]. Figure 6 shows the expression of macrophage markers. Using double IHF staining, we analyzed the hepatic sections for the expression of CD11c and CD206, which are surface markers for M1Φs and M2Φs [30], respectively, using double IHF staining. Notably, there was almost no overlap between cells stained with CD11c+ and those stained with CD68+ (Figure 6A), indicating that these cells are likely not M1Φs. These findings demonstrate that TBT has no impact on the proportion of hepatic M1Φs in rats.
CD206+ cells were enriched in the periportal regions and along the liver lobules. To quantify M2Φs, we selected comparable areas in all liver sections to assess the co-localization of CD206 and CD68 (Figure 6B). Quantitative analysis revealed that the number of CD206+CD68+ cells increased in dose-dependent rats exposed to TBT (p = 0.005; Figure 7), suggesting that TBT increases the proportion of M2Φs in rats.

3.7. TBT Down-Regulates the Gene Expression of Inflammation-Related Cytokines and Chemokines in the Livers of Rats

Inducible nitric-oxide synthase (iNOS), interleukin-1β (IL-1β), and tumor necrosis factor-α (TNF-α) are representative markers of inflammation [31]. We assessed the effects of TBT on liver inflammation by measuring the gene expression of these markers using qPCR. TBT treatment significantly decreased the gene expression of IL-1β (p < 0.05) and TNF-α (p < 0.001), but did not affect iNOS (Figure 8).

4. Discussion

Compared with the control group, treatment with 50 μg/kg TBT induced hepatic injury in rats, characterized by hepatocyte edema, congestion and elevated serum ALT levels. This injury may be attributed to the activation of the TBT -induced apoptotic [17,32] and autophagy pathways [33]. Consistent with our findings, a previous study reported that a single injection of one-quarter the LD50 of TBT increased serum ALT and AST levels in SD rats, accompanied by expanded hepatic sinusoids and swollen mitochondria in hepatocytes [15]. The observed mitochondrial swelling may provide a plausible explanation for the hepatocyte edema seen in our study.
Interestingly, despite these signs of injury, TBT exposure did not cause significant hepatic fat accumulation in rats. This contrasts with numerous studies reporting that low-dose TBT promotes fat accumulation in the livers of mice [19,20,21]. For instance, studies demonstrated that ancestral exposure to TBT led to hepatic lipid accumulation in unexposed offspring mice [19] via epigenetic modification [34,35]. These disparate findings suggest that species differences and variations in exposure paradigms—including the timing, route, and frequency of exposure—may critically influence the manifestation of hepatic steatosis. Indeed, acute oral toxicity experiments have shown that TBT induces more severe liver damage in mice than in rats and guinea pigs, underscoring the species-specific nature of TBT hepatotoxicity [16].
A recent study indicated that prenatal exposure to 50 nM TBT predisposed male offspring to more severe hepatic fibrosis and inflammatory responses upon subsequent challenge with a Western diet [35]. In the present study, with increasing doses of TBT, we observed a progressive increase in hepatic injury and liver fibrosis rather than in hepatic lipid levels compared to their control counterparts [35].
Liver fibrosis is a wound-healing process closely linked to tissue regeneration, orchestrated by various cell types, including macrophages [22,36]. The phenotype and function of these macrophages are critically shaped by their microenvironment [23]. In the present study, TBT exposure significantly reduced the expression of inflammatory genes in the liver, indicating that the hepatic immune microenvironment had shifted to a less inflammatory state. This TBT-induced restructuring of the immune niche may underlie the observed phenotypic changes in hepatic macrophages and contribute to the progression of liver fibrosis.
Correspondingly, we observed almost no M1Φs in the livers of rats from either the control or TBT-treated groups. At steady state, monocytes do not express CD11c, and CD11c expression was minimal in hepatic MΦs [37]. This indicates that TBT treatment did not trigger an inflammatory response. In line with our findings, a previous in vitro study demonstrated that TBT exposure did not elicit an inflammatory response in either LPS-primed or non-LPS-primed cells after a 6 h exposure to 30 μM TBT [38]. Furthermore, transcriptomic analyses in two extensive studies on TBT revealed no overexpression of inflammatory genes in either visceral fat or the liver [34,39].
In contrast to the M1 population, we observed a dose-dependent increase in M2Φs in the livers of TBT-treated rats. Given that M2Φs are involved in tissue repair and remodeling [40], this increase may represent a feedback mechanism aimed at autogenous tissue repair following TBT-induced injury. Importantly, this expansion of M2Φs did not result from the transformation of M1Φs, suggesting that the activation states of hepatic MΦs are more complex than the traditional M1/M2 dichotomy model [41]. It is widely accepted that the onset and progression of metabolic-associated fatty liver disease (MAFLD) are associated with hepatic steatosis and chronic, low-grade inflammation [42], in which M1Φs play a crucial role [43]. However, in the present study, we observed an immunosuppressive state rather than inflammation in the livers of TBT-treated rats.
A previous study indicated that type 2 cytokines facilitated the progression of MAFLD [25]. In the current study, we observed an immunosuppressive status rather than inflammation in the livers of TBT- treated rats, suggesting a distinct pathological mechanism. This immunosuppressive state may be mechanistically linked to TBT’s role as an ATP synthase inhibitor. TBT can reduce cellular ATP levels [44,45], and given that ATP is required for both the maturation and release of IL-1β and for the activation of the NALP3 inflammasome [46], the observed decrease in IL-1β expression may be a direct consequence of TBT-induced ATP depletion in the liver.
Immunosuppression has significant pathological implications, potentially increasing susceptibility to infections and even tumor development. Supporting this concern, one study demonstrated that perinatal exposure to 0.5 mg/kg TBT increased the proportion of offspring developing hepatic adenomas (at 45 weeks post-birth) [39]. Furthermore, given that over 90% of hepatocellular carcinoma cases arise in the context of fibrosis or cirrhosis [47], the progressive hepatic fibrosis observed in our study warrants particular attention. Notably, TBT-induced hepatic fibrosis occurred in the absence of steatosis, diverging from the classical paradigm of MAFLD. This unique pathological feature may offer valuable new insights into the mechanisms of TBT-induced hepatotoxicity and highlights the need for increased awareness of its immunosuppressive and pro-fibrotic effects.
This study has several limitations. This study has several limitations. First, only male rats were included, which precludes assessment of potential sex differences in TBT-induced hepatotoxicity or liver fibrosis. This is a notable gap, as recent evidence indicates that TBT exposure leads to sex-dimorphic hepatic effects [35,48], with male mice exhibiting greater susceptibility associated with more pronounced chromatin accessibility and transcriptomic changes compared to females [48].
Second, the analysis was restricted to a single time point. This limitation is highlighted by a discrepancy between our current findings and previous work. Although we observed a dose-dependent increase in lipid accumulation in the bone marrow of the femur under identical treatment conditions [49], no hepatic fat accumulation was detected in this study. This tissue-specific difference may reflect divergent temporal dynamics in response to TBT, which the current experimental design could not capture. Consequently, the use of a single sex and a solitary time point limits both the generalizability of our findings and our understanding of the temporal progression of TBT-induced liver toxicity.

5. Conclusions

TBT exposure in rats results in hepatic injury characterized by hepatocyte edema, congestion, and progressive fibrosis, notably without promoting hepatic lipid accumulation. This fi-brotic response is accompanied by an increase in the total number of hepatic macrophages—particularly the CD206+CD68+ M2-like subset—and a downregulation of pro-inflammatory cytokine gene expression, indicating the establishment of an immu-nosuppressive hepatic microenvironment. Thus, TBT-induced liver fibrosis, occurring independently of steatosis, appears to be driven by immune modulation via macrophages, thereby challenging prior assumptions about TBT hepatotoxicity. These findings provide valuable insights into the mechanisms underlying TBT-induced liver injury.

Author Contributions

Conceptualization, funding acquisition and project administration, D.C., H.L. and J.S.; methodology, resources and writing—original draft preparation, N.Z. and X.S.; investigation, validation, H.L. and W.Y.; formal analysis, J.S.; writing—review and editing, J.S. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by grants from the Shandong Provincial Natural Science Foundation, grant number ZR2020MH332.

Institutional Review Board Statement

The animal study protocol was approved by the Ethics Committee of the School of Public Health, Shandong University (Approval ID LL20210232, 3 March 2021).

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available on request from the corresponding authors.

Acknowledgments

The authors need to thank the colleagues for their help and support in the research.

Conflicts of Interest

The authors declare no conflicts of interest.

Abbreviations

The following abbreviations are used in this manuscript:
TBTTributyltin
qPCRQuantitative reverse transcription-PCR
NSCL/Pnonsyndromic cleft lip and/or palate
ALTalanine aminotransferase
ASTaspartate aminotransferase
HEHematoxylin and eosin
SRSSirius Red staining
IHCImmunohistochemistry
H-ScoreHistochemical Score
PBSphosphate-buffered saline
MΦMacrophage
DAPI4′,6-diamidino-2-phenylindole
Fforward
Rreverse
ANOVAone-way analysis of variance
HSIhepatosomatic index
iNOSinducible nitric-oxide synthase
IL-1βinterleukin-1β
TNF-αtumor necrosis factor-α
MAFLDMetabolic-associated fatty liver disease

References

  1. Antizar-Ladislao, B. Environmental levels, toxicity and human exposure to tributyltin (TBT)-contaminated marine environment. A review. Environ. Int. 2008, 34, 292–308. [Google Scholar] [CrossRef]
  2. Bajt, O.; Mavrič, B.; Milačič, R.; Ščančar, J.; Zuliani, T.; Lipej, L. Bioaccumulation of organotin compounds in the marbled electric ray (Torpedo marmorata) in the northern Adriatic Sea. Mar. Pollut. Bull. 2024, 204, 116511. [Google Scholar] [CrossRef] [PubMed]
  3. de Almeida, A.C.; Batista, R.M.; Castro, Í.B.; Fillmann, G. Passive sampling-derived aqueous concentrations of organotins and booster biocides in the largest Port of South America (Southeastern Brazil). Water Res. 2024, 273, 123009. [Google Scholar] [CrossRef] [PubMed]
  4. Meza-Morelos, D.; Johnson Restrepo, B.; Braga Castro, Í.; Fillmann, G.; Fernández Maestre, R. Imposex incidence in gastropod species from the Colombian Caribbean Coast reveals continued and widespread tributyltin contamination after its global ban. Environ. Pollut. 2024, 362, 125010. [Google Scholar] [CrossRef] [PubMed]
  5. Chen, C.; Chen, L.; Huang, Q.; Chen, Z.; Zhang, W. Organotin contamination in commercial and wild oysters from China: Increasing occurrence of triphenyltin. Sci. Total Environ. 2019, 650, 2527–2534. [Google Scholar] [CrossRef]
  6. Zeng, P.; Hu, H.; Wang, Y.; Liu, J.; Cheng, H. Occurrence, bioaccumulation, and ecological and health risks of Cd, Sn, Hg, and Pb compounds in shrimp and fish from aquaculture ponds. J. Hazard. Mater. 2025, 487, 137245. [Google Scholar] [CrossRef]
  7. Beyer, J.; Song, Y.; Tollefsen, K.E.; Berge, J.A.; Tveiten, L.; Helland, A.; Øxnevad, S.; Schøyen, M. The ecotoxicology of marine tributyltin (TBT) hotspots: A review. Mar. Environ. Res. 2022, 179, 105689. [Google Scholar] [CrossRef]
  8. Sadighara, P.; Jahanbakhsh, M.; Nazari, Z.; Mostashari, P. The organotin contaminants in food: Sources and methods for detection: A systematic review and meta-analysis. Food Chem. X 2021, 12, 100154. [Google Scholar] [CrossRef]
  9. da Silva, R.C.; Teixeira, M.P.; de Paiva, L.S.; Miranda-Alves, L. Environmental Health and Toxicology: Immunomodulation Promoted by Endocrine-Disrupting Chemical Tributyltin. Toxics 2023, 11, 696. [Google Scholar] [CrossRef]
  10. Lehmler, H.J.; Gadogbe, M.; Liu, B.; Bao, W. Environmental tin exposure in a nationally representative sample of U.S. adults and children: The National Health and Nutrition Examination Survey 2011–2014. Environ. Pollut. 2018, 240, 599–606. [Google Scholar] [CrossRef]
  11. Nielsen, J.B.; Strand, J. Butyltin compounds in human liver. Environ. Res. 2002, 88, 129–133. [Google Scholar] [CrossRef] [PubMed]
  12. Takahashi, S.; Mukai, H.; Tanabe, S.; Sakayama, K.; Miyazaki, T.; Masuno, H. Butyltin residues in livers of humans and wild terrestrial mammals and in plastic products. Environ. Pollut. 1999, 106, 213–218. [Google Scholar] [CrossRef] [PubMed]
  13. Chen, Y.; Cheng, Q.; Li, S.; Jin, L.; Li, Z.; Ren, A.; Wang, L. Organotin exposure and DNA methylation in non-syndromic cleft lip and palate: Integrating findings from case-control studies and animal experiments. Sci. Total Environ. 2024, 954, 176214. [Google Scholar] [CrossRef] [PubMed]
  14. Vos, J.G.; De Klerk, A.; Krajnc, E.I.; Van Loveren, H.; Rozing, J. Immunotoxicity of bis(tri-n-butyltin)oxide in the rat: Effects on thymus-dependent immunity and on nonspecific resistance following long-term exposure in young versus aged rats. Toxicol. Appl. Pharmacol. 1990, 105, 144–155. [Google Scholar] [CrossRef]
  15. Yoshizuka, M.; Hara, K.; Haramaki, N.; Yokoyama, M.; Mori, N.; Doi, Y.; Kawahara, A.; Fujimoto, S. Studies on the hepatotoxicity induced by bis (tributyltin) oxide. Arch. Toxicol. 1992, 66, 182–187. [Google Scholar] [CrossRef]
  16. Ueno, S.; Kashimoto, T.; Susa, N.; Ishii, M.; Chiba, T.; Mutoh, K.; Hoshi, F.; Suzuki, T.; Sugiyama, M. Comparison of hepatotoxicity and metabolism of butyltin compounds in the liver of mice, rats and guinea pigs. Arch. Toxicol. 2003, 77, 173–181. [Google Scholar] [CrossRef]
  17. Jurkiewicz, M.; Averill-Bates, D.A.; Marion, M.; Denizeau, F. Involvement of mitochondrial and death receptor pathways in tributyltin-induced apoptosis in rat hepatocytes. Biochim. Biophys. Acta 2004, 1693, 15–27. [Google Scholar] [CrossRef]
  18. Pascuali, N.; Pu, Y.; Waye, A.A.; Pearl, S.; Martin, D.; Sutton, A.; Shikanov, A.; Veiga-Lopez, A. Evaluation of Lipids and Lipid-Related Transcripts in Human and Ovine Theca Cells and an in Vitro Mouse Model Exposed to the Obesogen Chemical Tributyltin. Environ. Health Perspect. 2024, 132, 47009. [Google Scholar] [CrossRef]
  19. Chamorro-Garcia, R.; Sahu, M.; Abbey, R.J.; Laude, J.; Pham, N.; Blumberg, B. Transgenerational inheritance of increased fat depot size, stem cell reprogramming, and hepatic steatosis elicited by prenatal exposure to the obesogen tributyltin in mice. Environ. Health Perspect. 2013, 121, 359–366. [Google Scholar] [CrossRef]
  20. Yan, H.; Guo, H.; Cheng, D.; Kou, R.; Zhang, C.; Si, J. Tributyltin reduces the levels of serum adiponectin and activity of AKT and induces metabolic syndrome in male mice. Environ. Toxicol. 2018, 33, 752–758. [Google Scholar] [CrossRef]
  21. Zuo, Z.; Chen, S.; Wu, T.; Zhang, J.; Su, Y.; Chen, Y.; Wang, C. Tributyltin causes obesity and hepatic steatosis in male mice. Environ. Toxicol. 2011, 26, 79–85. [Google Scholar] [CrossRef] [PubMed]
  22. Lazarov, T.; Juarez-Carreño, S.; Cox, N.; Geissmann, F. Physiology and diseases of tissue-resident macrophages. Nature 2023, 618, 698–707. [Google Scholar] [CrossRef] [PubMed]
  23. Guilliams, M.; Scott, C.L. Liver macrophages in health and disease. Immunity 2022, 55, 1515–1529. [Google Scholar] [CrossRef] [PubMed]
  24. Yao, W.; Luan, J.; Li, H.; Cheng, D.; Lv, S.; Si, J. Tributyltin Alters Seric Bile Acid Pool Composition in Male Rats. Toxics 2025, 13, 440. [Google Scholar] [CrossRef]
  25. Hart, K.M.; Fabre, T.; Sciurba, J.C.; Gieseck, R.L., 3rd; Borthwick, L.A.; Vannella, K.M.; Acciani, T.H.; de Queiroz Prado, R.; Thompson, R.W.; White, S.; et al. Type 2 immunity is protective in metabolic disease but exacerbates NAFLD collaboratively with TGF-β. Sci. Transl. Med. 2017, 9, eaal3694. [Google Scholar] [CrossRef]
  26. Li, M.; Cheng, D.; Li, H.; Yao, W.; Guo, D.; Wang, S.; Si, J. Tributyltin perturbs femoral cortical architecture and polar moment of inertia in rat. BMC Musculoskelet. Disord. 2021, 22, 427. [Google Scholar] [CrossRef]
  27. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  28. Cai, D.; Yuan, M.; Frantz, D.F.; Melendez, P.A.; Hansen, L.; Lee, J.; Shoelson, S.E. Local and systemic insulin resistance resulting from hepatic activation of IKK-beta and NF-kappaB. Nat. Med. 2005, 11, 183–190. [Google Scholar] [CrossRef]
  29. Lumeng, C.N.; Bodzin, J.L.; Saltiel, A.R. Obesity induces a phenotypic switch in adipose tissue macrophage polarization. J. Clin. Investig. 2007, 117, 175–184. [Google Scholar] [CrossRef]
  30. Fujisaka, S.; Usui, I.; Bukhari, A.; Ikutani, M.; Oya, T.; Kanatani, Y.; Tsuneyama, K.; Nagai, Y.; Takatsu, K.; Urakaze, M.; et al. Regulatory mechanisms for adipose tissue M1 and M2 macrophages in diet-induced obese mice. Diabetes 2009, 58, 2574–2582. [Google Scholar] [CrossRef]
  31. Kubota, T.; Inoue, M.; Kubota, N.; Takamoto, I.; Mineyama, T.; Iwayama, K.; Tokuyama, K.; Moroi, M.; Ueki, K.; Yamauchi, T.; et al. Downregulation of macrophage Irs2 by hyperinsulinemia impairs IL-4-indeuced M2a-subtype macrophage activation in obesity. Nat. Commun. 2018, 9, 4863. [Google Scholar] [CrossRef] [PubMed]
  32. Zhou, M.; Feng, M.; Fu, L.L.; Ji, L.D.; Zhao, J.S.; Xu, J. Toxicogenomic analysis identifies the apoptotic pathway as the main cause of hepatotoxicity induced by tributyltin. Food Chem. Toxicol. 2016, 97, 316–326. [Google Scholar] [CrossRef] [PubMed]
  33. Liang, W.; Fu, L.; Feng, M.; Wang, X.; Yun, Z.; Xu, J. Endoplasmic Reticulum Stress and Autophagy Are Involved in Hepatotoxicity Induced by Tributyltin. Toxics 2023, 11, 607. [Google Scholar] [CrossRef] [PubMed]
  34. Chamorro-Garcia, R.; Diaz-Castillo, C.; Shoucri, B.M.; Käch, H.; Leavitt, R.; Shioda, T.; Blumberg, B. Ancestral perinatal obesogen exposure results in a transgenerational thrifty phenotype in mice. Nat. Commun. 2017, 8, 2012. [Google Scholar] [CrossRef]
  35. Chang, R.C.; Huang, Y.; To, K.; Whitlock, R.S.; Nguyen, K.U.; Joemon, M.C.; Lopez, M.; Deeprompt, K.G.; Shioda, T.; Blumberg, B. Transgenerational Effects of the Obesogen Tributyltin on Metabolic Health in Mice: Interactions with a Western Diet. Endocrinology 2025, 166, bqaf063. [Google Scholar] [CrossRef]
  36. Wynn, T.A.; Vannella, K.M. Macrophages in Tissue Repair, Regeneration, and Fibrosis. Immunity 2016, 44, 450–462. [Google Scholar] [CrossRef]
  37. Bonnardel, J.; T’Jonck, W.; Gaublomme, D.; Browaeys, R.; Scott, C.L.; Martens, L.; Vanneste, B.; De Prijck, S.; Nedospasov, S.A.; Kremer, A.; et al. Stellate Cells, Hepatocytes, and Endothelial Cells Imprint the Kupffer Cell Identity on Monocytes Colonizing the Liver Macrophage Niche. Immunity 2019, 51, 638–654.e9. [Google Scholar] [CrossRef]
  38. Childers, G.M.; Perry, C.A.; Blachut, B.; Martin, N.; Bortner, C.D.; Sieber, S.; Li, J.L.; Fessler, M.B.; Harry, G.J. Assessing the Association of Mitochondrial Function and Inflammasome Activation in Murine Macrophages Exposed to Select Mitotoxic Tri-Organotin Compounds. Environ. Health Perspect. 2021, 129, 47015. [Google Scholar] [CrossRef]
  39. Katz, T.A.; Grimm, S.L.; Kaushal, A.; Dong, J.; Treviño, L.S.; Jangid, R.K.; Gaitán, A.V.; Bertocchio, J.P.; Guan, Y.; Robertson, M.J.; et al. Hepatic Tumor Formation in Adult Mice Developmentally Exposed to Organotin. Environ. Health Perspect. 2020, 128, 17010. [Google Scholar] [CrossRef]
  40. Gordon, S.; Taylor, P.R. Monocyte and macrophage heterogeneity. Nat. Rev. Immunol. 2005, 5, 953–964. [Google Scholar] [CrossRef]
  41. Russo, L.; Lumeng, C.N. Properties and functions of adipose tissue macrophages in obesity. Immunology 2018, 155, 407–417. [Google Scholar] [CrossRef] [PubMed]
  42. Sheka, A.C.; Adeyi, O.; Thompson, J.; Hameed, B.; Crawford, P.A.; Ikramuddin, S. Nonalcoholic Steatohepatitis: A Review. JAMA 2020, 323, 1175–1183. [Google Scholar] [CrossRef] [PubMed]
  43. Davies, L.C.; Jenkins, S.J.; Allen, J.E.; Taylor, P.R. Tissue-resident macrophages. Nat. Immunol. 2013, 14, 986–995. [Google Scholar] [CrossRef] [PubMed]
  44. von Ballmoos, C.; Brunner, J.; Dimroth, P. The ion channel of F-ATP synthase is the target of toxic organotin compounds. Proc. Natl. Acad. Sci. USA 2004, 101, 11239–11244. [Google Scholar] [CrossRef]
  45. López-Gallardo, E.; Llobet, L.; Emperador, S.; Montoya, J.; Ruiz-Pesini, E. Effects of Tributyltin Chloride on Cybrids with or without an ATP Synthase Pathologic Mutation. Environ. Health Perspect. 2016, 124, 1399–1405. [Google Scholar] [CrossRef][Green Version]
  46. Perregaux, D.; Gabel, C.A. Interleukin-1 beta maturation and release in response to ATP and nigericin. Evidence that potassium depletion mediated by these agents is a necessary and common feature of their activity. J. Biol. Chem. 1994, 269, 15195–15203. [Google Scholar] [CrossRef]
  47. Peng, H.; Yang, M.; Feng, K.; Lv, Q.; Zhang, Y. Semaphorin 3C (Sema3C) reshapes stromal microenvironment to promote hepatocellular carcinoma progression. Signal Transduct. Target. Ther. 2024, 9, 169. [Google Scholar] [CrossRef]
  48. Wang, J.; Gu, X.; Chen, P.; Wang, S.; Huang, P.; Niu, Y.; Yang, W.; Ding, Z.; Liang, Y.; Shi, M.; et al. Systematic transcriptome-wide analysis and validation of tributyltin-induced differential changes in the liver with sex-specific effects. Ecotoxicol. Environ. Saf. 2025, 293, 117995. [Google Scholar] [CrossRef]
  49. Yao, W.; Wei, X.; Guo, H.; Cheng, D.; Li, H.; Sun, L.; Wang, S.; Guo, D.; Yang, Y.; Si, J. Tributyltin reduces bone mineral density by reprograming bone marrow mesenchymal stem cells in rat. Environ. Toxicol. Pharmacol. 2020, 73, 103271. [Google Scholar] [CrossRef]
Toxics 14 00274 g001
Figure 1. The effects of TBT on the weight of the body and liver of rats. (A) Body weight at all time points observed, (B) liver weight, or (C) (HSI) in rats did not alter by TBT treatment. Significance of body weight and liver weight was determined using one-way analysis of variance; Significance of hepatosomatic index was determined using the Kruskal–Wallis test. Data are presented as means ± SEM (n = 10 per group). HSI, hepatosomatic index; d, days.
Figure 1. The effects of TBT on the weight of the body and liver of rats. (A) Body weight at all time points observed, (B) liver weight, or (C) (HSI) in rats did not alter by TBT treatment. Significance of body weight and liver weight was determined using one-way analysis of variance; Significance of hepatosomatic index was determined using the Kruskal–Wallis test. Data are presented as means ± SEM (n = 10 per group). HSI, hepatosomatic index; d, days.
Toxics 14 00274 g001
Toxics 14 00274 g002
Figure 2. TBT treatment causing hepatic injury to rats. (A) Representative images of rat liver sections stained with hematoxylin and eosin; c, l, m, and h represent control, 0.5, 5, and 50 μg/kg TBT groups, respectively. The long white arrows indicate hepatic congestion, while the black arrows indicate hepatic edema; Scale bar: 100 μm; (B) The influence of TBT on serum ALT (B) and AST (C); Statistical significance was tested using one-way analysis of variance and then the least significant difference, * p < 0.05 compared to control. n = 10. ALT, alanine aminotransferase; AST, aspartate aminotransferase.
Figure 2. TBT treatment causing hepatic injury to rats. (A) Representative images of rat liver sections stained with hematoxylin and eosin; c, l, m, and h represent control, 0.5, 5, and 50 μg/kg TBT groups, respectively. The long white arrows indicate hepatic congestion, while the black arrows indicate hepatic edema; Scale bar: 100 μm; (B) The influence of TBT on serum ALT (B) and AST (C); Statistical significance was tested using one-way analysis of variance and then the least significant difference, * p < 0.05 compared to control. n = 10. ALT, alanine aminotransferase; AST, aspartate aminotransferase.
Toxics 14 00274 g002
Toxics 14 00274 g003
Figure 3. Representative images of rat liver sections stained with Picrosirius Red; Collagen fibers are visualized in red. scale bar: 50 μm for magnified area, 100 for others. c, l, m, and h represent control, 0.5, 5, and 50 μg/kg TBT groups, respectively. n = 6 (6 rats were randomly selected from each group).
Figure 3. Representative images of rat liver sections stained with Picrosirius Red; Collagen fibers are visualized in red. scale bar: 50 μm for magnified area, 100 for others. c, l, m, and h represent control, 0.5, 5, and 50 μg/kg TBT groups, respectively. n = 6 (6 rats were randomly selected from each group).
Toxics 14 00274 g003
Toxics 14 00274 g004
Figure 4. TBT unaltered hepatic lipid accumulation. (A) Representative Oil Red O-stained images of rat liver sections (scale bar: 500 μm). Red staining indicates the presence of lipid droplet; (B) the stained tissue area constituted in the hepatic sections; c, l, m, and h represent control, 0.5, 5, and 50 μg/kg TBT groups, respectively. Significance was determined using one-way analysis of variance and then the Dunnett’s T3 test, n = 10.
Figure 4. TBT unaltered hepatic lipid accumulation. (A) Representative Oil Red O-stained images of rat liver sections (scale bar: 500 μm). Red staining indicates the presence of lipid droplet; (B) the stained tissue area constituted in the hepatic sections; c, l, m, and h represent control, 0.5, 5, and 50 μg/kg TBT groups, respectively. Significance was determined using one-way analysis of variance and then the Dunnett’s T3 test, n = 10.
Toxics 14 00274 g004
Toxics 14 00274 g005
Figure 5. TBT increased the area of positive CD68 expression. (A) Representative IHC images of rat liver sections for CD68 (brown); scale bar: 50 μm. (B) The area and (C) H-score of CD68 expression in rat liver sections. Statistical significance was tested using one-way analysis of variance, and then the least significant difference, ** p < 0.01, compared with the control. c, l, m, and h represent control, 0.5, 5, and 50 μg/kg TBT groups, respectively. n = 6 (The slices were from the same rats as Figure 4). H-Score, histochemical score.
Figure 5. TBT increased the area of positive CD68 expression. (A) Representative IHC images of rat liver sections for CD68 (brown); scale bar: 50 μm. (B) The area and (C) H-score of CD68 expression in rat liver sections. Statistical significance was tested using one-way analysis of variance, and then the least significant difference, ** p < 0.01, compared with the control. c, l, m, and h represent control, 0.5, 5, and 50 μg/kg TBT groups, respectively. n = 6 (The slices were from the same rats as Figure 4). H-Score, histochemical score.
Toxics 14 00274 g005
Toxics 14 00274 g006
Figure 6. TBT increases the expression of CD206+CD68+ cells in the liver of rats. (A) Representative IHF image showing the distribution of M1Φ within the liver (left) and amplifying selected region (right; immunofluorescence staining for DAPI [blue], CD68 [red], CD11c [green] and their merged image). (B) Representative IHF image showing the distribution of M2Φ within the liver (left) and amplifying selected region (right; immunofluorescence staining for DAPI [blue], CD68 [red], CD206 [green] and their merged image). scale bars: 50 μm (left) and 20 μm (right); c, l, m and h represent control, 0.5, 5 and 50 μg/kg TBT groups, respectively. M1Φ, M1-type macrophage; M2Φ, M2-type macrophage; and DAPI, 4′,6-diamidino-2-phenylindole.
Figure 6. TBT increases the expression of CD206+CD68+ cells in the liver of rats. (A) Representative IHF image showing the distribution of M1Φ within the liver (left) and amplifying selected region (right; immunofluorescence staining for DAPI [blue], CD68 [red], CD11c [green] and their merged image). (B) Representative IHF image showing the distribution of M2Φ within the liver (left) and amplifying selected region (right; immunofluorescence staining for DAPI [blue], CD68 [red], CD206 [green] and their merged image). scale bars: 50 μm (left) and 20 μm (right); c, l, m and h represent control, 0.5, 5 and 50 μg/kg TBT groups, respectively. M1Φ, M1-type macrophage; M2Φ, M2-type macrophage; and DAPI, 4′,6-diamidino-2-phenylindole.
Toxics 14 00274 g006
Toxics 14 00274 g007
Figure 7. TBT elevated the number (%) of CD206+CD68+ cells in the rat liver sections. Statistical significance was tested using one-way analysis of variance and then the least significant difference, * p < 0.05, ** p < 0.01, compared with control, n = 6 (The slices were from the same rats as Figure 4).
Figure 7. TBT elevated the number (%) of CD206+CD68+ cells in the rat liver sections. Statistical significance was tested using one-way analysis of variance and then the least significant difference, * p < 0.05, ** p < 0.01, compared with control, n = 6 (The slices were from the same rats as Figure 4).
Toxics 14 00274 g007
Toxics 14 00274 g008
Figure 8. TBT down-regulated the gene expression of i representative markers of inflammation in the livers of rats. Statistical significance was tested using one-way analysis of variance, and then the least significant difference for IL-1β, Dunnett’s T3 test for iNOS and TNF-α, * p < 0.05, ** p < 0.01 compared with control. n = 5 (five rats were randomly selected from each group). iNOS, inducible nitric-oxide synthase; IL-1β, interleukin-1β; and TNF-α, tumor necrosis factor-α.
Figure 8. TBT down-regulated the gene expression of i representative markers of inflammation in the livers of rats. Statistical significance was tested using one-way analysis of variance, and then the least significant difference for IL-1β, Dunnett’s T3 test for iNOS and TNF-α, * p < 0.05, ** p < 0.01 compared with control. n = 5 (five rats were randomly selected from each group). iNOS, inducible nitric-oxide synthase; IL-1β, interleukin-1β; and TNF-α, tumor necrosis factor-α.
Toxics 14 00274 g008
Table 1. Primers used for qPCR analysis of gene expression.
Table 1. Primers used for qPCR analysis of gene expression.
GenePrimer Seq (5′-3′)Amplicon Size (bp)GenBank
iNOSF AGCCCTGGAAGACCCACATCTG122S71597.1
R AGCCATGACCTTCCGCATTAGC
TNF-αF GGACACCATGAGCACGGAAAGC133NM_012675.3
R CGCCACGAGCAGGAATGAGAAG
IL-1βF TGTTTCCCTCCCTGCCTCTGAC110NM_031512.2
R CGACAATGCTGCCTCGTGACC
β-actinF CACTATCGGCAATGAGCGGTTCC154NM_031144.3
R CAGCACTGTGTTGGCATAGAGGTC
Note: F, forward; R, reverse.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhou, N.; Si, X.; Yao, W.; Si, J.; Cheng, D.; Li, H. Tributyltin Alters Hepatic Immune Microenvironment to ProMote Liver Fibrosis Progression in Rats. Toxics 2026, 14, 274. https://doi.org/10.3390/toxics14040274

AMA Style

Zhou N, Si X, Yao W, Si J, Cheng D, Li H. Tributyltin Alters Hepatic Immune Microenvironment to ProMote Liver Fibrosis Progression in Rats. Toxics. 2026; 14(4):274. https://doi.org/10.3390/toxics14040274

Chicago/Turabian Style

Zhou, Nuo, Xiaoyu Si, Wenhuan Yao, Jiliang Si, Dong Cheng, and Hui Li. 2026. "Tributyltin Alters Hepatic Immune Microenvironment to ProMote Liver Fibrosis Progression in Rats" Toxics 14, no. 4: 274. https://doi.org/10.3390/toxics14040274

APA Style

Zhou, N., Si, X., Yao, W., Si, J., Cheng, D., & Li, H. (2026). Tributyltin Alters Hepatic Immune Microenvironment to ProMote Liver Fibrosis Progression in Rats. Toxics, 14(4), 274. https://doi.org/10.3390/toxics14040274

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop