Exposure to Nanoplastics During Pregnancy Induces Brown Adipose Tissue Whitening in Male Offspring
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Experimental Animals
2.3. Animal Model Development
2.4. Histological Analysis
2.5. mRNA Level Analysis
2.6. Western Blotting
2.7. Data Analysis and Statistics
3. Results
3.1. Prenatal PSNPs Exposure Led to Low-Birth-Weight Offspring
3.2. Prenatal PSNPs Exposure Prompted Obesity Development in Adult Offspring
3.3. Prenatal PSNPs Exposure Triggered Brown Adipose Tissue Whitening in Adult Offspring Mice
3.4. Prenatal PSNPs Exposure Enhanced Lipogenesis in Brown Adipose Tissue of Adult Male Offspring Mice
3.5. Prenatal PSNPs Exposure Inhibited Lipophagy in Brown Adipose Tissue of Adult Male Offspring Mice
4. Discussion
5. Limitations of This Study
6. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Mattsson, K.; Hansson, L.A.; Cedervall, T. Nano-plastics in the aquatic environment. Environ. Sci. Process Impacts 2015, 17, 1712–1721. [Google Scholar] [CrossRef] [PubMed]
- Borrelle, S.B.; Ringma, J.; Law, K.L.; Monnahan, C.C.; Lebreton, L.; McGivern, A.; Murphy, E.; Jambeck, J.; Leonard, G.H.; Hilleary, M.A.; et al. Predicted growth in plastic waste exceeds efforts to mitigate plastic pollution. Science 2020, 369, 1515–1518. [Google Scholar] [CrossRef]
- Lehner, R.; Weder, C.; Petri-Fink, A.; Rothen-Rutishauser, B. Emergence of Nanoplastic in the Environment and Possible Impact on Human Health. Environ. Sci. Technol. 2019, 53, 1748–1765. [Google Scholar] [CrossRef] [PubMed]
- Dissanayake, P.D.; Kim, S.; Sarkar, B.; Oleszczuk, P.; Sang, M.K.; Haque, M.N.; Ahn, J.H.; Bank, M.S.; Ok, Y.S. Effects of microplastics on the terrestrial environment: A critical review. Environ. Res. 2022, 209, 112734. [Google Scholar] [CrossRef] [PubMed]
- Ahmed, S.F.; Islam, N.; Tasannum, N.; Mehjabin, A.; Momtahin, A.; Chowdhury, A.A.; Almomani, F.; Mofijur, M. Microplastic removal and management strategies for wastewater treatment plants. Chemosphere 2024, 347, 140648. [Google Scholar] [CrossRef]
- Fournier, S.B.; D’Errico, J.N.; Adler, D.S.; Kollontzi, S.; Goedken, M.J.; Fabris, L.; Yurkow, E.J.; Stapleton, P.A. Nanopolystyrene translocation and fetal deposition after acute lung exposure during late-stage pregnancy. Part. Fibre Toxicol. 2020, 17, 1–11. [Google Scholar] [CrossRef]
- Sui, A.; Yao, C.; Chen, Y.; Li, Y.; Yu, S.; Qu, J.; Wei, H.; Tang, J.; Chen, G. Polystyrene nanoplastics inhibit StAR expression by activating HIF-1alpha via ERK1/2 MAPK and AKT pathways in TM3 Leydig cells and testicular tissues of mice. Food Chem. Toxicol. 2023, 173, 113634. [Google Scholar] [CrossRef] [PubMed]
- Domenech, J.; Hernandez, A.; Rubio, L.; Marcos, R.; Cortes, C. Interactions of polystyrene nanoplastics with in vitro models of the human intestinal barrier. Arch. Toxicol. 2020, 94, 2997–3012. [Google Scholar] [CrossRef] [PubMed]
- Halimu, G.; Zhang, Q.; Liu, L.; Zhang, Z.; Wang, X.; Gu, W.; Zhang, B.; Dai, Y.; Zhang, H.; Zhang, C.; et al. Toxic effects of nanoplastics with different sizes and surface charges on epithelial-to-mesenchymal transition in A549 cells and the potential toxicological mechanism. J. Hazard. Mater. 2022, 430, 128485. [Google Scholar] [CrossRef]
- Brandts, I.; Teles, M.; Tvarijonaviciute, A.; Pereira, M.L.; Martins, M.A.; Tort, L.; Oliveira, M. Effects of polymethylmethacrylate nanoplastics on Dicentrarchus labrax. Genomics 2018, 110, 435–441. [Google Scholar] [CrossRef]
- Lai, W.; Xu, D.; Li, J.; Wang, Z.; Ding, Y.; Wang, X.; Li, X.; Xu, N.; Mai, K.; Ai, Q. Dietary polystyrene nanoplastics exposure alters liver lipid metabolism and muscle nutritional quality in carnivorous marine fish large yellow croaker (Larimichthys crocea). J. Hazard. Mater. 2021, 419, 126454. [Google Scholar] [CrossRef] [PubMed]
- Shang, Y.; Wang, X.; Su, S.; Ji, F.; Shao, D.; Duan, C.; Chen, T.; Liang, C.; Zhang, D.; Lu, H. Identifying of immune-associated genes for assessing the obesity-associated risk to the offspring in maternal obesity: A bioinformatics and machine learning. CNS Neurosci. Ther. 2024, 30, e14700. [Google Scholar] [CrossRef]
- Inoue, Y.; Qin, B.; Poti, J.; Sokol, R.; Gordon-Larsen, P. Epidemiology of Obesity in Adults: Latest Trends. Curr. Obes. Rep. 2018, 7, 276–288. [Google Scholar] [CrossRef] [PubMed]
- Hruby, A.; Hu, F.B. The Epidemiology of Obesity: A Big Picture. Pharmacoeconomics 2015, 33, 673–689. [Google Scholar] [CrossRef] [PubMed]
- Hoffman, D.J.; Reynolds, R.M.; Hardy, D.B. Developmental origins of health and disease: Current knowledge and potential mechanisms. Nutr. Rev. 2017, 75, 951–970. [Google Scholar] [CrossRef] [PubMed]
- Chen, M.; Liang, S.; Zhou, H.; Xu, Y.; Qin, X.; Hu, Z.; Wang, X.; Qiu, L.; Wang, W.; Zhang, Y.; et al. Prenatal and postnatal mothering by diesel exhaust PM2.5-exposed dams differentially program mouse energy metabolism. Part. Fibre Toxicol. 2017, 14, 3. [Google Scholar] [CrossRef]
- Albers, L.; Sobotzki, C.; Kuss, O.; Ajslev, T.; Batista, R.F.; Bettiol, H.; Brabin, B.; Buka, S.L.; Cardoso, V.C.; Clifton, V.L.; et al. Maternal smoking during pregnancy and offspring overweight: Is there a dose-response relationship? An individual patient data meta-analysis. Int. J. Obes. 2018, 42, 1249–1264. [Google Scholar] [CrossRef] [PubMed]
- Somm, E.; Schwitzgebel, V.M.; Toulotte, A.; Cederroth, C.R.; Combescure, C.; Nef, S.; Aubert, M.L.; Hüppi, P.S. Perinatal Exposure to Bisphenol A Alters Early Adipogenesis in the Rat. Environ. Health Perspect. 2009, 117, 1549–1555. [Google Scholar] [CrossRef] [PubMed]
- Luo, T.; Wang, C.; Pan, Z.; Jin, C.; Fu, Z.; Jin, Y. Maternal Polystyrene Microplastic Exposure during Gestation and Lactation Altered Metabolic Homeostasis in the Dams and Their F1 and F2 Offspring. Environ. Sci. Technol. 2019, 53, 10978–10992. [Google Scholar] [CrossRef] [PubMed]
- Jeong, B.; Kim, J.S.; Kwon, A.R.; Lee, J.; Park, S.; Koo, J.; Lee, W.S.; Baek, J.Y.; Shin, W.H.; Lee, J.S.; et al. Maternal nanoplastic ingestion induces an increase in offspring body weight through altered lipid species and microbiota. Environ. Int. 2024, 185, 108522. [Google Scholar] [CrossRef]
- Tang, J.; Bu, W.; Hu, W.; Zhao, Z.; Liu, L.; Luo, C.; Wang, R.; Fan, S.; Yu, S.; Wu, Q.; et al. Ferroptosis Is Involved in Sex-Specific Small Intestinal Toxicity in the Offspring of Adult Mice Exposed to Polystyrene Nanoplastics during Pregnancy. ACS Nano 2023, 17, 2440–2449. [Google Scholar] [CrossRef]
- Wang, X.; Zhao, Z.; Wang, X.; Hu, W.; Chao, L.; Chu, X.; Qian, M.; Wang, R.; Yu, S.; Wu, Q.; et al. Effects of polystyrene nanoplastic gestational exposure on mice. Chemosphere 2023, 324, 138255. [Google Scholar] [CrossRef] [PubMed]
- Berstein, L.M. Cancer and heterogeneity of obesity: A potential contribution of brown fat. Future Oncol. 2012, 8, 1537–1548. [Google Scholar] [CrossRef]
- Liu, X.; Zhang, Z.; Song, Y.; Xie, H.; Dong, M. An update on brown adipose tissue and obesity intervention: Function, regulation and therapeutic implications. Front. Endocrinol. 2022, 13, 1065263. [Google Scholar] [CrossRef] [PubMed]
- Cypess, A.M.; Lehman, S.; Williams, G.; Tal, I.; Rodman, D.; Goldfine, A.B.; Kuo, F.C.; Palmer, E.L.; Tseng, Y.H.; Doria, A.; et al. Identification and importance of brown adipose tissue in adult humans. N. Engl. J. Med. 2009, 360, 1509–1517. [Google Scholar] [CrossRef]
- Chen, H.J.; Li, G.L.; Zhang, W.X.; Fan, J.; Hu, L.; Zhang, L.; Zhang, J.; Yan, Y.E. Maternal nicotine exposure during pregnancy and lactation induces brown adipose tissue whitening in female offspring. Toxicol. Appl. Pharmacol. 2020, 409, 115298. [Google Scholar] [CrossRef]
- Yao, Z.; Liang, S.; Chen, J.; Zhang, H.; Chen, W.; Li, H. Dietary Lactate Intake and Physical Exercise Synergistically Reverse Brown Adipose Tissue Whitening to Ameliorate Diet-Induced Obesity. J. Agric. Food Chem. 2024, 72, 25286–25297. [Google Scholar] [CrossRef]
- Rio, D.C.; Ares, M., Jr.; Hannon, G.J.; Nilsen, T.W. Purification of RNA using TRIzol (TRI reagent). Cold Spring Harb. Protoc. 2010, 2010, pdb-prot5439. [Google Scholar] [CrossRef]
- Bustin, S.A.; Benes, V.; Garson, J.A.; Hellemans, J.; Huggett, J.; Kubista, M.; Mueller, R.; Nolan, T.; Pfaffl, M.W.; Shipley, G.L.; et al. The MIQE guidelines: Minimum information for publication of quantitative real-time PCR experiments. Clin. Chem. 2009, 55, 611–622. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Liu, L.; Luo, C.; Zheng, D.; Wang, X.; Wang, R.; Ding, W.; Shen, Z.; Xue, P.; Yu, S.; Liu, Y.; et al. TRPML1 contributes to antimony-induced nephrotoxicity by initiating ferroptosis via chaperone-mediated autophagy. Food Chem. Toxicol. 2024, 184, 114378. [Google Scholar] [CrossRef] [PubMed]
- Zwick, R.K.; Guerrero-Juarez, C.F.; Horsley, V.; Plikus, M.V. Anatomical, Physiological, and Functional Diversity of Adipose Tissue. Cell Metab. 2018, 27, 68–83. [Google Scholar] [CrossRef] [PubMed]
- Takaishi, K.; Oshima, T.; Eto, H.; Nishihira, M.; Nguyen, S.T.; Ochi, R.; Fujita, N.; Urakawa, S. Impact of Exercise and Detraining during Childhood on Brown Adipose Tissue Whitening in Obesity. Metabolites 2021, 11, 677. [Google Scholar] [CrossRef] [PubMed]
- Shimizu, I.; Aprahamian, T.; Kikuchi, R.; Shimizu, A.; Papanicolaou, K.N.; MacLauchlan, S.; Maruyama, S.; Walsh, K. Vascular rarefaction mediates whitening of brown fat in obesity. J. Clin. Investig. 2014, 124, 2099–2112. [Google Scholar] [CrossRef]
- Shimizu, I.; Walsh, K. The Whitening of Brown Fat and Its Implications for Weight Management in Obesity. Curr. Obes. Rep. 2015, 4, 224–229. [Google Scholar] [CrossRef] [PubMed]
- Kotzbeck, P.; Giordano, A.; Mondini, E.; Murano, I.; Severi, I.; Venema, W.; Cecchini, M.P.; Kershaw, E.E.; Barbatelli, G.; Haemmerle, G.; et al. Brown adipose tissue whitening leads to brown adipocyte death and adipose tissue inflammation. J. Lipid Res. 2018, 59, 784–794. [Google Scholar] [CrossRef]
- Zhang, S.; Peng, X.; Yang, S.; Li, X.; Huang, M.; Wei, S.; Liu, J.; He, G.; Zheng, H.; Yang, L.; et al. The regulation, function, and role of lipophagy, a form of selective autophagy, in metabolic disorders. Cell Death Dis. 2022, 13, 132. [Google Scholar] [CrossRef]
- Xu, Z.; Han, X.; Ou, D.; Liu, T.; Li, Z.; Jiang, G.; Liu, J.; Zhang, J. Targeting PI3K/AKT/mTOR-mediated autophagy for tumor therapy. Appl. Microbiol. Biotechnol. 2020, 104, 575–587. [Google Scholar] [CrossRef] [PubMed]
- Owei, I.; Umekwe, N.; Provo, C.; Wan, J.; Dagogo-Jack, S. Insulin-sensitive and insulin-resistant obese and non-obese phenotypes: Role in prediction of incident pre-diabetes in a longitudinal biracial cohort. BMJ Open Diabetes Res. Care 2017, 5, e000415. [Google Scholar] [CrossRef]
- Powell-Wiley, T.M.; Poirier, P.; Burke, L.E.; Despres, J.P.; Gordon-Larsen, P.; Lavie, C.J.; Lear, S.A.; Ndumele, C.E.; Neeland, I.J.; Sanders, P.; et al. Obesity and Cardiovascular Disease: A Scientific Statement From the American Heart Association. Circulation 2021, 143, e984–e1010. [Google Scholar] [CrossRef] [PubMed]
- Miracle, C.E.; McCallister, C.L.; Egleton, R.D.; Salisbury, T.B. Mechanisms by which obesity regulates inflammation and anti-tumor immunity in cancer. Biochem. Biophys. Res. Commun. 2024, 733, 150437. [Google Scholar] [CrossRef] [PubMed]
- Koliaki, C.; Dalamaga, M.; Liatis, S. Update on the Obesity Epidemic: After the Sudden Rise, Is the Upward Trajectory Beginning to Flatten? Curr. Obes. Rep. 2023, 12, 514–527. [Google Scholar] [CrossRef]
- Oken, E.; Levitan, E.B.; Gillman, M.W. Maternal smoking during pregnancy and child overweight: Systematic review and meta-analysis. Int. J. Obes. 2008, 32, 201–210. [Google Scholar] [CrossRef]
- Vrijheid, M.; Fossati, S.; Maitre, L.; Marquez, S.; Roumeliotaki, T.; Agier, L.; Andrusaityte, S.; Cadiou, S.; Casas, M.; de Castro, M.; et al. Early-Life Environmental Exposures and Childhood Obesity: An Exposome-Wide Approach. Environ. Health Perspect. 2020, 128, 67009. [Google Scholar] [CrossRef]
- Gao, H.; Wang, Y.F.; Wang, Z.W.; Wang, Y.; Tao, F.B. Prenatal phthalate exposure associated with age-specific alterations in markers of adiposity in offspring: A systematic review. Ecotoxicol. Environ. Saf. 2022, 232, 113247. [Google Scholar] [CrossRef] [PubMed]
- Starling, A.P.; Wood, C.; Liu, C.; Kechris, K.; Yang, I.V.; Friedman, C.; Thomas, D.S.K.; Peel, J.L.; Adgate, J.L.; Magzamen, S.; et al. Ambient air pollution during pregnancy and DNA methylation in umbilical cord blood, with potential mediation of associations with infant adiposity: The Healthy Start study. Environ. Res. 2022, 214, 113881. [Google Scholar] [CrossRef]
- Chen, G.; Xiong, S.; Jing, Q.; van Gestel, C.A.M.; van Straalen, N.M.; Roelofs, D.; Sun, L.; Qiu, H. Maternal exposure to polystyrene nanoparticles retarded fetal growth and triggered metabolic disorders of placenta and fetus in mice. Sci. Total Environ. 2023, 854, 158666. [Google Scholar] [CrossRef]
- Senathirajah, K.; Attwood, S.; Bhagwat, G.; Carbery, M.; Wilson, S.; Palanisami, T. Estimation of the mass of microplastics ingested—A pivotal first step towards human health risk assessment. J. Hazard. Mater. 2021, 404, 124004. [Google Scholar] [CrossRef] [PubMed]
- Tian, X.; Zhu, M.; Du, L.; Wang, J.; Fan, Z.; Liu, J.; Zhao, Y.; Nie, G. Intrauterine inflammation increases materno-fetal transfer of gold nanoparticles in a size-dependent manner in murine pregnancy. Small 2013, 9, 2432–2439. [Google Scholar] [CrossRef]
- Rangel-Azevedo, C.; Santana-Oliveira, D.A.; Miranda, C.S.; Martins, F.F.; Mandarim-de-Lacerda, C.A.; Souza-Mello, V. Progressive brown adipocyte dysfunction: Whitening and impaired nonshivering thermogenesis as long-term obesity complications. J. Nutr. Biochem. 2022, 105, 109002. [Google Scholar] [CrossRef] [PubMed]
- Bjune, J.I.; Stromland, P.P.; Jersin, R.A.; Mellgren, G.; Dankel, S.N. Metabolic and Epigenetic Regulation by Estrogen in Adipocytes. Front. Endocrinol. 2022, 13, 828780. [Google Scholar] [CrossRef] [PubMed]
- Knebel, B.; Fahlbusch, P.; Dille, M.; Wahlers, N.; Hartwig, S.; Jacob, S.; Kettel, U.; Schiller, M.; Herebian, D.; Koellmer, C.; et al. Fatty Liver Due to Increased Lipogenesis: Alterations in the Hepatic Peroxisomal Proteome. Front. Cell Dev. Biol. 2019, 7, 248. [Google Scholar] [CrossRef]
- Heeren, J.; Scheja, L. Metabolic-associated fatty liver disease and lipoprotein metabolism. Mol. Metab. 2021, 50, 101238. [Google Scholar] [CrossRef]
- Schlein, C.; Fischer, A.W.; Sass, F.; Worthmann, A.; Tödter, K.; Jaeckstein, M.Y.; Behrens, J.; Lynes, M.D.; Kiebish, M.A.; Narain, N.R.; et al. Endogenous Fatty Acid Synthesis Drives Brown Adipose Tissue Involution. Cell Rep. 2021, 34, 108624. [Google Scholar] [CrossRef] [PubMed]
- Chitraju, C.; Fischer, A.W.; Farese, R.V.; Walther, T.C. Lipid Droplets in Brown Adipose Tissue Are Dispensable for Cold-Induced Thermogenesis. Cell Rep. 2020, 33, 108348. [Google Scholar] [CrossRef] [PubMed]
- Silhavy, J.; Mlejnek, P.; Simáková, M.; Marková, I.; Malínská, H.; Hüttl, M.; Kazdová, L.; Kazantsev, D.; Mancini, M.; Novotny, J.; et al. CD36 regulates substrates utilisation in brown adipose tissue of spontaneously hypertensive rats: In vitro study. PLoS ONE 2023, 18, e0283276. [Google Scholar] [CrossRef]
- Kwanten, W.J.; Martinet, W.; Michielsen, P.P.; Francque, S.M. Role of autophagy in the pathophysiology of nonalcoholic fatty liver disease: A controversial issue. World J. Gastroenterol. 2014, 20, 7325–7338. [Google Scholar] [CrossRef]
- Schott, M.B.; Weller, S.G.; Schulze, R.J.; Krueger, E.W.; Drizyte-Miller, K.; Casey, C.A.; McNiven, M.A. Lipid droplet size directs lipolysis and lipophagy catabolism in hepatocytes. J. Cell Biol. 2019, 218, 3320–3335. [Google Scholar] [CrossRef]
- Martinez-Lopez, N.; Garcia-Macia, M.; Sahu, S.; Athonvarangkul, D.; Liebling, E.; Merlo, P.; Cecconi, F.; Schwartz, G.J.; Singh, R. Autophagy in the CNS and Periphery Coordinate Lipophagy and Lipolysis in the Brown Adipose Tissue and Liver. Cell Metab. 2016, 23, 113–127. [Google Scholar] [CrossRef]
- Cairo, M.; Villarroya, J. The role of autophagy in brown and beige adipose tissue plasticity. J. Physiol. Biochem. 2020, 76, 213–226. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Yu, P.; Xie, X.; Wu, L.; Zhou, M.; Huan, F.; Jiang, L.; Gao, R. Bisphenol F induces nonalcoholic fatty liver disease-like changes: Involvement of lysosome disorder in lipid droplet deposition. Environ. Pollut. 2021, 271, 116304. [Google Scholar] [CrossRef] [PubMed]
- Ando, Y.; Odawara, E.; Sakai, H.; Sato, F.; Kamei, J. Placental extract suppresses lipid droplet accumulation by autophagy during the differentiation of adipose-derived mesenchymal stromal/stem cells into mature adipocytes. BMC Res. Notes 2023, 16, 338. [Google Scholar] [CrossRef]
- Govindhan, T.; Amirthalingam, M.; Govindan, S.; Duraisamy, K.; Cho, J.H.; Tawata, S.; Periyakali, S.B.; Palanisamy, S. Diosgenin intervention: Targeting lipophagy to counter high glucose diet-induced lipid accumulation and lifespan reduction. 3Biotech 2024, 14, 171. [Google Scholar] [CrossRef]
- Altshuler-Keylin, S.; Kajimura, S. Mitochondrial homeostasis in adipose tissue remodeling. Sci. Signal. 2017, 10, eaai9248. [Google Scholar] [CrossRef]
Gene | Forward Primer (5–3′) | Reverse Primer (5–3′) |
---|---|---|
β-actin | TGAACGGGAAGCTCACTGG | TCCACCACCCTGTTGCTGTA |
ATGL | CAGAGATGGACTTCGATTCCTT | CAGGTGCTCTAGAATTCGATCT |
HSL | CTCACAGTTACCATCTCACCTC | GATTTTGCCAGGCTGTTGAGTA |
UCP-1 | CACGGGGACCTACAATGCTT | CAGGAGTGTGGTGCAAAACC |
Protein | Source | Dilution Rate | Brand | Art. No. |
---|---|---|---|---|
LC3 | Rabbit | 1:5000 | Proteintech | 14600 |
P62 | Rabbit | 1:1000 | Proteintech | 18420 |
p-mTOR | Rabbit | 1:2000 | Abways | CY6571 |
p-AKT | Rabbit | 1:2000 | Abways | CY6569 |
Lamp2 | Rabbit | 1:2000 | Abways | CY5518 |
PPAR-α | Rabbit | 1:1000 | Proteintech | 15540 |
SREBP1 | Rabbit | 1:5000 | Abcam | ab28481 |
FASN | Rabbit | 1:1000 | Cell Signaling | 3180S |
CD36 | Rabbit | 1:2000 | proteintech | 18836 |
DGAT2 | Rabbit | 1:2000 | Immunoway | YN0642 |
UCP-1 | Rabbit | 1:1000 | Cell Signaling | 14670S |
β-actin | Mouse | 1:20,000 | Immunoway | YM3028 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Shen, Z.; Tian, K.; Tang, J.; Wang, L.; Zhang, F.; Yang, L.; Ge, Y.; Jiang, M.; Zhao, X.; Yang, J.; et al. Exposure to Nanoplastics During Pregnancy Induces Brown Adipose Tissue Whitening in Male Offspring. Toxics 2025, 13, 171. https://doi.org/10.3390/toxics13030171
Shen Z, Tian K, Tang J, Wang L, Zhang F, Yang L, Ge Y, Jiang M, Zhao X, Yang J, et al. Exposure to Nanoplastics During Pregnancy Induces Brown Adipose Tissue Whitening in Male Offspring. Toxics. 2025; 13(3):171. https://doi.org/10.3390/toxics13030171
Chicago/Turabian StyleShen, Zhaoping, Kai Tian, Jiayi Tang, Lin Wang, Fangsicheng Zhang, Lingjuan Yang, Yufei Ge, Mengna Jiang, Xinyuan Zhao, Jinxian Yang, and et al. 2025. "Exposure to Nanoplastics During Pregnancy Induces Brown Adipose Tissue Whitening in Male Offspring" Toxics 13, no. 3: 171. https://doi.org/10.3390/toxics13030171
APA StyleShen, Z., Tian, K., Tang, J., Wang, L., Zhang, F., Yang, L., Ge, Y., Jiang, M., Zhao, X., Yang, J., Chen, G., & Wang, X. (2025). Exposure to Nanoplastics During Pregnancy Induces Brown Adipose Tissue Whitening in Male Offspring. Toxics, 13(3), 171. https://doi.org/10.3390/toxics13030171