miR-26a-5p/ADAM17-Mediated Proteolysis of TREM2 Regulates Neuroinflammation in Hypertensive Mice Following Lead Exposure
Abstract
1. Introduction
2. Materials and Methods
2.1. Animal and Treatment
2.2. Methods of CSF Extraction in Mice
2.3. Cells Culture and Treatment
2.4. Quantitative Real-Time PCR (qPCR)
2.5. Western Blotting
2.6. Immunofluorescence Staining
2.7. Behavioural Test
2.7.1. Sucrose Preference Test (SPT)
2.7.2. Elevated Plus-Maze Test (EPM)
2.8. Transfection
2.9. Enzyme-Linked Immunosorbent Assay (Elisa)
2.10. Statistical Analysis
3. Results
3.1. Hypertension Aggravated Neuroinflammation in Mice Following Pb Exposure
3.2. The Decrease in TREM2 Expression in Microglia Was Accelerated by Co-Exposure to Pb and AngII
3.3. TREM2 Played the Vital Role in Microglia-Related Neuroinflammation Caused by Pb and AngII Exposure
3.4. The Change Profile of ADAM10 and ADAM17 in Hypertensive Mice with/Without Pb Exposure
3.5. TREM2 Was Primarily Clipped by ADAM17 in Hypertensive Mice After Pb Exposure
3.6. miR-26a-5p Regulated Pb- and AngII-Induced TREM2 Change by Targeting ADAM17
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Zaman, R.; Hamidzada, H.; Kantores, C.; Wong, A.; Dick, S.A.; Wang, Y.M.; Momen, A.; Aronoff, L.; Lin, J.L.; Razani, B.; et al. Selective loss of resident macrophage-derived insulin-like growth factor-1 abolishes adaptive cardiac growth to stress. Immunity 2021, 54, 2057–2071.e6. [Google Scholar] [CrossRef] [Scilit]
- Song, J.W.; Shou, H.; Obusez, E.C.; Raymond, S.B.; Rafla, S.D.; Kharal, G.A.; Schaefer, P.W.; Romero, J.M. Spatial Distribution of Intracranial Vessel Wall Enhancement in Hypertension and Primary Angiitis of the CNS. Sci. Rep. 2019, 9, 19270. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Z.L.; Zhao, L.; Zhou, X.Y.; Meng, X.; Zhou, X.L. Role of inflammation, immunity, and oxidative stress in hypertension: New insights and potential therapeutic targets. Front. Immunol. 2023, 13, 1098725. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, Y.Y.; Guo, S.Q.; Wang, S.; Li, X.J.; Hou, D.K.; Li, H.Z.; Wang, L.L.; Xu, Y.; Ma, B.J.; Wang, H.T.; et al. LncRNA OIP5-AS1 inhibits ferroptosis in prostate cancer with long-term cadmium exposure through miR-128-3p/SLC7A11 signaling. Ecotoxicol. Environ. Saf. 2021, 220, 112376. [Google Scholar] [CrossRef] [Scilit]
- Xu, L.; He, D.; Bai, Y. Microglia-Mediated Inflammation and Neurodegenerative Disease. Mol. Neurobiol. 2016, 53, 6709–6715. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, C.C.; Zong, S.; Cui, X.L.; Wang, X.Y.; Wu, S.; Wang, L.; Liu, Y.C.; Lu, Z.M. The effects of microglia-associated neuroinflammation on Alzheimer’s disease. Front. Immunol. 2023, 14, 1117172. [Google Scholar] [CrossRef] [Scilit]
- Köhler, O.; Krogh, J.; Mors, O.; Benros, M.E. Inflammation in Depression and the Potential for Anti-Inflammatory Treatment. Curr. Neuropharmacol. 2016, 14, 732–742. [Google Scholar] [CrossRef] [Scilit]
- Ho, W.C.; Hsu, C.C.; Huang, H.J.; Wang, H.T.; Lin, A.M.Y. Anti-inflammatory Effect of AZD6244 on Acrolein-Induced Neuroinflammation. Mol. Neurobiol. 2020, 57, 88–95. [Google Scholar] [CrossRef] [Scilit]
- Huang, W.D.; Huang, J.; Huang, N.Q.; Luo, Y. The role of TREM2 in Alzheimer’s disease: From the perspective of Tau. Front. Cell Dev. Biol. 2023, 11, 1280257. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shi, Q.; Gutierrez, R.A.; Bhat, M.A. Microglia, Trem2, and Neurodegeneration. The Neuroscientist, 2024; Published online. [CrossRef] [Scilit]
- Wang, X.C.; He, Q.F.; Zhou, C.L.; Xu, Y.Y.; Liu, D.H.; Fujiwara, N.; Kubota, N.; Click, A.; Henderson, P.; Vancil, J.; et al. Prolonged hypernutrition impairs TREM2-dependent efferocytosis to license chronic liver inflammation and NASH development. Immunity 2023, 56, 58–77.e11. [Google Scholar] [CrossRef] [Scilit]
- Pillai, J.A.; Khrestian, M.; Bena, J.; Leverenz, J.B.; Bekris, L.M. Temporal Ordering of Inflammatory Analytes sTNFR2 and sTREM2 in Relation to Alzheimer’s Disease Biomarkers and Clinical Outcomes. Front. Aging Neurosci. 2021, 13, 676744. [Google Scholar] [CrossRef] [Scilit]
- Liu, W.F.; Taso, O.; Wang, R.; Bayram, S.; Graham, A.C.; Garcia-Reitboeck, P.; Mallach, A.; Andrews, W.D.; Piers, T.M.; Botia, J.A.; et al. Trem2 promotes anti-inflammatory responses in microglia and is suppressed under pro-inflammatory conditions. Hum. Mol. Genet. 2020, 29, 3224–3248. [Google Scholar] [CrossRef] [Scilit]
- Liu, F.; Zhuang, L.; Wu, R.X.; Li, D.Y. miR-365 inhibits cell invasion and migration of triple negative breast cancer through ADAM10. J. Buon 2019, 24, 1905–1912. [Google Scholar]
- Meng, H.N.; Huang, Q.; Zhang, X.J.; Huang, J.W.; Shen, R.W.; Zhang, B. MiR-449a regulates the cell migration and invasion of human non-small cell lung carcinoma by targeting ADAM10. Oncotargets Ther. 2019, 12, 3829–3838. [Google Scholar] [CrossRef] [Scilit]
- Shi, H.T.; Li, H.; Zhang, F.; Xue, H.H.; Zhang, Y.A.; Han, Q.H. MiR-26a-5p alleviates cardiac hypertrophy and dysfunction via targeting ADAM17. Cell Biol. Int. 2021, 45, 2357–2367. [Google Scholar] [CrossRef] [Scilit]
- Lin, Y.Y.; Liu, L.Z.; Lin, Y.; Yang, R.X.; Liao, S.L.; Xu, M.W.; He, J.B.; Liu, Q.H. MiR-145 Alleviates Sepsis-Induced Inflammatory Responses and Organ Injury by Targeting ADAM17. Front. Biosci. -Landmark 2024, 29, 44. [Google Scholar] [CrossRef] [Scilit]
- Unger, T.; Borghi, C.; Charchar, F.; Khan, N.A.; Poulter, N.R.; Prabhakaran, D.; Ramirez, A.; Schlaich, M.; Stergiou, G.S.; Tomaszewski, M.; et al. 2020 International Society of Hypertension global hypertension practice guidelines. J. Hypertens. 2020, 38, 982–1004. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Feuerbach, D.; Schindler, P.; Barske, C.; Joller, S.; Beng-Louka, E.; Worringer, K.A.; Kommineni, S.; Kaykas, A.; Ho, D.J.; Ye, C.Y.; et al. ADAM17 is the main sheddase for the generation of human triggering receptor expressed in myeloid cells (hTREM2) ectodomain and cleaves TREM2 after Histidine 157. Neurosci. Lett. 2017, 660, 109–114. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wen, X.; Yin, Y.; Li, X.H.; He, T.; Wang, P.F.; Song, M.Z.; Gao, J.F. Effect of miR-26a-5p targeting ADAM17 gene on apoptosis, inflammatory factors and oxidative stress response of myocardial cells in hypoxic model. J. Bioenerg. Biomembr. 2020, 52, 83–92. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, K.-s.; Hao, J.-h.; Zeng, Y.; Dai, F.-c.; Gu, P.-q. Neurotoxicity and biomarkers of lead exposure: A review. Chin. Med. Sci. J. 2013, 28, 178–188. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, C.; Wang, Y.; Xing, Y.; Han, J.; Zhang, Y.; Zhang, A.; Hu, J.; Hua, Y.; Bai, Y. Regulation of microglia phagocytosis and potential involvement of exercise. Front. Cell Neurosci. 2022, 16, 953534. [Google Scholar] [CrossRef] [Scilit]
- Du, S.; Xiong, S.; Du, X.; Yuan, T.-F.; Peng, B.; Rao, Y. Primary Microglia Isolation from Postnatal Mouse Brains. J. Vis. Exp. 2021, 168, 62237. [Google Scholar] [CrossRef] [Scilit]
- Gong, S.; Zhai, M.; Shi, J.; Yu, G.; Lei, Z.; Shi, Y.; Zeng, Y.; Ju, P.; Yang, N.; Zhang, Z.; et al. TREM2 macrophage promotes cardiac repair in myocardial infarction by reprogramming metabolism via SLC25A53. Cell Death Differ. 2024, 31, 239–253. [Google Scholar] [CrossRef] [Scilit]
- Hwang, M.; Savarin, C.; Kim, J.; Powers, J.; Towne, N.; Oh, H.; Bergmann, C.C. Trem2 deficiency impairs recovery and phagocytosis and dysregulates myeloid gene expression during virus-induced demyelination. J. Neuroinflamm. 2022, 19, 267. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pang, X.-W.; Chu, Y.-H.; Zhou, L.-Q.; Chen, M.; You, Y.-F.; Tang, Y.; Yang, S.; Zhang, H.; Xiao, J.; Deng, G.; et al. Trem2 deficiency attenuates microglial phagocytosis and autophagic-lysosomal activation in white matter hypoperfusion. J. Neurochem. 2023, 167, 489–504. [Google Scholar] [CrossRef] [Scilit]
- Krasemann, S.; Madore, C.; Cialic, R.; Baufeld, C.; Calcagno, N.; El Fatimy, R.; Beckers, L.; O’Loughlin, E.; Xu, Y.; Fanek, Z.; et al. The TREM2-APOE Pathway Drives the Transcriptional Phenotype of Dysfunctional Microglia in Neurodegenerative Diseases. Immunity 2017, 47, 566–581.e9. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Su, P.; Zhang, J.B.; Wu, J.X.; Chen, H.G.; Luo, W.J.; Hu, M. TREM2 expression on the microglia resolved lead exposure-induced neuroinflammation by promoting anti-inflammatory activities. Ecotoxicol. Environ. Saf. 2023, 260, 115058. [Google Scholar] [CrossRef] [Scilit]
- Thornton, P.; Sevalle, J.; Deery, M.J.; Fraser, G.; Zhou, Y.; Ståhl, S.; Franssen, E.H.; Dodd, R.B.; Qamar, S.; Gomez Perez-Nievas, B.; et al. TREM2 shedding by cleavage at the H157-S158 bond is accelerated for the Alzheimer’s disease-associated H157Y variant. EMBO Mol. Med. 2017, 9, 1366–1378. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pocock, J.; Vasilopoulou, F.; Svensson, E.; Cosker, K. Microglia and TREM2. Neuropharmacology 2024, 257, 110020. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, Y.Y.; Gao, X.; Pei, H. miRNA-384-3p alleviates sevoflurane-induced nerve injury by inhibiting Aak1 kinase in neonatal rats. Brain Behav. 2022, 12, e2556. [Google Scholar] [CrossRef] [Scilit]
- Vishnoi, A.; Rani, S. miRNA Biogenesis and Regulation of Diseases: An Updated Overview. Methods Mol. Biol. 2023, 2595. [Google Scholar] [CrossRef] [Scilit]
- Sartorius, K.; Sartorius, B.; Winkler, C.; Chuturgoon, A.; Makarova, J. The biological and diagnostic role of mirna’s in hepatocellular carcinoma. Front. Biosci. -Landmark 2018, 23, 1701–1720. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sotoudeh Anvari, M.; Vasei, H.; Najmabadi, H.; Badv, R.S.; Golipour, A.; Mohammadi-Yeganeh, S.; Salehi, S.; Mohamadi, M.; Goodarzynejad, H.; Mowla, S.J. Identification of microRNAs associated with human fragile X syndrome using next-generation sequencing. Sci. Rep. 2022, 12, 5011. [Google Scholar] [CrossRef] [Scilit]
- Liu, Y.N.; Wang, L.; Xie, F.H.; Wang, X.; Hou, Y.Y.; Wang, X.M.; Liu, J. Overexpression of miR-26a-5p Suppresses Tau Phosphorylation and Aβ Accumulation in the Alzheimer’s Disease Mice by Targeting DYRK1A. Curr. Neurovasc. Res. 2020, 17, 241–248. [Google Scholar] [CrossRef] [Scilit] [PubMed]










| Gene | Forward Primer (5′ to 3′) | Reverse Primer (5′ to 3′) |
|---|---|---|
| TREM2 | TCTGAAGAACCTCCAAGCCG | GGAGGTGCTGTGTTCCACTT |
| ADAM10 | TGAAGTGGAGCGAGAGGGAG | GTGCATCGATCCTGAGGGAG |
| ADAM17 | AGCTGCCAAGTCCTTTGAGG | TGCTTCCCCGTTTCTCAGAT |
| β-actin | CATTGCTGACAGGATGCAGAAGG | TGCTGGAAGGTGGACAGTGAGG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, Y.; Wang, Z.; Hao, H.; Zhao, Y.; Wang, J.; Wang, W. miR-26a-5p/ADAM17-Mediated Proteolysis of TREM2 Regulates Neuroinflammation in Hypertensive Mice Following Lead Exposure. Toxics 2025, 13, 37. https://doi.org/10.3390/toxics13010037
Wang Y, Wang Z, Hao H, Zhao Y, Wang J, Wang W. miR-26a-5p/ADAM17-Mediated Proteolysis of TREM2 Regulates Neuroinflammation in Hypertensive Mice Following Lead Exposure. Toxics. 2025; 13(1):37. https://doi.org/10.3390/toxics13010037
Chicago/Turabian StyleWang, Yuran, Zeming Wang, Han Hao, Yuwei Zhao, Jian Wang, and Weixuan Wang. 2025. "miR-26a-5p/ADAM17-Mediated Proteolysis of TREM2 Regulates Neuroinflammation in Hypertensive Mice Following Lead Exposure" Toxics 13, no. 1: 37. https://doi.org/10.3390/toxics13010037
APA StyleWang, Y., Wang, Z., Hao, H., Zhao, Y., Wang, J., & Wang, W. (2025). miR-26a-5p/ADAM17-Mediated Proteolysis of TREM2 Regulates Neuroinflammation in Hypertensive Mice Following Lead Exposure. Toxics, 13(1), 37. https://doi.org/10.3390/toxics13010037
