Increased Prorenin Expression in the Kidneys May Be Involved in the Abnormal Renal Function Caused by Prolonged Environmental Exposure to Microcystin-LR
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials and Reagents
2.2. Animal Experiments
2.3. Measurements of Albumin, Blood Urea Nitrogen, and Creatinine
2.4. Cell Culture
2.5. Quantitative Real-Time PCR
2.6. Statistical Analysis
3. Results
3.1. The Effect of Administering Microcystin-LR to Rats for 7 Weeks on Renal Function
3.2. The Influence of Administering Microcystin-LR to Rats for 7 Weeks on the Expression Levels of Genes Associated with the Renin–Angiotensin System in the Renal Cortex
3.3. The Correlation between the Expression Levels of Prorenin and PRR, AGT, or ACE Following Microcystin-LR Administration to Rats for 7 Weeks
3.4. The Impact of Administering Microcystin-LR to Rats for 7 Weeks on the Expression Levels of Genes Associated with Fibrosis, as Well as the Relationship between the Expression Levels of These Genes in the Renal Cortex
3.5. Relationship between the Expression Levels of Renin–Angiotensin System-Related Genes and Fibrosis-Related Genes in the Renal Cortex of Rats Following Microcystin-LR Administration for 7 Weeks
3.6. Effects of Microcystin-LR on the mRNA Expression Levels of Prorenin in Cultured Proximal Tubular Cells
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Hu, X.; Ye, J.; Zhang, R.; Wu, X.; Zhang, Y.; Wu, C. Detection of free microcystins in the liver and muscle of freshwater fish by liquid chromatography-tandem mass spectrometry. J. Environ. Sci. Health B 2017, 52, 770–776. [Google Scholar] [CrossRef] [PubMed]
- Stotts, R.R.; Namikoshi, M.; Haschek, W.M.; Rinehart, K.L.; Carmichael, W.W.; Dahlem, A.M.; Beasley, V.R. Structural modifications imparting reduced toxicity in microcystins from Microcystis spp. Toxicon 1993, 31, 783–789. [Google Scholar] [CrossRef] [PubMed]
- Ibelings, B.W.; Chorus, I. Accumulation of cyanobacterial toxins in freshwater “seafood” and its consequences for public health: A review. Environ. Pollut. 2007, 150, 177–192. [Google Scholar] [CrossRef] [PubMed]
- Miller, T.R.; Beversdorf, L.J.; Weirich, C.A.; Bartlett, S.L. Cyanobacterial Toxins of the Laurentian Great Lakes, Their Toxicological Effects, and Numerical Limits in Drinking Water. Mar. Drugs 2017, 15, 160. [Google Scholar] [CrossRef]
- Bouaïcha, N.; Miles, C.O.; Beach, D.G.; Labidi, Z.; Djabri, A.; Benayache, N.Y.; Nguyen-Quang, T. Structural Diversity, Characterization and Toxicology of Microcystins. Toxins 2019, 11, 714. [Google Scholar] [CrossRef] [PubMed]
- He, Q.; Wang, W.; Xu, Q.; Liu, Z.; Teng, J.; Yan, H.; Liu, X. Microcystins in Water: Detection, Microbial Degradation Strategies, and Mechanisms. Int. J. Environ. Res. Public Health 2022, 19, 13175. [Google Scholar] [CrossRef]
- Du, X.; Liu, H.; Yuan, L.; Wang, Y.; Ma, Y.; Wang, R.; Chen, X.; Losiewicz, M.D.; Guo, H.; Zhang, H. The diversity of cyanobacterial toxins on structural characterization, distribution and identification: A systematic review. Toxins 2019, 11, 530. [Google Scholar] [CrossRef]
- Tamele, I.J.; Silva, M.; Vasconcelos, V. The incidence of marine toxins and the associated seafood poisoning episodes in the African countries of the Indian Ocean and the Red Sea. Toxins 2019, 11, 58. [Google Scholar] [CrossRef] [PubMed]
- Valério, E.; Chaves, S.; Tenreiro, R. Diversity and impact of prokaryotic toxins on aquatic environments: A review. Toxins 2010, 2, 2359–2410. [Google Scholar] [CrossRef]
- Buratti, F.M.; Manganelli, M.; Vichi, S.; Stefanelli, M.; Scardala, S.; Testai, E.; Funari, E. Cyanotoxins: Producing organisms, occurrence, toxicity, mechanism of action and human health toxicological risk evaluation. Arch. Toxicol. 2017, 91, 1049–1130. [Google Scholar] [CrossRef]
- Cirés, S.; Casero, M.C.; Quesada, A. Toxicity at the Edge of Life: A Review on Cyanobacterial Toxins from Extreme Environments. Mar. Drugs 2017, 15, 233. [Google Scholar] [CrossRef]
- Carmichael, W.W. Cyanobacteria secondary metabolites—The cyanotoxins. J. Appl. Bacteriol. 1992, 72, 445–459. [Google Scholar] [CrossRef]
- Vasconcelos, V.M.; Sivonen, K.; Evans, W.R.; Carmichael, W.W.; Namikoshi, M. Hepatotoxic microcystin diversity in cyanobacterial blooms collected in Portuguese freshwaters. Water Res. 1996, 30, 2377–2384. [Google Scholar] [CrossRef]
- Carey, C.C.; Haney, J.F.; Cottingham, K.L. First report of microcystin-LR in the cyanobacterium Gloeotrichia echinulata. Environ. Toxicol. 2007, 22, 337–339. [Google Scholar] [CrossRef]
- Zhang, Z.; Yu, S.; Wei, G.; Chen, W. Study on the whole and cells level distribution of Microcystin LR in mice. J. Toxicol. 2002, 16, 5–8. [Google Scholar]
- Wang, Q.; Xie, P.; Chen, J.; Liang, G. Distribution of microcystins in various organs (heart, liver, intestine, gonad, brain, kidney and lung) of Wistar rat via intravenous injection. Toxicon 2008, 52, 721–727. [Google Scholar] [CrossRef]
- Madhushankha, L.; Dhammika, M.A.; Charitha, P.; Tilak, A.; Lishantha, G. Cyanobacteria and cyanotoxins in well waters of the Girandurukotte, CKDu endemic area in Sri Lanka; do they drink safe water? J. Ecotechnol. Res. 2016, 1, 17–21. [Google Scholar]
- Xu, S.; Yi, X.; Liu, W.; Zhang, C.; Massey, I.Y.; Yang, F.; Tian, L. A Review of Nephrotoxicity of Microcystins. Toxins 2020, 12, 693. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.; Xie, P.; Li, L.; Xu, J. First Identification of the Hepatotoxic Microcystins in the Serum of a Chronically Exposed Human Population Together with Indication of Hepatocellular Damage. Toxicol. Sci. 2009, 108, 81–89. [Google Scholar] [CrossRef] [PubMed]
- Lin, H.; Liu, W.; Zeng, H.; Pu, C.; Zhang, R.; Qiu, Z.; Chen, J.A.; Wang, L.; Tan, Y.; Zheng, C.; et al. Determination of Environmental Exposure to Microcystin and Aflatoxin as a Risk for Renal Function Based on 5493 Rural People in Southwest China. Environ. Sci. Technol. 2016, 50, 5346–5356. [Google Scholar] [CrossRef]
- Cho, M.H. Renal fibrosis. Korean J. Pediatr. 2010, 53, 735–740. [Google Scholar] [CrossRef] [PubMed]
- Miyazawa, H.; Hirai, K.; Ookawara, S.; Ishibashi, K.; Morishita, Y. Nano-sized carriers in gene therapy for renal fibrosis in vivo. Nano Rev. Exp. 2017, 8, 1331099. [Google Scholar] [CrossRef]
- Balakumar, P.; Sambathkumar, R.; Mahadevan, N.; Muhsinah, A.B.; Alsayari, A.; Venkateswaramurthy, N.; Jagadeesh, G. A potential role of the renin-angiotensin-aldosterone system in epithelial-to-mesenchymal transition-induced renal abnormalities: Mechanisms and therapeutic implications. Pharmacol. Res. 2019, 146, 104314. [Google Scholar] [CrossRef] [PubMed]
- Meng, X.M.; Tang, P.M.; Li, J.; Lan, H.Y. TGF-β/Smad signaling in renal fibrosis. Front. Physiol. 2015, 6, 82. [Google Scholar] [CrossRef] [PubMed]
- Duni, A.; Liakopoulos, V.; Roumeliotis, S.; Peschos, D.; Dounousi, E. Oxidative Stress in the Pathogenesis and Evolution of Chronic Kidney Disease: Untangling Ariadne’s Thread. Int. J. Mol. Sci. 2019, 20, 3711. [Google Scholar] [CrossRef] [PubMed]
- Shimizu, H.; Yisireyili, M.; Nishijima, F.; Niwa, T. Indoxyl sulfate enhances p53-TGF-β1-Smad3 pathway in proximal tubular cells. Am. J. Nephrol. 2013, 37, 97–103. [Google Scholar] [CrossRef] [PubMed]
- Burns, W.C.; Thomas, M.C. Angiotensin II and its role in tubular epithelial to mesenchymal transition associated with chronic kidney disease. Cells Tissues Organs 2011, 193, 74–84. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, G.; Delarue, F.; Burcklé, C.; Bouzhir, L.; Giller, T.; Sraer, J.D. Pivotal role of the renin/prorenin receptor in angiotensin II production and cellular responses to renin. J. Clin. Investig. 2002, 109, 1417–1427. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Zuo, S.; Li, X.; Fan, J.; Cao, X.; Yu, X.; Yang, Q. Interaction between V-ATPase B2 and (Pro) renin Receptors in Promoting the progression of Renal Tubulointerstitial Fibrosis. Sci. Rep. 2016, 6, 25035. [Google Scholar] [CrossRef]
- Kaneshiro, Y.; Ichihara, A.; Sakoda, M.; Takemitsu, T.; Nabi, A.H.; Uddin, M.N.; Nakagawa, T.; Nishiyama, A.; Suzuki, F.; Inagami, T.; et al. Slowly progressive, angiotensin II-independent glomerulosclerosis in human (pro)renin receptor-transgenic rats. J. Am. Soc. Nephrol. 2007, 18, 1789–1795. [Google Scholar] [CrossRef]
- Arman, T.; Lynch, K.D.; Goedken, M.; Clarke, J.D. Sub-chronic microcystin-LR renal toxicity in rats fed a high fat/high cholesterol diet. Chemosphere 2021, 269, 128773. [Google Scholar] [CrossRef] [PubMed]
- Yao, X.; Liu, Y.; Yang, Y.; Li, Y.; Hu, N.; Song, F.; Yang, F. Microcystin-LR-Exposure-Induced Kidney Damage by Inhibiting MKK6-Mediated Mitophagy in Mice. Toxins 2023, 15, 404. [Google Scholar] [CrossRef] [PubMed]
- Dietrich, D.; Hoeger, S. Guidance values for microcystins in water and cyanobacterial supplement products (blue-green algal supplements): A reasonable or misguided approach? Toxicol. Appl. Pharmacol. 2005, 203, 273–289. [Google Scholar] [CrossRef] [PubMed]
- Li, T.; Fan, X.; Cai, M.; Jiang, Y.; Wang, Y.; He, P.; Ni, J.; Mo, A.; Peng, C.; Liu, J. Advances in investigating microcystin-induced liver toxicity and underlying mechanisms. Sci. Total Environ. 2023, 905, 167167. [Google Scholar] [CrossRef]
- Schaefer, A.M.; Yrastorza, L.; Stockley, N.; Harvey, K.; Harris, N.; Grady, R.; Sullivan, J.; McFarland, M.; Reif, J.S. Exposure to microcystin among coastal residents during a cyanobacteria bloom in Florida. Harmful Algae 2020, 92, 101769. [Google Scholar] [CrossRef]
- Yi, X.; Xu, S.; Huang, F.; Wen, C.; Zheng, S.; Feng, H.; Guo, J.; Chen, J.; Feng, X.; Yang, A.F. Effects of Chronic Exposure to Microcystin-LR on Kidney in Mice. Int. J. Environ. Res. Public Health 2019, 16, 5030. [Google Scholar] [CrossRef]
- Soltani-Fard, E.; Taghvimi, S.; Karimi, F.; Vahedi, F.; Khatami, S.H.; Behrooj, H.; Deylami Hayati, M.; Movahedpour, A.; Ghasemi, H. Urinary biomarkers in diabetic nephropathy. Clin. Chim. Acta 2024, 561, 119762. [Google Scholar] [CrossRef] [PubMed]
- Luetscher, J.A.; Kraemer, F.B.; Wilson, D.M.; Schwartz, H.C.; Bryer-Ash, M. Increased Plasma Inactive Renin in Diabetes Mellitus. A Marker of Microvascular Complications. N. Engl. J. Med. 1985, 312, 1412–1417. [Google Scholar] [CrossRef]
- Wilson, D.M.; Luetscher, J.A. Plasma Prorenin Activity and Complications in Children with Insulin-Dependent Diabetes Mellitus. N. Engl. J. Med. 1990, 323, 1101–1106. [Google Scholar] [CrossRef]
- Chiarelli, F.; Pomilio, M.; De Luca, F.A.; Vecchiet, J.; Verrotti, A. Plasma Prorenin Levels May Predict Persistent Microalbuminuria in Children with Diabetes. Pediatr. Nephrol. 2001, 16, 116–120. [Google Scholar] [CrossRef]
- Deinum, J.; Rønn, B.; Mathiesen, E.; Derkx, F.H.M.; Hop, W.C.J.; Schalekamp, M.A.D.H. Increase in Serum Prorenin Precedes Onset of Microalbuminuria in Patients with Insulin-Dependent Diabetes Mellitus. Diabetologia 1999, 42, 1006–1010. [Google Scholar] [CrossRef] [PubMed]
- Koto, Y.; Kawahara, H.; Kurata, K.; Yoshikiyo, K.; Hashiguchi, A.; Okano, K.; Sugiura, N.; Shimizu, K.; Shimizu, H. Microcystin-LR incorporated into colonic cells through probenecid-sensitive transporters leads to upregulated MCP-1 expression induced by JNK activation. Toxicol. Rep. 2022, 9, 937–944. [Google Scholar] [CrossRef] [PubMed]
- Shimizu, H.; Saito, S.; Higashiyama, Y.; Nishijima, F.; Niwa, T. CREB, NF-κB, and NADPH oxidase coordinately upregulate indoxyl sulfate-induced angiotensinogen expression in proximal tubular cells. Am. J. Physiol. Cell Physiol. 2013, 304, C685–C692. [Google Scholar] [CrossRef] [PubMed]
- Kurata, K.; Ishii, K.; Koto, Y.; Naito, K.; Yuasa, K.; Shimizu, H. Skatole-induced p38 and JNK activation coordinately upregulates, whereas AhR activation partially attenuates TNFα expression in intestinal epithelial cells. Biosci. Biotechnol. Biochem. 2023, 87, 611–619. [Google Scholar] [CrossRef] [PubMed]
- Tomii, A.; Higa, M.; Naito, K.; Kurata, K.; Kobayashi, J.; Takei, C.; Yuasa, K.; Koto, Y.; Shimizu, H. Activation of the TLR4-JNK but not the TLR4-ERK pathway induced by indole-3-acetic acid exerts anti-proliferative effects on Caco-2 cells. Biosci. Biotechnol. Biochem. 2023, 87, 839–849. [Google Scholar] [CrossRef] [PubMed]
- Ichisaka, Y.; Yano, S.; Nishimura, K.; Niwa, T.; Shimizu, H. Indoxyl sulfate contributes to colorectal cancer cell proliferation and increased EGFR expression by activating AhR and Akt. Biomed. Res. 2024, 45, 57–66. [Google Scholar] [CrossRef] [PubMed]
- Saito, S.; Shimizu, H.; Yisireyili, M.; Nishijima, F.; Enomoto, A.; Niwa, T. Indoxyl sulfate-induced activation of (pro)renin receptor is involved in expression of TGF-β1 and α-smooth muscle actin in proximal tubular cells. Endocrinology 2014, 155, 1899–1907. [Google Scholar] [CrossRef] [PubMed]
- Faustino, L.C.; Almeida, N.A.; Pereira, G.F.; Ramos, R.G.; Soares, R.M.; Morales, M.M.; Pazos-Moura, C.C.; Ortiga-Carvalho, T.M. Thyroid hormone and estradiol have overlapping effects on kidney glutathione S-transferase-α gene expression. Am. J. Physiol. Endocrinol. Metab. 2012, 303, E787–E797. [Google Scholar] [CrossRef][Green Version]
- Shimizu, H.; Bolati, D.; Adijiang, A.; Enomoto, A.; Nishijima, F.; Dateki, M.; Niwa, T. Senescence and dysfunction of proximal tubular cells are associated with activated p53 expression by indoxyl sulfate. Am. J. Physiol. Cell Physiol. 2010, 299, C1110–C1117. [Google Scholar] [CrossRef]
- Shimizu, H.; Bolati, D.; Adijiang, A.; Muteliefu, G.; Enomoto, A.; Nishijima, F.; Dateki, M.; Niwa, T. NF-κB plays an important role in indoxyl sulfate-induced cellular senescence, fibrotic gene expression, and inhibition of proliferation in proximal tubular cells. Am. J. Physiol. Cell Physiol. 2011, 301, C1201–C1212. [Google Scholar] [CrossRef]
- Li, Z.; Zhou, L.; Wang, Y.; Miao, J.; Hong, X.; Hou, F.F.; Liu, Y. (Pro)renin receptor is an amplifier of Wnt/β-catenin signaling in kidney injury and fibrosis. J. Am. Soc. Nephrol. 2017, 28, 2393–2408. [Google Scholar] [CrossRef] [PubMed]
- Li, W.; Sullivan, M.N.; Zhang, S.; Worker, C.J.; Xiong, Z.; Speth, R.C.; Feng, Y. Intracerebroventricular infusion of the (pro)renin receptor antagonist PRO20 attenuates deoxycorticosterone acetate-salt-induced hypertension. Hypertension 2015, 65, 352–361. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Wang, Y.; Xue, K.; Wang, H.; Zhou, J.; Gao, F.; Li, C.; Yang, T.; Fang, H. (Pro)renin receptor antagonist PRO20 attenuates nephrectomy-induced nephropathy in rats via inhibition of intrarenal RAS and Wnt/β-catenin signaling. Physiol. Rep. 2021, 9, e14881. [Google Scholar] [CrossRef] [PubMed]
- Niwa, T.; Yazawa, T.; Ise, M.; Sugano, M.; Kodama, T.; Uehara, Y.; Maeda, K. Inhibitory effect of oral sorbent on accumulation of albumin-bound indoxyl sulfate in serum of experimental uremic rats. Nephron. 1991, 57, 84–88. [Google Scholar] [CrossRef]
- Niwa, T.; Emoto, Y.; Maeda, K.; Uehara, Y.; Yamada, N.; Shibata, M. Oral sorbent suppresses accumulation of albumin-bound indoxyl sulphate in serum of haemodialysis patients. Nephrol. Dial. Transplant. 1991, 6, 105–109. [Google Scholar] [CrossRef]
- Niwa, T.; Miyazaki, T.; Hashimoto, N.; Hayashi, H.; Ise, M.; Uehara, Y.; Maeda, K. Suppressed serum and urine levels of indoxyl sulfate by oral sorbent in experimental uremic rats. Am. J. Nephrol. 1992, 12, 201–206. [Google Scholar] [CrossRef] [PubMed]
- Niwa, T.; Ise, M. Indoxyl sulfate, a circulating uremic toxin, stimulates the progression of glomerular sclerosis. J. Lab. Clin. Med. 1994, 124, 96–104. [Google Scholar] [PubMed]
- Kamiński, T.W.; Pawlak, K.; Karbowska, M.; Myśliwiec, M.; Pawlak, D. Indoxyl sulfate—The uremic toxin linking hemostatic system disturbances with the prevalence of cardiovascular disease in patients with chronic kidney disease. BMC Nephrol. 2017, 18, 35. [Google Scholar] [CrossRef] [PubMed]
- Sun, C.Y.; Chang, S.C.; Wu, M.S. Uremic toxins induce kidney fibrosis by activating intrarenal renin-angiotensin-aldosterone system associated epithelial-to-mesenchymal transition. PLoS ONE 2012, 7, e34026. [Google Scholar] [CrossRef]
- Wan, X.; Steinman, A.D.; Gu, Y.; Zhu, G.; Shu, X.; Xue, Q.; Zou, W.; Xie, L. Occurrence and risk assessment of microcystin and its relationship with environmental factors in lakes of the eastern plain ecoregion, China. Environ. Sci. Pollut. Res. Int. 2020, 27, 45095–45107. [Google Scholar] [CrossRef]
- Greer, B.; McNamee, S.E.; Boots, B.; Cimarelli, L.; Guillebault, D.; Helmi, K.; Marcheggiani, S.; Panaiotov, S.; Breitenbach, U.; Akçaalan, R.; et al. A validated UPLC-MS/MS method for the surveillance of ten aquatic biotoxins in European brackish and freshwater systems. Harmful Algae 2016, 55, 31–40. [Google Scholar] [CrossRef] [PubMed]






| Target Genes | GenBank Accession No. | Primers (5→3′) | Length (bp) | Product Length (bp) |
|---|---|---|---|---|
| Rat | ||||
| Prorenin | NM_012642.4 | Fw: CTCTCTGGGCACTCTTGTTGC | 21 | 198 |
| Rv: GGGAGGTAACATTGGTAAAGGA | 22 | |||
| PRR | NM_001007091.1 | Fw: TTCTGAACTGCAAGTGCTGCAT | 22 | 101 |
| Rv: CTGCCAGCTCCAGTGAATACAAG | 23 | |||
| AGT | NM_134432.2 | Fw: GTGGAGGTCCTCGTCTTCCA | 20 | 108 |
| Rv: GTTGTAGGATCCCCGAATTTCC | 22 | |||
| ACE | NM_012544.1 | Fw: TGGGGACAAATACATCAATCTCA | 23 | 105 |
| Rv: GGGAAAGGCACTACCATGTCG | 21 | |||
| TGFβ1 | NM_021578.2 | Fw: AGCTGGTGAAACGGAAGCG | 19 | 64 |
| Rv: GCGAGCCTTAGTTTGGACAGG | 21 | |||
| α-SMA | NM_031004.2 | Fw: GTCCCAGACACCAGGGAGTGA | 21 | 102 |
| Rv: TCGGATACTTCAGGGTCAGGA | 21 | |||
| RPLP0 | NM_022402.2 | Fw: GCTCCAAGCAGATGCAGCA | 19 | 143 |
| Rv: CCGGATGTGAGGCAGCAG | 18 | |||
| Human | ||||
| Prorenin | NM_000537.4 | Fw: CCGTGATCCTCACCAACTACA | 21 | 112 |
| Rv: ACCCAAACATTGGACGAACCA | 21 | |||
| RPLP0 | NM_001002.4 | Fw: CGACCTGGAAGTCCAACTAC | 20 | 108 |
| Rv: ATCTGCTGCATCTGCTTG | 18 |
| Control | Microcystin-LR | p | |
|---|---|---|---|
| Kidney weight (g/100 g body weight) | 0.53 ± 3.40 | 0.55 ± 3.34 | NS |
| Albumin (g/dL) | 3.3 ± 0.07 | 3.3 ± 0.02 | NS |
| Blood urea nitrogen (mg/dL) | 17.4 ± 0.85 | 16.5 ± 0.57 | NS |
| Creatinine (mg/dL) | 0.4 ± 0.01 | 0.3 ± 0.02 | NS |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hitsuda, Y.; Koto, Y.; Kawahara, H.; Kurata, K.; Yoshikiyo, K.; Nishimura, K.; Hashiguchi, A.; Maseda, H.; Okano, K.; Sugiura, N.; et al. Increased Prorenin Expression in the Kidneys May Be Involved in the Abnormal Renal Function Caused by Prolonged Environmental Exposure to Microcystin-LR. Toxics 2024, 12, 547. https://doi.org/10.3390/toxics12080547
Hitsuda Y, Koto Y, Kawahara H, Kurata K, Yoshikiyo K, Nishimura K, Hashiguchi A, Maseda H, Okano K, Sugiura N, et al. Increased Prorenin Expression in the Kidneys May Be Involved in the Abnormal Renal Function Caused by Prolonged Environmental Exposure to Microcystin-LR. Toxics. 2024; 12(8):547. https://doi.org/10.3390/toxics12080547
Chicago/Turabian StyleHitsuda, Yuuka, Yoshihito Koto, Hideaki Kawahara, Koichi Kurata, Keisuke Yoshikiyo, Kohji Nishimura, Ayumi Hashiguchi, Hideaki Maseda, Kunihiro Okano, Norio Sugiura, and et al. 2024. "Increased Prorenin Expression in the Kidneys May Be Involved in the Abnormal Renal Function Caused by Prolonged Environmental Exposure to Microcystin-LR" Toxics 12, no. 8: 547. https://doi.org/10.3390/toxics12080547
APA StyleHitsuda, Y., Koto, Y., Kawahara, H., Kurata, K., Yoshikiyo, K., Nishimura, K., Hashiguchi, A., Maseda, H., Okano, K., Sugiura, N., Shimizu, K., & Shimizu, H. (2024). Increased Prorenin Expression in the Kidneys May Be Involved in the Abnormal Renal Function Caused by Prolonged Environmental Exposure to Microcystin-LR. Toxics, 12(8), 547. https://doi.org/10.3390/toxics12080547

