Gestational and Lactational Co-Exposure to DEHP and BPA Impairs Hepatic Function via PI3K/AKT/FOXO1 Pathway in Offspring
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animal Feeding
2.2. Establishment of Animal Models
2.3. Blood Collection
2.4. Organ Collection
2.5. Biochemical Analysis
2.6. Real-Time Polymerase Chain Reaction (PCR)
2.7. Western Blot Analysis
2.8. Standard Solution Preparation
2.9. Sample Preparation
2.10. UHPLC Conditions
2.11. Mass Spectrometry Conditions
2.12. Qualitative Method
2.13. Bodyweight
2.14. Oxidation Index
2.15. Histopathological Analysis
2.16. Collation and Network Construction of Liver Injury Related Targets
2.17. Target Prediction for BPA, DEHP, and Their Metabolites
2.18. Network Construction and Analysis
2.19. Gene Ontology and KEGG Pathway Enrichment Analysis
2.20. Molecular Docking
2.21. Statistical Analysis
3. Results
3.1. Identification and Qualitative Analysis of BPA, DEHP, and Their Metabolites in the Blood of Gestational Rats
3.2. Effects of BPA and DEHP Mixed Exposure on the Reproductive Development of Offspring
3.3. Effects of BPA and DEHP Mixed Exposure on Hepatic Oxidative Stress of Offspring
3.3.1. Histological Analysis of the Hepatic Sections Stained with Haematoxylin and Eosin in Offspring
3.3.2. Body Weight Gain (BWG) in Offspring
3.3.3. Relative Organ Weights (ROW) in Offspring
3.3.4. Effects of Hepatic Oxidative Stress in Offspring
3.3.5. Effects of Hepatic Oxidative Stress in Pregnant Females
3.4. Evaluation of the Correlation between DEHP, BPA, and Their Metabolites with Liver Injury
3.4.1. The Compound Network Pathway BPA, DEHP, and Their Metabolites
3.4.2. Venn Diagram of Metabolite-Targeted Network and Disease-Targeted Network
3.5. Molecular Docking
3.6. Effects of BPA, DEHP, and BPA+DHEP on the mRNA and Protein Levels of IRS-2, PI3K, AKT, and FOXO1 in Offspring Liver
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Lang, I.A.; Galloway, T.S. Association of urinary bisphenol A concentration with medical disorders and laboratory abnormalities in adults. JAMA 2008, 300, 1303–1310. [Google Scholar] [CrossRef] [PubMed]
- Singh, S.; Li, S.S.L. Bisphenol A and phthalates exhibit similar toxicogenomics and health effects. Gene 2012, 494, 85–91. [Google Scholar] [CrossRef] [PubMed]
- Buha, A.; Antonijević, B. The impact of prolonged cadmium exposure and co-exposure with polychlorinated biphenyls on thyroid function in rats. Toxicol. Lett. 2013, 221, 83–90. [Google Scholar] [CrossRef] [PubMed]
- Tsatsakis, A.M.; Docea, A.O. New challenges in risk assessment of chemicals when simulating real exposure scenarios, simultaneous multi-chemicals’ low dose exposure. Food Chem. Toxicol. 2016, 96, 174–176. [Google Scholar] [CrossRef]
- Watkins, D.J.; Peterson, K.E. Relating phthalate and BPA exposure to metabolism in peripubescence: The role of exposure timing, sex, and puberty. J. Clin. Endocrinol. Metab. 2016, 101, 79–88. [Google Scholar] [CrossRef]
- Benjamin, S.; Masai, E. Phthalates impact human health: Epidemiological evidences and plausible mechanism of action. J. Hazard. Mater. 2017, 340, 360–383. [Google Scholar] [CrossRef]
- Radha, M.J.; Basha, P.M. Di (n)-Butyl phthalate induced neuronal perturbations in rat brain tissues: A multigenerational assessment. Int. J. Biosci. Psychiatry Technol. 2017, 8, 794–800. [Google Scholar]
- Tsatsakis, A.M.; Kouretas, D. Simulating real-life exposures to uncover possible risks to human health: A proposed consensus for a novel methodological approach. Hum. Exp. Toxicol. 2017, 36, 554–564. [Google Scholar] [CrossRef]
- Docea, A.O.; Gofita, E. Six months exposure to a real life mixture of 13 chemicals’ below individual NOAELs induced non-monotonic sex-dependent biochemical and redox status changes in rats. Food Chem. Toxicol. 2018, 115, 470–481. [Google Scholar] [CrossRef]
- Street, M.E.; Angelini, S. Current knowledge on endocrine disrupting chemicals (EDCs) from animal biology to humans, from pregnancy to adulthood: Highlights from a national Italian meeting. Int. J. Mol. Sci. 2018, 19, 1647. [Google Scholar] [CrossRef]
- Andjelkovic, M.; Djordjevic, A.B. Toxic effect of acute cadmium and lead exposure in rat blood, liver and kidney. Int. J. Environ. Res. Public Health 2019, 16, 274. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Zhu, H.; Kannan, K. A review of biomonitoring of phthalate exposures. Toxics 2019, 7, 21. [Google Scholar] [CrossRef] [PubMed]
- Wittassek, M.; Koch, H.M. Assessing exposure to phthalates—The human biomonitoring approach. Mol. Nutr. Food Res. 2011, 55, 7–31. [Google Scholar] [CrossRef] [PubMed]
- Kortenkamp, A. Low dose mixture effects of endocrine disrupters: Implications for risk assessment and epidemiology. Int. J. Androl. 2008, 31, 233–240. [Google Scholar] [CrossRef]
- Curčić, M.; Janković, S. Combined effects of cadmium and decabrominated diphenyl ether on thyroid hormones in rats. Arh. Hig. Rada Toksikol. 2012, 63, 255–262. [Google Scholar] [CrossRef]
- Iyyadurai, R.; Peter, J.V. Organophosphate-pyrethroid combination pesticides may be associated with increased toxicity in human poisoning compared to either pesticide alone. Clin. Toxicol. (Phila) 2014, 52, 538–541. [Google Scholar] [CrossRef]
- Chen, H.; Zhang, W. Di(2-ethylhexyl) phthalate exacerbates non-alcoholic fatty liver in rats and its potential mechanisms. Environ. Toxicol. Pharmacol. 2016, 42, 38–44. [Google Scholar] [CrossRef]
- Margina, D.; Nițulescu, G. Overview of the effects of chemical mixtures with endocrine disrupting activity in the context of real-life risk simulation (RLRS): An integrative approach (Review). World Acad. Sci. J. 2019, 1, 157–164. [Google Scholar] [CrossRef]
- Dong, X.; Zhang, Y. Urinary metabolomic profiling in rats exposed to dietary di(2-ethylhexyl) phthalate (DEHP) using ultraperformance liquid chromatography quadrupole time-of-flight tandem mass spectrometry (UPLC/Q-TOF-MS). Environ. Sci. Pollut. Res. 2017, 24, 16659–16672. [Google Scholar] [CrossRef]
- Errico, S.; Chioccarelli, T. A new LC-MS/MS method for simultaneous and quantitative detection of bisphenol-A and steroids in target tissues: A power tool to characterize the interference of bisphenol-A exposure on steroid levels. Molecules 2019, 25, 48. [Google Scholar] [CrossRef]
- David, R.M.; Moore, M.R.; Finney, D.C.; Guest, D. Chronic toxicity of di(2-ethylhexyl)phthalate in rats. Toxicol. Sci. 2000, 55, 433–443. [Google Scholar] [CrossRef] [PubMed]
- Bisphenol, A. Action Plan; US Environmental Protection Agency: Washington, DC, USA, 2011; CASRN 80-05-7.
- Organisation for Economic Co-operation and Development. Repeated Dose 90-Day Oral Toxicity Study in Rodents. In OECD Guideline for the Testing of Chemicals; OECD: Paris, France, 1998. [Google Scholar]
- GB/T 21911-2008; Determination of Phthalates. National Standards for food Safety of the People’s Republic of China: Beijing, China, 2023; No. 08. Volume 155066.1-32374.
- Wu, T.; Hu, E. clusterProfiler 4.0: A universal enrichment tool for interpreting omics data. Innovation 2021, 2, 100141. [Google Scholar] [CrossRef] [PubMed]
- Tremblay-Franco, M.; Cabaton, N.J. Dynamic metabolic disruption in rats perinatally exposed to low doses of bisphenol-A. PLoS ONE 2015, 10, e0141698. [Google Scholar] [CrossRef] [PubMed]
- Becker, K.; Seiwert, M. DEHP metabolites in urine of children and DEHP in house dust. Int. J. Hyg. Environ. Health 2004, 207, 409–417. [Google Scholar] [CrossRef]
- Schmidt, J.S.; Schaedlich, K. Effects of di(2-ethylhexyl) phthalate (DEHP) on female fertility and adipogenesis in C3H/N mice. Environ. Health Perspect. 2012, 120, 1123–1129. [Google Scholar] [CrossRef] [PubMed]
- Lind, P.M.; Zethelius, B. Circulating levels of phthalate metabolites are associated with prevalent diabetes in the elderly. Diabetes Care 2012, 35, 1519–1524. [Google Scholar] [CrossRef] [PubMed]
- Corrales, J.; Kristofco, L.A. Global assessment of bisphenol A in the environment. Dose Response 2015, 13, 1559325815598308. [Google Scholar] [CrossRef]
- Kim, T.S.; Yoon, C.Y. In vitro study of Organization for Economic Co-Operation and Development (OECD) endocrine disruptor screening and testing methods-establishment of a recombinant rat androgen receptor (rrAR) binding assay. J. Toxicol. Sci. 2010, 35, 239–243. [Google Scholar] [CrossRef]
- Li, M.; Wu, C.; Guo, H. Mangiferin improves hepatic damage-associated molecular patterns, lipid metabolic disorder and mitochondrial dysfunction in alcohol hepatitis rats. Food Funct. 2019, 10, 3514–3534. [Google Scholar] [CrossRef]
- Saka, W.A.; Akhigbe, R.E. Suppression of uric acid generation and blockade of glutathione dysregulation by L-arginine ameliorates dichlorvos-induced oxidative hepatorenal damage in rats. Biomed. Pharmacother. 2021, 138, 111443. [Google Scholar] [CrossRef]
- Ryzewski, J.; Roszkowski-Sliź, W. The action of thiols on lymphocyte membranes. Immunology 1976, 31, 145–149. [Google Scholar] [PubMed]
- Singal, A.K.; Jampana, S.C. Antioxidants as therapeutic agents for Liver disease. Liver Int. 2011, 31, 1432–1448. [Google Scholar] [CrossRef] [PubMed]
- Tiwari, D.; Vanage, G. Bisphenol A induces oxidative stress in bone marrow cells, lymphocytes, and reproductive organs of Holtzman rats. Int. J. Toxicol. 2017, 36, 142–152. [Google Scholar] [CrossRef] [PubMed]
- Valdecantos, M.P.; Pérez-Matute, P. Lipoic acid administration prevents nonalcoholic steatosis linked to long-term high-fat feeding by modulating mitochondrial function. J. Nutr. Biochem. 2012, 23, 1676–1684. [Google Scholar] [CrossRef] [PubMed]
- Cho, Y.J.; Park, S.B. Di-(2-ethylhexyl)-phthalate induces oxidative stress in human endometrial stromal cells in vitro. Mol. Cell. Endocrinol. 2015, 407, 9–17. [Google Scholar] [CrossRef] [PubMed]
- Spahis, S.; Delvin, E. Oxidative stress as a critical factor in nonalcoholic fatty liver disease pathogenesis. Antioxid. Redox Signal. 2017, 26, 519–541. [Google Scholar] [CrossRef]
- Videla, L.A.; Rodrigo, R. Oxidative stress-related parameters in the liver of non-alcoholic fatty liver disease patients. Clin. Sci. (Lond.) 2004, 106, 261–268. [Google Scholar] [CrossRef]
- Wang, Y.; Chen, B. Protective Effects of vitamin E against reproductive toxicity induced by di(2-ethylhexyl) phthalate via PPAR-Dependent Mechanisms. Toxicol. Mech. Methods 2017, 27, 551–559. [Google Scholar] [CrossRef]
- Zhang, W.; Shen, X.Y. Di-(2-ethylhexyl) phthalate could disrupt the insulin signaling pathway in liver of SD rats and L02 cells via PPARγ. Toxicol. Appl. Pharmacol. 2017, 316, 17–26. [Google Scholar] [CrossRef]
- Smerieri, A.; Testa, C. Di-(2-ethylhexyl) phthalate metabolites in urine show age-related changes and associations with adiposity and parameters of insulin sensitivity in childhood. PLoS ONE 2015, 10, e0117831d. [Google Scholar] [CrossRef]
- Menale, C.; Grandone, A. Bisphenol A is associated with insulin resistance and modulates adiponectin and resistin gene expression in obese children. Pediatr. Obes. 2017, 12, 380–387. [Google Scholar] [CrossRef]
- Hirsch, E.; Costa, C.; Ciraolo, E. Phosphoinositide 3-kinases as a common platform for multi-hormone signaling. J. Endocrinol. 2007, 194, 243–256. [Google Scholar] [CrossRef] [PubMed]
- Kane, S.; Sano, H. A method to identify serine kinase substrates: Akt phosphorylates a novel adipocyte protein with a Rab GTPase-activating protein (GAP) domain. J. Biol. Chem. 2002, 277, 22115–22118. [Google Scholar] [CrossRef] [PubMed]
- Tan, K.; Kimber, W.A. Analysis of genetic variation in Akt2/PKB-beta in severe insulin resistance, lipodystrophy, type 2 diabetes, and related metabolic phenotypes. Diabetes 2007, 56, 714–719. [Google Scholar] [CrossRef] [PubMed]
Group | No. Neonates | Litter Size ( ± SD) | Gender (M/M + F) | |
---|---|---|---|---|
control | PND7 PND21 PND56 | 21/21 | 14.2 ± 1.3 | 10/21 |
18/18 | 13.5 ± 1.2 | 8/18 | ||
16/16 | 14.1 ± 1.0 | 8/16 | ||
BPA | PND7 PND21 PND56 | 18/20 | 12.8 ± 0.2 | 9/18 |
17/17 | 12.2 ± 0.2 | 8/17 | ||
14/16 | 12.3 ± 0.3 | 7/7 | ||
DEHP | PND7 PND21 PND56 | 14/16 | 11.8 ± 0.7 | 7/7 |
17/17 | 11.5 ± 1.3 | 8/9 | ||
14/16 | 11.7 ± 1.5 | 7/7 | ||
BPA + DEHP | PND7 PND21 PND56 | 24/28 | 11.0 ± 0.7 | 12/12 |
22/24 | 10.6 ± 0.7 | 10/12 | ||
18/20 | 10.9 ± 0.3 | 9/9 |
Target Gene Orientation | Primer Sequence 5′–3′ | Product Size (bp) |
---|---|---|
IRS2 Forward Primer Reverse Primer | CAGCACCTACGCAAGCATCG GCCCGCCAGCACTTTACTCTTTC | 80 |
PI3K Forward Primer Reverse Primer | AAAACCGGCCAGCTCTTCCA CTTCACAGCACTGGCGGAAC | 178 |
AKT Forward Primer Reverse Primer | ATGGACTTCCGGTCAGGTTCA GCCCTTGCCCAGTAGCTTCA | 126 |
FOXO1 Forward Primer Reverse Primer | TCGGAACGACCTCATGGACG ATGTTGCCTGCTCACTAACTCCT | 136 |
Time (min) | Mobile Phase A (%) | Mobile Phase B (%) |
---|---|---|
1 min | 5 | 95 |
1.01 min | 35 | 65 |
15 min | 90 | 10 |
16 min | 90 | 10 |
16.01 min | 5 | 95 |
17 min | 5 | 95 |
NAME | Molecular | TR (min) | MS (m/z) | ppm | Ion Mode | Calculate Mass | Production | Formula |
---|---|---|---|---|---|---|---|---|
BPA | 228.12 | 2.62 | 227.11 | −4.8 | M-H | 227.11 | 133.07/212.09 | C15H16O2 |
BPA-G | 404.15 | 2.61 | 403.14 | −2.7 | M-H | 403.14 | 227.11/175.03 | C21H24O8 |
GlcA-BPA-OH | 420.14 | 2.56 | 419.14 | 4.8 | M-H | 419.13 | 243.10/175.03 | C21H24O9 |
BPA-OH | 244.11 | 2.44 | 243.10 | −3.7 | M-H | 243.10 | ND | C15H16O3 |
DEHP | 390.28 | 6.95 | 389.27 | −4.1 | M-H | 389.27 | 146.97 | C24H38O4 |
MEHP | 278.15 | 3.63 | 277.15 | 5.1 | M-H | 277.14 | 146.97 | C16H22O4 |
5OH-MEHP | 294.15 | 3.13 | 293.14 | 5.5 | M-H | 293.14 | 121.03/146.97 | C16H22O5 |
5oxo-MEHP | 292.13 | 3.10 | 291.13 | 4.5 | M-H | 291.12 | 121.03/146.97 | C16H20O5 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, M.; Wang, Y.; Han, J.; Duan, Z.; Yin, J.; Ding, R.; Wang, Q. Gestational and Lactational Co-Exposure to DEHP and BPA Impairs Hepatic Function via PI3K/AKT/FOXO1 Pathway in Offspring. Toxics 2023, 11, 216. https://doi.org/10.3390/toxics11030216
Wang M, Wang Y, Han J, Duan Z, Yin J, Ding R, Wang Q. Gestational and Lactational Co-Exposure to DEHP and BPA Impairs Hepatic Function via PI3K/AKT/FOXO1 Pathway in Offspring. Toxics. 2023; 11(3):216. https://doi.org/10.3390/toxics11030216
Chicago/Turabian StyleWang, Minghan, Yu Wang, Junyuan Han, Zhiwen Duan, Jiye Yin, Rigao Ding, and Quanjun Wang. 2023. "Gestational and Lactational Co-Exposure to DEHP and BPA Impairs Hepatic Function via PI3K/AKT/FOXO1 Pathway in Offspring" Toxics 11, no. 3: 216. https://doi.org/10.3390/toxics11030216
APA StyleWang, M., Wang, Y., Han, J., Duan, Z., Yin, J., Ding, R., & Wang, Q. (2023). Gestational and Lactational Co-Exposure to DEHP and BPA Impairs Hepatic Function via PI3K/AKT/FOXO1 Pathway in Offspring. Toxics, 11(3), 216. https://doi.org/10.3390/toxics11030216