Effects of Black Soldier Fly Larvae Hydrolysate on Culture of Primary Myogenic and Adipogenic Cells Isolated from Broilers for Cultured Meat Development
Abstract
1. Introduction
2. Materials and Methods
2.1. Preparation of Black Soldier Fly Larvae Hydrolysate (BLH)
2.2. Isolation of Primary Cells (Muscle Cells, Stromal Vascular Fractions (SVF)) from Chicken Tissues (Breast, Leg, and Abdominal Fat)
2.3. Pre-Plating of Primary Cells Isolated from Chicken Breast and Leg Muscle Tissues
2.4. Culturing and Imaging of Chicken Leg- and Breast-Derived Myogenic Cells and SVFs
2.5. Cell Counting and Viability Measurement
2.6. Cell Proliferation Assay (MTS)
2.7. Oil Red O Staining and Quantification
2.8. Nile Red Staining
2.9. RT-qPCR
2.10. Statistical Analysis
2.11. Ethics Approvals
3. Results and Discussion
3.1. Purification of Myogenic Cells Through Pre-Plating
3.2. Proliferation of Pre-Plated Chicken Leg- and Breast-Derived Primary Myogenic Cells Induced by BLH
3.3. Confirmation of Differentiation from SVF Cells to Adipocytes and the Proliferation and Differentiation of Chicken SVFs Induced by BLH
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- OECD/FAO. OECD-FAO Agricultural Outlook 2015–2024; OECD/FAO: Paris, France, 2015. [Google Scholar]
- Godber, O.F.; Wall, R. Livestock and food security: Vulnerability to population growth and climate change. Glob. Change Biol. 2014, 20, 3092–3102. [Google Scholar] [CrossRef]
- Post, M.J.; Levenberg, S.; Kaplan, D.L.; Genovese, N.; Fu, J.; Bryant, C.J.; Negowetti, N.; Verzijden, K.; Moutsatsou, P. Scientific, sustainability and regulatory challenges of cultured meat. Nat. Food 2020, 1, 403–415. [Google Scholar] [CrossRef]
- Tuomisto, H.L. The eco-friendly burger: Could cultured meat improve the environmental sustainability of meat products? EMBO Rep. 2019, 20, e47395. [Google Scholar] [CrossRef] [PubMed]
- Post, M.J. Cultured meat from stem cells: Challenges and prospects. Meat Sci. 2012, 92, 297–301. [Google Scholar] [CrossRef] [PubMed]
- Bhat, Z.F.; Kumar, S.; Bhat, H.F. In vitro meat: A future animal-free harvest. Crit. Rev. Food Sci. Nutr. 2017, 57, 782–789. [Google Scholar] [CrossRef] [PubMed]
- Sogore, T.; Guo, M.; Sun, N.; Jiang, D.; Shen, M.; Ding, T. Microbiological and chemical hazards in cultured meat and methods for their detection. Compr. Rev. Food Sci. Food Saf. 2024, 23, e13392. [Google Scholar] [CrossRef]
- Baum, C.M.; Feistl, A.-L.; Kamrath, C. Cultivated meat–Will all vegetarians say ‘No thanks’? Berichte Landwirtsch. Z. Agrarpolit. Landwirtsch. 2022, 100, 1–11. [Google Scholar]
- Hartman, R.; Pilařova, L. Marketing positioning of cultivated meat. In Proceedings of the 31st International Scientific Conference, Prague, Czech Republic, 14–15 September 2022. [Google Scholar]
- Jiménez Rodríguez, A. Cultured meat, clean meat, … queer meat? A vegan queer ecofeminist perspective on the implications of cellular agriculture. Front. Sustain. Food Syst. 2023, 7, 1104731. [Google Scholar] [CrossRef]
- Cai, J.; Wang, S.; Li, Y.; Dong, S.; Liang, J.; Liu, Y.; Li, S. Industrialization progress and challenges of cultivated meat. J. Future Foods 2024, 4, 119–127. [Google Scholar] [CrossRef]
- Hubalek, S.; Post, M.J.; Moutsatsou, P. Towards resource-efficient and cost-efficient cultured meat. Curr. Opin. Food Sci. 2022, 47, 100885. [Google Scholar] [CrossRef]
- Stephens, N.; Di Silvio, L.; Dunsford, I.; Ellis, M.; Glencross, A.; Sexton, A. Bringing cultured meat to market: Technical, socio-political, and regulatory challenges in cellular agriculture. Trends Food Sci. Technol. 2018, 78, 155–166. [Google Scholar] [CrossRef]
- Eggink, K.M.; Lund, I.; Pedersen, P.B.; Hansen, B.W.; Dalsgaard, J. Biowaste and by-products as rearing substrates for black soldier fly (Hermetia illucens) larvae: Effects on larval body composition and performance. PLoS ONE 2022, 17, e0275213. [Google Scholar] [CrossRef] [PubMed]
- Rumpold, B.A.; Langen, N. Consumer acceptance of edible insects in an organic waste-based bioeconomy. Curr. Opin. Green Sustain. Chem. 2020, 23, 80–84. [Google Scholar] [CrossRef]
- Huang, C.; Feng, W.; Xiong, J.; Wang, T.; Wang, W.; Wang, C.; Yang, F. Impact of drying method on the nutritional value of the edible insect protein from black soldier fly (Hermetia illucens L.) larvae: Amino acid composition, nutritional value evaluation, in vitro digestibility, and thermal properties. Eur. Food Res. Technol. 2019, 245, 11–21. [Google Scholar] [CrossRef]
- Amrul, N.F.; Kabir Ahmad, I.; Ahmad Basri, N.E.; Suja, F.; Abdul Jalil, N.A.; Azman, N.A. A review of organic waste treatment using black soldier fly (Hermetia illucens). Sustainability 2022, 14, 4565. [Google Scholar] [CrossRef]
- Dreyer, S. An Evaluation on the Effects of Three Different Dietary Emulsifiers and the Use of Black Soldier Fly (Hermetia illucens) Larvae oil on Young Broiler Production. Doctoral Dissertation, Stellenbosch University, Stellenbosch, South Africa, 2021. [Google Scholar]
- Kim, T.-K.; Yong, H.I.; Kim, Y.-B.; Kim, H.-W.; Choi, Y.-S. Edible insects as a protein source: A review of public perception, processing technology, and research trends. Food Sci. Anim. Resour. 2019, 39, 521. [Google Scholar] [CrossRef] [PubMed]
- Mouithys-Mickalad, A.; Schmitt, E.; Dalim, M.; Franck, T.; Tome, N.M.; van Spankeren, M.; Serteyn, D.; Paul, A. Black soldier fly (Hermetia illucens) larvae protein derivatives: Potential to promote animal health. Animals 2020, 10, 941. [Google Scholar] [CrossRef] [PubMed]
- Xu, X.; Ji, H.; Yu, H.; Zhou, J. Influence of dietary black soldier fly (Hermetia illucens Linnaeus) pulp on growth performance, antioxidant capacity and intestinal health of juvenile mirror carp (Cyprinus carpio var. specularis). Aquac. Nutr. 2020, 26, 432–443. [Google Scholar] [CrossRef]
- European Union. Regulation (EU) 2015/2283 of the European Parliament and of the Council on Novel Foods; European Union: Brussels, Belgium, 2015; Volume L327, pp. 1–22. [Google Scholar]
- Ministry of Agriculture, F.; Affairs, R. Comprehensive Plan for Promoting the Insect Industry; Ministry of Agriculture, Food and Rural Affairs: Sejong-si, Republic of Korea, 2023. [Google Scholar]
- Halonen, V.; Uusitalo, V.; Levänen, J.; Sillman, J.; Leppäkoski, L.; Claudelin, A. Recognizing potential pathways to increasing the consumption of edible insects from the perspective of consumer acceptance: Case study from finland. Sustainability 2022, 14, 1439. [Google Scholar] [CrossRef]
- Batish, I.; Brits, D.; Valencia, P.; Miyai, C.; Rafeeq, S.; Xu, Y.; Galanopoulos, M.; Sismour, E.; Ovissipour, R. Effects of enzymatic hydrolysis on the functional properties, antioxidant activity and protein structure of black soldier fly (Hermetia illucens) protein. Insects 2020, 11, 876. [Google Scholar] [CrossRef] [PubMed]
- Garg, P. Serum-Free Media Development Using Black Soldier Fly Protein Isolate and Hydrolysate for Cultivated Meat. Doctoral Dissertation, Food Science and Technology, Virginia Polytechnic Institute and State University, Virginia Tech, Blacksburg, VA, USA, 2024. [Google Scholar]
- Abduh, M.Y.; Prawitasari, D.A.; Fitrian, U.A.; Firmansyah, M. Effects of enzymatic hydrolysis on the antioxidant activity of protein hydrolysate derived from the larvae of black soldier fly (Hermetia illucens). J. Appl. Biol. Biotechnol. 2023, 11, 151–157. [Google Scholar] [CrossRef]
- Oh, J.H.; Karadeniz, F.; Yang, J.; Lee, H.; Choi, M.-N.; Jeon, S.; Park, G.; Kim, J.; Park, K.; Kong, C.-S. Antioxidant, anti-inflammatory, anti-adipogenesis activities and proximate composition of Hermetia illucens larvae reared on food waste enriched with different wastes. J. Anim. Sci. Technol. 2023, 66, 1034. [Google Scholar] [CrossRef]
- Riolo, K.; Rotondo, A.; La Torre, G.L.; Marino, Y.; Franco, G.A.; Crupi, R.; Fusco, R.; Di Paola, R.; Oliva, S.; De Marco, G. Cytoprotective and antioxidant effects of hydrolysates from black soldier fly (Hermetia illucens). Antioxidants 2023, 12, 519. [Google Scholar] [CrossRef]
- Obaidi, I.; Mota, L.M.; Quigley, A.; Butler, M. The role of protein hydrolysates in prolonging viability and enhancing antibody production of CHO cells. Appl. Microbiol. Biotechnol. 2021, 105, 3115–3129. [Google Scholar] [CrossRef]
- Batish, I.; Zarei, M.; Nitin, N.; Ovissipour, R. Evaluating the potential of marine invertebrate and insect protein hydrolysates to reduce fetal bovine serum in cell culture media for cultivated fish production. Biomolecules 2022, 12, 1697. [Google Scholar] [CrossRef]
- Iram, S.; Akash, A.; Kathera, C.S.; Park, K.W.; Cho, Y.S.; Kim, J. Serum markers for beef meat quality: Potential media supplement for cell-cultured meat production. Curr. Res. Food Sci. 2024, 10, 100943. [Google Scholar] [CrossRef] [PubMed]
- Park, J.Y.; Kwak, K.-W.; Choi, J.-Y.; Lee, S.-E.; Kim, Y.-S.; Koo, B.; Kim, E.; Park, K.; Kim, S.Y. Ethanol extract of Hermetia illucens larvae inhibits adipogenesis in 3T3-L1 adipocytes. J. Life Sci. 2021, 31, 1094–1099. [Google Scholar]
- Zhu, D.; Huang, X.; Tu, F.; Wang, C.; Yang, F. Preparation, antioxidant activity evaluation, and identification of antioxidant peptide from black soldier fly (Hermetia illucens L.) larvae. J. Food Biochem. 2020, 44, e13186. [Google Scholar] [CrossRef]
- Park, S.; Park, G.; Oh, S.; Park, Y.; Kim, Y.; Kim, J.; Choi, J. Investigating proliferation and differentiation capacities of Hanwoo steer myosatellite cells at different passages for developing cell-cultured meat. Sci. Rep. 2023, 13, 15614. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Richler, C.; Yaffe, D. The in vitro cultivation and differentiation capacities of myogenic cell lines. Dev. Biol. 1970, 23, 1–22. [Google Scholar] [CrossRef] [PubMed]
- Rozo, M.; Li, L.; Fan, C.-M. Targeting β1-integrin signaling enhances regeneration in aged and dystrophic muscle in mice. Nat. Med. 2016, 22, 889–896. [Google Scholar] [CrossRef] [PubMed]
- Dohmen, R.G.; Hubalek, S.; Melke, J.; Messmer, T.; Cantoni, F.; Mei, A.; Hueber, R.; Mitic, R.; Remmers, D.; Moutsatsou, P. Muscle-derived fibro-adipogenic progenitor cells for production of cultured bovine adipose tissue. npj Sci. Food 2022, 6, 6. [Google Scholar] [CrossRef] [PubMed]
- Yoshioka, K.; Kitajima, Y.; Okazaki, N.; Chiba, K.; Yonekura, A.; Ono, Y. A modified pre-plating method for high-yield and high-purity muscle stem cell isolation from human/mouse skeletal muscle tissues. Front. Cell Dev. Biol. 2020, 8, 793. [Google Scholar] [CrossRef] [PubMed]
- Nascimento, C.S.; Barbosa, L.T.; Brito, C.; Fernandes, R.P.; Mann, R.S.; Pinto, A.P.G.; Oliveira, H.C.; Dodson, M.V.; Guimarães, S.E.; Duarte, M.S. Identification of suitable reference genes for real time quantitative polymerase chain reaction assays on pectoralis major muscle in chicken (Gallus gallus). PLoS ONE 2015, 10, e0127935. [Google Scholar] [CrossRef] [PubMed]
- Bagés, S.; Estany, J.; Tor, M.; Pena, R. Investigating reference genes for quantitative real-time PCR analysis across four chicken tissues. Gene 2015, 561, 82–87. [Google Scholar] [CrossRef]
- Ho, Y.Y.; Lu, H.K.; Lim, Z.F.S.; Lim, H.W.; Ho, Y.S.; Ng, S.K. Applications and analysis of hydrolysates in animal cell culture. Bioresour. Bioprocess. 2021, 8, 93. [Google Scholar] [CrossRef] [PubMed]
- Kozakowska, M.; Pietraszek-Gremplewicz, K.; Jozkowicz, A.; Dulak, J. The role of oxidative stress in skeletal muscle injury and regeneration: Focus on antioxidant enzymes. J. Muscle Res. Cell Motil. 2015, 36, 377–393. [Google Scholar] [CrossRef]
- Lv, R.; Dong, Y.; Bao, Z.; Zhang, S.; Lin, S.; Sun, N. Advances in the activity evaluation and cellular regulation pathways of food-derived antioxidant peptides. Trends Food Sci. Technol. 2022, 122, 171–186. [Google Scholar] [CrossRef]
- Ljunggren, J.; Häggström, L. Catabolic control of hybridoma cells by glucose and glutamine limited fed batch cultures. Biotechnol. Bioeng. 1994, 44, 808–818. [Google Scholar] [CrossRef]
- Ha, T.K.; Lee, G.M. Effect of glutamine substitution by TCA cycle intermediates on the production and sialylation of Fc-fusion protein in Chinese hamster ovary cell culture. J. Biotechnol. 2014, 180, 23–29. [Google Scholar] [CrossRef] [PubMed]
- Christie, A.; Butler, M. The adaptation of bhk cells to a non-ammoniagenic glutamate-based culture medium. Biotechnol. Bioeng. 1999, 64, 298–309. [Google Scholar] [CrossRef]
- Freund, N.W.; Croughan, M.S. A simple method to reduce both lactic acid and ammonium production in industrial animal cell culture. Int. J. Mol. Sci. 2018, 19, 385. [Google Scholar] [CrossRef]
- Hara, K.; Yonezawa, K.; Weng, Q.-P.; Kozlowski, M.T.; Belham, C.; Avruch, J. Amino acid sufficiency and mTOR regulate p70 S6 kinase and eIF-4E BP1 through a common effector mechanism. J. Biol. Chem. 1998, 273, 14484–14494. [Google Scholar] [CrossRef] [PubMed]
- Spranghers, T.; Ottoboni, M.; Klootwijk, C.; Ovyn, A.; Deboosere, S.; De Meulenaer, B.; Michiels, J.; Eeckhout, M.; De Clercq, P.; De Smet, S. Nutritional composition of black soldier fly (Hermetia illucens) prepupae reared on different organic waste substrates. J. Sci. Food Agric. 2017, 97, 2594–2600. [Google Scholar] [CrossRef]
- Martins, B.; Bister, A.; Dohmen, R.G.; Gouveia, M.A.; Hueber, R.; Melzener, L.; Messmer, T.; Papadopoulos, J.; Pimenta, J.; Raina, D. Advances and challenges in cell biology for cultured meat. Annu. Rev. Anim. Biosci. 2024, 12, 345–368. [Google Scholar] [CrossRef]
- Darlington, G.J.; Ross, S.E.; MacDougald, O.A. The role of C/EBP genes in adipocyte differentiation. J. Biol. Chem. 1998, 273, 30057–30060. [Google Scholar] [CrossRef]
- Yang, M.; Wang, Q.; Zhu, Y.; Sheng, K.; Xiang, N.; Zhang, X. Cell culture medium cycling in cultured meat: Key factors and potential strategies. Trends Food Sci. Technol. 2023, 138, 564–576. [Google Scholar] [CrossRef]
- Zhang, G.; Zhao, X.; Li, X.; Du, G.; Zhou, J.; Chen, J. Challenges and possibilities for bio-manufacturing cultured meat. Trends Food Sci. Technol. 2020, 97, 443–450. [Google Scholar] [CrossRef]
- Biferali, B.; Proietti, D.; Mozzetta, C.; Madaro, L. Fibro–adipogenic progenitors cross-talk in skeletal muscle: The social network. Front. Physiol. 2019, 10, 1074. [Google Scholar] [CrossRef]
- Ito, N.; Kii, I.; Shimizu, N.; Tanaka, H.; Takeda, S. Direct reprogramming of fibroblasts into skeletal muscle progenitor cells by transcription factors enriched in undifferentiated subpopulation of satellite cells. Sci. Rep. 2017, 7, 8097. [Google Scholar] [CrossRef]










| Primer | Description | Direction | Sequence (5′-3′) |
|---|---|---|---|
| PDGFRA | Platelet-derived growth factor receptor alpha | F | GAGCTTGGCAAAAGGAACAG |
| R | GATCCGAGGAGTCAATTCCA | ||
| ITGB1 | Integrin subunit beta 1 | F | AGTGGTATGATGCCAAGGAA |
| R | GTTTCCATCCTCTCCCATCT | ||
| MYOD1 | Myogenic differentiation 1 | F | TATTACCCCTGTTCTGGCCA |
| R | GCACAACAAACCAAGCAACA | ||
| PAX7 | Paired box 7 | F | CAGGTGGAACCTCACCATAG |
| R | AGGTGGGAGGACAGTAGGAC | ||
| NCAM1 | Neural cell adhesion molecule 1 | F | TTCCATCACGTGGAAAACTT |
| R | CTTGGGAGCATACTGCACTT | ||
| MYF5 | Myogenic factor 5 | F | AGATGGAGGTGATGGACAGC |
| R | GGACGTGTTCCTCTTCCTCA | ||
| CEBPB | CCAAT enhancer binding protein beta | F | GACAAGCACAGCGACGAGTA |
| R | CACCTTCTTCTGCAGCCTCT | ||
| ACTB | Actin beta | F | AATGGCTCCGGTATGTGCAA |
| R | GGCCCATACCAACCATCACA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Park, S.-H.; Oh, S.-H.; Park, G.-T.; Jang, S.-Y.; Lim, Y.-H.; Oh, S.-K.; Lee, T.-H.; Lee, S.-H.; Kim, J.-H.; Choi, J.-S. Effects of Black Soldier Fly Larvae Hydrolysate on Culture of Primary Myogenic and Adipogenic Cells Isolated from Broilers for Cultured Meat Development. Foods 2025, 14, 678. https://doi.org/10.3390/foods14040678
Park S-H, Oh S-H, Park G-T, Jang S-Y, Lim Y-H, Oh S-K, Lee T-H, Lee S-H, Kim J-H, Choi J-S. Effects of Black Soldier Fly Larvae Hydrolysate on Culture of Primary Myogenic and Adipogenic Cells Isolated from Broilers for Cultured Meat Development. Foods. 2025; 14(4):678. https://doi.org/10.3390/foods14040678
Chicago/Turabian StylePark, Sang-Hun, Se-Hyuk Oh, Gyu-Tae Park, So-Young Jang, Young-Ho Lim, Sung-Kyun Oh, Tae-Hyung Lee, Sol-Hee Lee, Jong-Hyuk Kim, and Jung-Seok Choi. 2025. "Effects of Black Soldier Fly Larvae Hydrolysate on Culture of Primary Myogenic and Adipogenic Cells Isolated from Broilers for Cultured Meat Development" Foods 14, no. 4: 678. https://doi.org/10.3390/foods14040678
APA StylePark, S.-H., Oh, S.-H., Park, G.-T., Jang, S.-Y., Lim, Y.-H., Oh, S.-K., Lee, T.-H., Lee, S.-H., Kim, J.-H., & Choi, J.-S. (2025). Effects of Black Soldier Fly Larvae Hydrolysate on Culture of Primary Myogenic and Adipogenic Cells Isolated from Broilers for Cultured Meat Development. Foods, 14(4), 678. https://doi.org/10.3390/foods14040678

