Effects of Lacticaseibacillus paracasei L9 on Oral Microbiota and Cariogenic Factors in Streptococcus mutans-Infected Mice
Abstract
:1. Introduction
2. Materials and Methods
2.1. Bacterial Strains and Culture Conditions
2.2. Animals and Experimental Procedure
2.3. Dental Caries Scores
2.4. Oral Microbial Counting
2.5. RT-qPCR for Gene Expressions of Dental Biofilms
2.6. S rRNA Gene Sequencing of Dental Plaques
2.7. Biofilm Formation Assay
2.8. SEM Observation of Biofilms
2.9. Statistical Analysis
3. Results
3.1. Dental Caries Scores
3.2. Quantification of Caries-Causing Factors
3.3. Effects of L9 and K12 on Oral Microbial Community
3.4. Biofilm Staining
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Baker, J.L.; Edlund, A. Exploiting the oral microbiome to prevent tooth decay: Has evolution already provided the best Tools? Front. Microbiol. 2019, 9, 3323. [Google Scholar] [CrossRef] [PubMed]
- Bowen, W.H.; Burne, R.A.; Wu, H.; Koo, H. Oral biofilms: Pathogens, matrix, and polymicrobial interactions in microenvironments. Trent Microbiol. 2018, 26, 229–242. [Google Scholar] [CrossRef] [PubMed]
- Li, Z.; Fu, R.; Huang, X.; Wen, X.; Zhang, L. A decade of progress: Bibliometric analysis of trends and hotspots in oral microbiome research (2013–2022). Front. Cell Infect. Microbiol. 2023, 13, 1195127. [Google Scholar] [CrossRef] [PubMed]
- He, X.S.; Shi, W.Y. Oral microbiology: Past, present and future. Int. J. Oral Sci. 2009, 1, 47–58. [Google Scholar] [CrossRef]
- Takahashi, N.; Nyvad, B. Caries ecology revisited: Microbial dynamics and the caries process. Caries Res. 2008, 42, 409–418. [Google Scholar] [CrossRef]
- Klinke, T.; Kneist, S.; de Soet, J.J.; Kuhlisch, E.; Mauersberger, S.; Förster, A.; Klimm, W. Acid production by oral strains of Candida albicans and Lactobacilli. Caries Res. 2009, 43, 83–91. [Google Scholar] [CrossRef]
- Marchant, S.; Brailsford, S.R.; Twomey, A.C.; Roberts, G.J.; Beighton, D. The predominant microflora of nursing caries lesions. Caries Res. 2001, 35, 397–406. [Google Scholar] [CrossRef]
- Raja, M.; Hannan, A.; Ali, K. Association of oral candidal carriage with dental caries in children. Caries Res. 2010, 44, 272–276. [Google Scholar] [CrossRef]
- Luo, A.H.; Yang, D.Q.; Xin, B.C.; Paster, B.J.; Qin, J. Microbial profiles in saliva from children with and without caries in mixed dentition. Oral Dis. 2012, 18, 595–601. [Google Scholar] [CrossRef]
- Frencken, J.E.; Sharma, P.; Stenhouse, L.; Green, D.; Laverty, D.; Dietrich, T. Global epidemiology of dental caries and severe periodontitis—A comprehensive review. J. Clin. Periodontol. 2017, 44, S94–S105. [Google Scholar] [CrossRef]
- Sivamaruthi, B.S.; Kesika, P.; Chaiyasut, C. A review of the role of probiotic supplementation in dental caries. Probiotics Antimicrob. Proteins 2020, 12, 1300–1309. [Google Scholar] [CrossRef] [PubMed]
- Inchingolo, F.; Inchingolo, A.M.; Malcangi, G.; De Leonardis, N.; Sardano, R.; Pezzolla, C.; de Ruvo, E.; Di Venere, D.; Palermo, A.; Inchingolo, A.D.; et al. The benefits of probiotics on oral health: Systematic review of the literature. Pharmaceuticals 2023, 16, 1313. [Google Scholar] [CrossRef] [PubMed]
- Fejerskov, O. Changing paradigms in concepts on dental caries: Consequences for oral health care. Caries Res. 2004, 38, 182–191. [Google Scholar] [CrossRef] [PubMed]
- Nozari, A.; Motamedifar, M.; Seifi, N.; Hatamizargaran, Z.; Ranjbar, M.A. The effect of iranian customary used probiotic yogurt on the children’s salivary cariogenic microflora. J. Dent. 2015, 16, 81–86. [Google Scholar]
- Brignone, D.; Radmann, P.; Behr, J.; Vogel, R.F. Boosting the growth of the probiotic strain Lactobacillus paracasei ssp. paracasei F19. Arch. Microbiol. 2017, 199, 853–862. [Google Scholar] [CrossRef]
- Keyes, P.H. Dental caries in the molar teeth of rats. J. Dent. Res. 1958, 37, 1088–1099. [Google Scholar] [CrossRef]
- Salli, K.M.; Forssten, S.D.; Lahtinen, S.J.; Ouwehand, A.C. Influence of sucrose and xylitol on an early Streptococcus mutans biofilm in a dental simulator. Arch. Oral Biol. 2016, 70, 39–46. [Google Scholar] [CrossRef]
- Wu, D. The Dynamic Changes of Virulence Factors and Cariogenic Bacteria in Plaque Biofilms with the Development of Dental Caries. Master’s Thesis, Zunyi Medical University, Zunyi, China, 2011. [Google Scholar]
- Merritt, J.; Qi, F.; Goodman, S.D.; Anderson, M.H.; Shi, W. Mutation of luxS affects biofilm formation in Streptococcus mutans. Infect. Immun. 2003, 71, 1972–1979. [Google Scholar] [CrossRef]
- Tsang, P.; Merritt, J.; Shi, W.; Qi, F. IrvA-dependent and irvA-independent pathways for mutacin gene regulation in Streptococcus mutans. FEMS Microbiol. Lett. 2006, 261, 231–234. [Google Scholar] [CrossRef]
- Yousefi, B.; Ghaderi, S.; Rezapoor-Lactooyi, A.; Amiri, N.; Verdi, J.; Shoae-Hassani, A. Hydroxy decenoic acid down regulates gtfB and gtfC expression and prevents Streptococcus mutans adherence to the cell surfaces. Ann. Clin. Microbiol. Antimicrob. 2012, 11, 21. [Google Scholar] [CrossRef]
- Lima, B.D.; de Lira, S.P.; Kossuga, M.H.; Goncalves, R.B.; Berlinck, R.G.S.; Kamiya, R.U. Halistanol sulfate A and rodriguesines A and B are antimicrobial and antibiofilm agents against the cariogenic bacterium Streptococcus mutans. Rev. Bras. Farmacogn. 2014, 24, 651–659. [Google Scholar] [CrossRef]
- Mattos-Graner, R.O.; Napimoga, M.H.; Fukushima, K.; Duncan, M.J.; Smith, D.J. Comparative analysis of Gtf isozyme production and diversity in isolates of Streptococcus mutans with different biofilm growth phenotypes. J. Clin. Microbiol. 2004, 42, 4586–4592. [Google Scholar] [CrossRef] [PubMed]
- Cury, J.A.; Koo, H. Extraction and purification of total RNA from Sreptococcus mutans biofilms. Anal. Biochem. 2007, 365, 208–214. [Google Scholar] [CrossRef] [PubMed]
- Köchl, S.; Niederstätter, H.; Parson, W. DNA extraction and quantitation of forensic samples using the phenol-chloroform method and real-time PCR. Methods Mol. Biol. 2005, 297, 13–30. [Google Scholar]
- Zheng, Y.; Wu, F.; Zhang, M.; Fang, B.; Zhao, L.; Dong, L.; Zhou, X.; Ge, S. Hypoglycemic effect of camel milk powder in type 2 diabetic patients: A randomized, double-blind, placebo-controlled trial. Food Sci. Nutr. 2021, 9, 4461–4472. [Google Scholar] [CrossRef]
- Zhang, J.; Wang, Q.; Duan, Z. Preventive effects of probiotics on dental caries in vitro and in vivo. BMC Oral Health 2024, 24, 915. [Google Scholar] [CrossRef]
- Zhang, Q.; Qin, S.; Xu, X.; Zhao, J.; Zhang, H.; Liu, Z.; Chen, W.; Deng, W. Inhibitory effect of Lactobacillus plantarum CCFM8724 towards Streptococcus mutans- and Candida albicans-Induced caries in rats. Oxid. Med. Cell Longev. 2020, 2020, 4345804. [Google Scholar] [CrossRef]
- Jung, H.-Y.; Cai, J.-N.; Yoo, S.C.; Kim, S.-H.; Jeon, J.-G.; Kim, D. Collagen peptide in a combinatorial treatment with Lactobacillus rhamnosus inhibits the cariogenic properties of Streptococcus mutans: An in vitro study. Int. J. Mol. Sci. 2022, 23, 1860. [Google Scholar] [CrossRef]
- Zhao, Z.; Wu, J.; Sun, Z.; Fan, J.; Liu, F.; Zhao, W.; Liu, W.-H.; Zhang, M.; Hung, W.-L. Postbiotics derived from L. paracasei ET-22 inhibit the formation of S. mutans biofilms and bioactive Substances: An analysis. Molecules 2023, 28, 1236. [Google Scholar] [CrossRef]
- Wattanarat, O.; Nirunsittirat, A.; Piwat, S.; Manmontri, C.; Teanpaisan, R.; Pahumunto, N.; Makeudom, A.; Sastraruji, T.; Krisanaprakornkit, S. Significant elevation of salivary human neutrophil peptides 1-3 levels by probiotic milk in preschool children with severe early childhood caries: A randomized controlled trial. Clin. Oral Investig. 2020, 25, 2891–2903. [Google Scholar] [CrossRef]
- Żyła, T.; Kawala, B.; Antoszewska-Smith, J.; Kawala, M. Black stain and dental caries: A review of the literature. BioMed. Res. Int. 2015, 2015, 469392. [Google Scholar] [CrossRef] [PubMed]
- Teanpaisan, R.; Piwat, S.; Tianviwat, S.; Sophatha, B.; Kampoo, T. Effect of long-term consumption of Lactobacillus paracasei SD1 on reducing mutans streptococci and caries risk: A randomized placebo-controlled trial. Dent. J. 2015, 3, 43–54. [Google Scholar] [CrossRef] [PubMed]
- Mantzourani, I.; Terpou, A.; Bekatorou, A.; Mallouchos, A.; Alexopoulos, A.; Kimbaris, A.; Bezirtzoglou, E.; Koutinas, A.A.; Plessas, S. Functional pomegranate beverage production by fermentation with a novel synbiotic L. paracasei biocatalyst. Food Chem. 2020, 308, 125658. [Google Scholar] [CrossRef] [PubMed]
- Zheng, Y.; Yang, Y.; Liu, X.; Liu, P.; Li, X.; Zhang, M.; Zhou, E.; Zhao, Z.; Wang, X.; Zhang, Y.; et al. Accelerated corrosion of 316L stainless steel in a simulated oral environment via extracellular electron transfer and acid metabolites of subgingival microbiota. Bioact. Mater. 2024, 35, 56–66. [Google Scholar] [CrossRef]
- Zheng, X.; Chen, L.; Zeng, W.; Liao, W.; Wang, Z.; Tian, X.; Fang, R.; Sun, Y.; Zhou, T. Antibacterial and anti-biofilm efficacy of Chinese dragon’s blood against Staphylococcus aureus isolated from infected wounds. Front. Microbiol. 2021, 12, 672943. [Google Scholar] [CrossRef]
- Zheng, T.; Jing, M.; Gong, T.; Yan, J.; Wang, X.; Xu, M.; Zhou, X.; Zeng, J.; Li, Y. Regulatory mechanisms of exopolysaccharide synthesis and biofilm formation in Streptococcus mutans. J. Oral Microbiol. 2023, 15, 2225257. [Google Scholar] [CrossRef]
- Zheng, S.; Bawazir, M.; Dhall, A.; Kim, H.-E.; He, L.; Heo, J.; Hwang, G. Implication of surface properties, bacterial motility, and hydrodynamic conditions on bacterial surface sensing and their initial adhesion. Front. Bioeng. Biotechnol. 2021, 9, 643722. [Google Scholar] [CrossRef]
- Hannig, C.; Hannig, M. The oral cavity-a key system to understand substratum-dependent bioadhesion on solid surfaces in man. Clin. Oral Investig. 2009, 13, 123–139. [Google Scholar] [CrossRef]
- Zou, P.; Liu, J.; Li, P.; Luan, Q. Antifungal activity, synergism with fluconazole or amphotericin B and potential mechanism of direct current against Candida albicans biofilms and persisters. Antibiotics 2024, 13, 521. [Google Scholar] [CrossRef]
- Zeng, Y.; Fadaak, A.; Alomeir, N.; Wu, T.T.; Rustchenko, E.; Qing, S.; Bao, J.; Gilbert, C.; Xiao, J. Lactobacillus plantarum disrupts S. mutans-C. albicans cross-kingdom biofilms. Front. Cell Infect. Microbiol. 2022, 12, 872012. [Google Scholar] [CrossRef]
- Zanetta, P.; Squarzanti, D.F.; di Coste, A.; Rolla, R.; Valletti, P.A.; Garzaro, M.; Dell’Era, V.; Amoruso, A.; Pane, M.; Azzimonti, B. In Vitro selection of Lactobacillus and Bifidobacterium probiotic strains for the management of oral pathobiont infections associated to systemic diseases. Int. J. Mol. Sci. 2022, 23, 16163. [Google Scholar] [CrossRef] [PubMed]
- Díaz-Garrido, N.; Lozano, C.P.; Kreth, J.; Giacaman, R.A.; McBain, A.J. Competition and caries on enamel of a dual-species biofilm model with Streptococcus mutans and Streptococcus sanguinis. Appl. Environ. Microbiol. 2020, 86, e01262-20. [Google Scholar] [CrossRef] [PubMed]
- Yuan, K.; Hou, L.; Jin, Q.; Niu, C.; Mao, M.; Wang, R.; Huang, Z. Comparative transcriptomics analysis of Streptococcus mutans with disruption of LuxS/AI-2 quorum sensing and recovery of methyl cycle. Arch. Oral Biol. 2021, 127, 105137. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Li, X.; Ling, J. Streptococcus gordonii LuxS/autoinducer-2 quorum-sensing system modulates the dual-species biofilm formation with Streptococcus mutans. J. Basic Microbiol. 2017, 57, 605–616. [Google Scholar] [CrossRef]
- Zhang, L.; Meng, Y.; Li, J.; Yu, J.; Mu, G.; Tuo, Y. Lactiplantibacillus plantarum Y42 in biofilm and planktonic states improves intestinal barrier integrity and modulates gut microbiota of Balb/c Mice. Foods 2022, 11, 1451. [Google Scholar] [CrossRef]
- Zhang, L.; Chen, X.; Ren, B.; Zhou, X.; Cheng, L. Helicobacter pylori in the oral cavity: Current evidence and potential survival strategies. Int. J. Mol. Sci. 2022, 23, 13646. [Google Scholar] [CrossRef]
- Zhu, J.; Chu, W.; Luo, J.; Yang, J.; He, L.; Li, J. Dental materials for oral microbiota dysbiosis: An update. Front. Cell Infect. Microbiol. 2022, 12, 900918. [Google Scholar] [CrossRef]
- Lozano, C.P.; Díaz-Garrido, N.; Kreth, J.; Giacaman, R.A. Streptococcus mutans and Streptococcus sanguinis expression of competition-related genes, under sucrose. Caries Res. 2019, 53, 194–203. [Google Scholar] [CrossRef]
- Wuri, G.; Liu, F.; Sun, Z.; Fang, B.; Zhao, W.; Hung, W.-L.; Liu, W.-H.; Zhang, X.; Wang, R.; Wu, F.; et al. Lactobacillus paracasei ET-22 and derived postbiotics reduce halitosis and modulate oral microbiome dysregulation–a randomized, double-blind placebo-controlled clinical trial. Food Funct. 2023, 14, 7335–7346. [Google Scholar] [CrossRef]
- Zumsteg, Z.S.; Luu, M.; Rosenberg, P.S.; Elrod, J.K.; Bray, F.; Vaccarella, S.; Gay, C.; Lu, D.J.; Chen, M.M.; Chaturvedi, A.K.; et al. Global epidemiologic patterns of oropharyngeal cancer incidence trends. J. Natl. Cancer Inst. 2023, 115, 1544–1554. [Google Scholar] [CrossRef]
- Zou, R.; Zhao, L.; Shen, D.; Wu, Y. TrkA serves as a virulence modulator in Porphyromonas gingivalis by maintaining heme acquisition and pathogenesis. Front. Cell Infect. Microbiol. 2022, 12, 1012316. [Google Scholar] [CrossRef] [PubMed]
- Ren, Z.; Chen, L.; Li, J.; Li, Y. Inhibition of Streptococcus mutans polysaccharide synthesis by molecules targeting glycosyltransferase activity. J. Oral Microbiol. 2016, 8, 31095. [Google Scholar] [CrossRef] [PubMed]
- Noda, M.; Sugihara, N.; Sugimoto, Y.; Hayashi, I.; Sugimoto, S.; Danshiitsoodol, N.; Sugiyama, M. Lactobacillus reuteri BM53-1 produces a compound that inhibits sticky glucan synthesis by Streptococcus mutans. Microorganisms 2021, 9, 1390. [Google Scholar] [CrossRef] [PubMed]
Number | Forward Primers (5′-3′) | Reverse Primers (5′-3′) | Product Length (bp) |
---|---|---|---|
B1 | AGCGTTGTCCGGATTTATTGG | AGCGTTGTCCGGATTTATTGG | 95 |
B2 | GCCTACAGCTCAGAGATGCTATTCT | GCCATACACCACTCATGAATTGA | 180 |
B3 | AGCAATGCAGCCATCTACAAAT | ACGAACTTTGCCGTTATTGTCA | 98 |
B4 | ACTGTTCCCCTTTTGGCTGTC | AACTTGCTTTGATGACTGTGGC | 93 |
B5 | TGTACCCCGTATCGTTCCTGTG | AAAGACTGGAGTTGCAATGTGAATA | 175 |
Primers | Forward Sequences (5′-3′) | Reverse Sequences (5′-3′) | Reference |
---|---|---|---|
spaP | TGATGTTGCTTCTTCTATGGAG | CAGGTTAGTGTATGTAAGCTGT | [18] |
luxs | CCCTATGTTCGCTTGATTGGGG | AGTCAATCATGCCGTCAATGCG | [19] |
ciaH | GCGAAGTGGAGTCAAAAACC | AACTCTCCAAGCGATTTTGC | [20] |
gtfB | CGAACAGCTTCTAATGGTGAAAAGCTT | TTGGCTGCATTGCTATCATCA | [21] |
gtfC | TGATTAACATGGATAACAGG | CCAAACTGTTAGTGATCAGA | [22] |
gtfD | CCAATATTCCGACAGCCTATG | TCACCATAATAAAGACGTGTAATTGAA | [23] |
ldh | CTTGATACTGCTCGTTTCCGTC | GAGTCACCATGTTCACCCAT | [18] |
recA | GCCTATGCTGCTGCTCTTG | TCACCAATATCTCCGTCAATCTC | [18] |
S. mutans | GCCTACAGCTCAGAGATGCTATTCT | GCCATACACCACTCATGAATTGA | This study |
Type of Index | Control | Model | L9 | K12 | p Value (Model–Control) | p Value (L9–Model) | p Value (K12–Model) |
---|---|---|---|---|---|---|---|
Sobs | 119.9 ± 62.915 | 102.57 ± 27.969 | 84.3 ± 36.314 | 128.33 ± 28.465 | 0.508 | 0.282 | 0.073 |
Shannon | 1.792 ± 0.261 | 1.662 ± 0.464 | 1.659 ± 0.277 | 1.966 ± 0.284 | 0.472 | 0.984 | 0.093 |
Simpson | 0.259 ± 0.052 | 0.344 ± 0.133 | 0.298 ± 0.111 | 0.241 ± 0.065 | 0.084 | 0.450 | 0.036 * |
Ace | 130.94 ± 65.275 | 125.28 ± 31.646 | 118.6 ± 39.195 | 161.83 ± 45.61 | 0.835 | 0.715 | 0.080 |
Chao | 132.71 ± 67.921 | 119.56 ± 29.068 | 106.95 ± 36.224 | 153.25 ± 32.305 | 0.639 | 0.458 | 0.036 * |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pu, X.; Fang, B.; Wu, J.; Zhao, Z.; Liu, Y.; Li, J.; Gao, H.; Wang, R.; Zhang, M. Effects of Lacticaseibacillus paracasei L9 on Oral Microbiota and Cariogenic Factors in Streptococcus mutans-Infected Mice. Foods 2024, 13, 4118. https://doi.org/10.3390/foods13244118
Pu X, Fang B, Wu J, Zhao Z, Liu Y, Li J, Gao H, Wang R, Zhang M. Effects of Lacticaseibacillus paracasei L9 on Oral Microbiota and Cariogenic Factors in Streptococcus mutans-Infected Mice. Foods. 2024; 13(24):4118. https://doi.org/10.3390/foods13244118
Chicago/Turabian StylePu, Xinyao, Bing Fang, Jianmin Wu, Zhi Zhao, Yue Liu, Jingyu Li, Haina Gao, Ran Wang, and Ming Zhang. 2024. "Effects of Lacticaseibacillus paracasei L9 on Oral Microbiota and Cariogenic Factors in Streptococcus mutans-Infected Mice" Foods 13, no. 24: 4118. https://doi.org/10.3390/foods13244118
APA StylePu, X., Fang, B., Wu, J., Zhao, Z., Liu, Y., Li, J., Gao, H., Wang, R., & Zhang, M. (2024). Effects of Lacticaseibacillus paracasei L9 on Oral Microbiota and Cariogenic Factors in Streptococcus mutans-Infected Mice. Foods, 13(24), 4118. https://doi.org/10.3390/foods13244118