Next Article in Journal
Preparation and Characterization of Calcium-Chelated Sea Cucumber Ovum Hydrolysate and the Inhibitory Effect on α-Amylase
Next Article in Special Issue
Effects of Purple-Fleshed Sweet Potato Lyophilized Powder on the Physicochemical Properties, Lactic Acid Bacteria Viability, Microstructure, and Textural Properties of Stirred Yogurt
Previous Article in Journal
Efficient Green Extraction of Nutraceutical Compounds from Nannochloropsis gaditana: A Comparative Electrospray Ionization LC-MS and GC-MS Analysis for Lipid Profiling
Previous Article in Special Issue
Bacteriocin Mining in Lactiplantibacillus pentosus PCZ4 with Broad-Spectrum Antibacterial Activity and Its Biopreservative Effects on Snakehead Fish
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effects of Lacticaseibacillus paracasei L9 on Oral Microbiota and Cariogenic Factors in Streptococcus mutans-Infected Mice

1
School of Food Science and Engineering, Tianjin University of Science and Technology, Tianjin 300457, China
2
Beijing Advanced Innovation Center for Food Nutrition and Human Health, College of Food Science & Nutritional Engineering, China Agricultural University, Beijing 100083, China
3
School of Food and Health, Beijing Technology and Business University, No. 11 Fucheng Road, Beijing 100024, China
*
Authors to whom correspondence should be addressed.
Foods 2024, 13(24), 4118; https://doi.org/10.3390/foods13244118
Submission received: 26 November 2024 / Revised: 14 December 2024 / Accepted: 17 December 2024 / Published: 19 December 2024
(This article belongs to the Special Issue Bio-Functional Properties of Lactic Acid Bacteria in Functional Foods)

Abstract

In the pathogenesis of dental caries, Streptococcus mutans (S. mutans) plays a central role. S. mutans can produce extracellular polysaccharides, which can help the bacteria form biofilms on the tooth surface, create a stable living environment, and hinder the removal of bacteria by natural defense substances in the oral cavity such as saliva. Meanwhile, the oral microbiota and dietary habits exert long-term influences on its development. This study, employing the BALB/c mouse model, explored the effects of L. paracasei L9 on dental caries. In the experiment, mice underwent the S. mutans inoculation and were subsequently treated with L. paracasei L9 or S. salivarius K12 for 28 consecutive days. The results showed that L. paracasei L9 significantly ameliorated early enamel caries, and both L. paracasei L9 and S. salivarius K12 cooperatively downregulated the expressions of critical cariogenic factors, effectively suppressing the initial adhesion of S. mutans and the formation of dental plaques. L. paracasei L9 reshaped the oral microbiota of caries-affected mice, selectively reducing pathogens abundances and augmenting abundances of probiotics such as Lactobacillaceae and Streptococcus salivarius. This study offers a strategic approach for the management of dental caries, highlighting the potential of these probiotics in the field of oral health.

Graphical Abstract

1. Introduction

Caries is a microbial-mediated oral disease that causes demineralization and destruction of tooth. The global epidemiological survey of oral health showed that dental caries and periodontal disease are the two most important factors for extraction or removal of tooth. Dental caries is the major cause for loosing tooth in early childhood [1]. It has been listed by the World Health Organization as the third major chronic non-communicable disease after cancer and cardiovascular diseases.
Dental caries is a polymicrobial biofilm disease driven by microbiota–matrix interactions that occur on a tooth surface [2]. Mature dental plaque biofilm is composed of various bacteria embedded encapsulated by matrix that adheres to each other or adheres to the surface of the tooth, between teeth, or the surface of the prosthesis. The major matrix components in oral biofilms associated with dental caries are water-insoluble polysaccharides, particularly Streptococus mutans (S. mutans) derived glucans. S. mutans, an indigenous bacterium in the mouth, is widely regarded as the most important cariogenic microorganism because of its strong capability of initial adhesion, producing glucans, and reducing the pH value. However, S. mutans is not the only pathogenic bacteria and other bacterial species might be responsible for biofilm initiation and development.
Recent evidence suggests that more than 700 bacterial species or phylotypes exist in the oral cavity, of which over 50% cannot be successfully cultivated [3]. Recent advances in high throughput genomics now allow for a comprehensive survey of bacterial species present in the oral cavity. The role of S. mutans in the initiation of dental caries may not be as dominant as it was previously assumed [4,5]. Some other bacteria may play a more important role. For instance, the presence and level of Candida albicans in saliva were reported to be strongly associated with caries pathogenesis, particularly in children, adolescents, and young adults [6,7,8]. In addition, Campylobacter showae, Parvimonas micra, and Leptotrichia hofstadii may be considered as potential pathogens for dental caries [9]. Therefore, the most promising way to prevent tooth decay is to re-establish the oral microbiota associated with good health [10]. A large number of existing studies have pointed out that regular consumption of probiotic products can significantly reduce the risks of dental caries by inhibiting cariogenic bacteria in the oral cavity and enrich the oral microbiota. The possible mechanisms behind the beneficial effects of probiotics are buffering the saliva pH, producing bacteriocins and enzymes (glucanase, mutanase and urease), and the ability to compete for adhesion and colonization on the tooth surface [11,12].
Current strategies for caries prevention and management mainly encompass the use of topical fluorides, dietary monitoring, and mechanical and chemical plaque control [13]. Although efficacy, the current methods are unlikely to further reduce the incidence of dental caries. Recently, there has been growing attention on the probiotics for dental caries prevention. Probiotics have been confirmed to inhibit the formation of dental biofilm through interaction with oral pathogens. Clinical data also reveal the regular intake of some live probiotics can reduce the caries risk and prevent the caries development in preschool children [14]. Despite some encouraging results, there is widespread skepticism concerning the use of probiotics as anti-caries strategies. The effect of probiotics is strain-dependent and the precise mechanisms by which probiotics exert anti-caries effects remain to be explored.
In our previous study, L. paracasei L9 (L9) is a commensal bacterial strain originally isolated from the feces of healthy centenarians, which exhibited a considerable effect on inhibiting S. mutans biofilm formation in vitro [15]. However, the effect of L. paracasei L9 on dental caries and the action mechanism remain to be explored. In this study, we assessed the inhibitory efficacy of L. paracasei L9 on S. mutans-induced dental caries in male BALB/c mice and further verified its modification on oral microbiota. In addition, the effect of L. paracasei L9 on biofilm formation was also assessed in vitro. The S. salivarius K12 (K12, commercialized oral cavity probiotic) was used as a reference strain.

2. Materials and Methods

2.1. Bacterial Strains and Culture Conditions

The L. paracasei L9 strain (CGMCC No. 9800) was isolated from centenarians’ fecal samples and grown in MRS broth at 37 °C under aerobic conditions. Streptococcus mutans (S. mutans) ATCC 25175 was obtained from the China General Microbiological Culture Collection Center and cultured in BHI medium at 37 °C aerobically. The S. salivarius K12 strain (BAA—1024, ATCC, Manassas, VA, USA) was cultured in M17 broth at 37 °C under aerobic conditions. After culture, the L. paracasei L9 and S. salivarius K12 were centrifuged and resuspended in sucrose solutions for daily oral administration. The S. mutans cells were resuspended in a physiological saline solution.

2.2. Animals and Experimental Procedure

40 male BALB/c mice aged 3 weeks were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. (Beijing, China). All experimental animal care and treatment were approved by the China Agricultural University Institutional Animal Care Committee (No. AW01210202-4-3). After one week of quarantine, mice were divided into four groups (n = 10): control group, model group, L. paracasei L9 group, and S. salivarius K12 group. Except for the control group, mice in other groups were subjected to S. mutans incubation, a high sucrose diet (Diet 2000, Trophic Animal Feed High-tech Co., Ltd., Nantong, China), and the 10% (w/v, g/mL) sucrose drinking water. In order to make the mice develop dental caries, during the model-preparing period, a micropipette was used to inoculate S. mutans onto the teeth of the mice for four consecutive days at an inoculation dose of 1 × 108 cells. The mice in the control group were swabbed with sterile PBS. After inoculation, L. paracasei L9 or S. salivarius K12 was added to drinking water at the concentration of 1 × 107 CFU/mL until the end of experiment. The drinking water was refreshed per 12 h.

2.3. Dental Caries Scores

Mice were sacrificed at the end of the study and their heads were stripped manually. The mandibles and maxillae were removed, stained in 0.4% murexide solution for 12 h, and hemisected along the mesiodistal sagittal plane using a diamond-coated band saw with the diameter of 25 mm and thickness of 0.1 mm (Struers Minitom, Copenhagen, Denmark). Smooth surface lesions and sulcal lesions were scored according to a previously published Keyes method [16].

2.4. Oral Microbial Counting

A total of five pairs of S. mutans primers are shown in Table 1. Using quantitative PCR, we screened for the primers that could specifically amplify the variant streptococci and Streptococcus oralis, but not the Streptococcus salivarius and Lactococcus lactis subsp. lactis. PCR amplification of pathogenic bacteria was performed using specific primers, and the products were subjected to agarose gel electrophoresis, gel cutting, and DNA recovery using a gel recovery kit. The recovered PCR products were connected to the pESI-T vector with the Ampicillin resistance gene. The pESI-T vector was transformed into receptive E. coli DH5α. After the culture in LB with Ampicillin, culture liquids with gradient concentrations were extracted from the DNA and quantitative PCR was performed using corresponding primers. Meanwhile, the bacterial concentrations of culture liquids were confirmed by gradient dilutions and LB agar medium counting. Then, the standard curves were established between the CT value and bacterial number. Using a similar method, after the DNA extraction from the oral microbial samples and quantitative PCR, the standard curves were used to calculate the abundances of pathogenic bacteria. DNA of HA disks was extracted as previously described [17]. The primers for S. mutans are listed in Table 2.

2.5. RT-qPCR for Gene Expressions of Dental Biofilms

Four days before the sacrifice, plaque-biofilm samples were collected. Sterile oral swabs were used to rub back and forth for 1 min on the teeth crown, the gap of the teeth, and the gums of mice. The RNA extraction and purification were conducted according to the protocol as described previously [24]. Then, the RNA was reversed into cDNA with the commercial kits (MF166-01, Mei5bio, Beijing, China) and RT-qPCR procedure was finished with the commercial kits (MF797-01, Mei5bio, Beijing, China) via the QuantStudio5 system (ABI, Wakefield, RI, USA). The primers for spaP, luxs, ciaH, gtfB, gtfC, gtfD, ldh, and recA are listed in Table 2.

2.6. S rRNA Gene Sequencing of Dental Plaques

Plaque microbiota samples were collected one day before the sacrifice. Sterile oral swabs were used to rub back and forth for 1 min in the crown, the gap of the teeth, and the gums of mice. The cotton swabs were then immersed in preservation solutions and stored at 4 °C for DNA extraction. Bacterial genomic DNA was extracted with phenol-chloroform [25], and then quantified by NanoDrop (OneC, Thermo Scientific, Waltham, MA, USA). The V3–V4 region of 16S rRNA gene was amplified with the universal primers as described previously [26]. The products were pooled based on a uniform standard and sequenced on an Illumina Miseq PE300 platform (Illumina, San Diego, CA, USA) by a paired-end sequencing strategy. Raw data were assembled filtered, and then used to select the operational taxonomic units (OTUs) with USEARCH software (version 7.0, http://www.drive5.com/usearch/, accessed on 1 October 2024) based on the 97% sequence similarity. The OTUs were further subjected to the Ribosomal Database Project classifier software (version number: RDP Release 11.5) for taxonomic identification. Further analysis, such as abundances of special communities, was analyzed on the platform of Majorbio Cloud Platform (https://cloud.majorbio.com, accessed on 1 October 2024).

2.7. Biofilm Formation Assay

The concentrations of L. paracasei L9 cultured in MRS broth medium, S. salivarius K12 in M17 broth medium, as well as S. mutans in BHI medium with 1% sucrose, were adjusted to OD600 = 0.7 ± 0.05 (5 × 108 cfu/mL) and OD600 = 0.5 ± 0.05 (1 × 108 cfu/mL), respectively. The 24-well cell culture plates were then prepared by adding 1 mL of artificial saliva medium containing 1% sucrose, 50 μL of S. mutans suspension, and 50 μL of probiotics suspension. The control group consisted of equivalent MRS or M17 broth medium. The plates were incubated under anaerobic conditions at 37 °C for 24 h. Subsequently, the liquid culture medium was carefully aspirated with a pipette, and the cells were washed 3 times with PBS. The floating S. mutans cells without forming films were removed. The plates were then air-dried. For each well, 100 μL of 99% methanol was added and treated the cells for 15 min. Then, the supernatant was aspirated, and the plates were air-dried. Next, 200 μL of 0.1% CV solution was added to wells for 20 min, followed by 3 washes with PBS to remove redundant CV. Finally, 1 mL of 33% acetic acid was added to release the bound CV, and the absorbance was measured at 595 nm using an ELISA reader (Perkin Elmer Victor X3, Shelton, CT, USA).

2.8. SEM Observation of Biofilms

Microbial biofilms were grown on 14 mm diameter round glass slides (SORFA, China) in the wells of 24-well plates. After 24 h of anaerobic culture, the liquid culture medium was gently aspirated, and the glass slides were removed. To wash off the floating S. mutans, PBS was used to wash. The biofilms were then fixed in 2.5% glutaraldehyde at 4 °C overnight. The glass slides were successively dehydrated with 30%, 50%, 70%, 80%, and 90% ethyl alcohol for 1 h. Subsequently, the dried glass slides were stuck onto the sample table, sprayed with gold, and observed using SEM (HITACHI, S-4800, Tokyo, Japan).

2.9. Statistical Analysis

Data are expressed as the mean ± SEM. Statistical comparisons were made using one-way analysis of variance (ANOVA) with Dunnett’s multiple comparisons. A p value of less than 0.05 is considered significant. Statistical analysis was performed with SPSS 18.0 (SPSS, Inc., Chicago, IL, USA). Graphs were generated by GraphPad Prism 7.0 (GraphPad Software, San Diego, CA, USA).

3. Results

3.1. Dental Caries Scores

The process and modeling method of this experiment are shown in Figure 1A. Figure 1B illustrates the main effects of L. paracasei L9 and S. salivarius K12 treatments on the occlusal surface of mice teeth. As shown, the occlusal surface of the control group’s mice teeth is smooth, lacking deep grooves, whereas the model group’s occlusal surface displays evident caries, with almost every tooth having deep sulci on its occlusal surface (Figure 1B). Probiotic strains L. paracasei L9 and S. salivarius K12 considerably obstructed the cariogenic actions of S. mutans, leaving the teeth’s occlusal surface relatively intact, yet small numbers of superficial caries remained present (Figure 1B). On the occlusal surfaces of the mice’s teeth, E-level, Ds-level, and Dm-level caries were detected (Figure 1C). In E-level caries (Figure 1C), the model group had a significantly higher caries score than control group (p < 0.05), whereas the L. paracasei L9 group showed a notably reduced score compared to model group (p < 0.05). The S. salivarius K12 group had a slightly decreased score than model group, but it was not statistically different (p > 0.05). Regarding the Ds and Dm level caries scores for each group, they were all under 1, and hardly any shallow caries could be found, with no notable differences (Figure 1C, p > 0.05). Ds and Dm level caries emerged at the outer layers of the enamel and dentin. Pathogenic bacteria, specifically Streptococcus abundances in the oral cavity, were also measured in Figure 1D, where the Streptococcus count in the model was significantly elevated versus other groups (p < 0.05), and both S. salivarius K12 and L. paracasei L9 groups had drastically lower counts than the model group (p < 0.05). Overall, these results suggest that L. paracasei L9 has a marked preventative effect on initial stage caries on the teeth’s occlusal surface.

3.2. Quantification of Caries-Causing Factors

The quantitative results of caries-causing factors in mouse dental plaque are shown in Figure 2. It can be seen that compared to the control (CK) group, the relative expressions of spap, luxs, and ciaH in the model group were significantly higher (Figure 2A–C, p < 0.05), the expression levels of spap and ciaH in the L. paracasei L9 and S. salivarius K12 groups were reduced compared to the expression levels of the CK group, and the expression of Luxs gene was significantly lower than that of the model group (Figure 2B, p < 0.05). But compared with the CK group, the mean relative expression levels were still increased, especially in the L. paracasei L9 group (Figure 2B).
As shown in Figure 2D–F, the relative expressions of gtfB and gtfD were significantly higher in the model group compared to the CK group (p < 0.05), especially the gtfB. The expressions of both genes in the L. paracasei L9 and S. salivarius K12 groups were significantly lower than those in the model group (Figure 2D–F, p < 0.05) except the gtfB expression in the S. salivarius K12 group, although the mean expression levels of both genes were increased compared to the CK group. In addition, the relative expressions of gtfC were not significantly different among the four groups (Figure 2E, p > 0.05).
The ldh gene encodes lactate dehydrogenase. As can be seen from the results in Figure 2G, the mean relative expression level of ldh was relatively low in the L. paracasei L9 group, and the relative expression level of ldh was not significantly different among the four groups (p > 0.05). Therefore, L. paracasei L9 may show no significant effect on the acid product capacity of S. mutans.

3.3. Effects of L9 and K12 on Oral Microbial Community

For the α-diversity of oral microbiota, evaluated by the Sobs, Shannon, Simpson, Ace, and Chao indexes, there was no significant difference in each index between the model and control groups (Table 3, p > 0.05), meaning both diversity and richness did not show a significant change. In the S. salivarius K12 group, the Simpson index was obviously lower than that of the model group, and the Chao index was increased (Table 3, p < 0.05), indicating the increased α-diversity. There was no significant difference in each index between the L. paracasei L9 and the model groups (Table 3, p > 0.05), suggesting the not significant impact on oral bacteria diversity and richness.
To detect the compositions of the dental plaque microbiota in mice, the third generation PacBio sequencing technology based on the full-length bacterial 16S rRNA gene was adopted, which can identify bacteria at the species level. At the class level, the top five classes with the highest abundances were presented, including Bacilli, Gammaproteobacteria, Mollicutes, Actinobacteria, and Erysipelotrichia (Figure 3A). Principal Coordinate Analysis (PCoA) based on Bray–Curtis distance is a method used to evaluate the similarities in the compositions of microbiota communities (Figure 3B). According to the results, the model group was almost completely separated from the other three groups. Meanwhile, there was no overlap between the control group and the L. paracasei L9 group, as well as the S. salivarius K12 group (Figure 3B).
The control, S. salivarius K12, and L. paracasei L9 groups were compared with the model group in order to analyze different bacteria at the genus level. Compared with control group, the model group showed higher abundances of Staphylococcus, Aerococcus, and Klebsiella (p < 0.05). Similarly to the S. salivarius K12 group, compared with the model group, the L. paracasei L9 group had a significant decrease in the abundance of Pasteurella and a significant increase in the abundance of Escherichia—Shigella (Figure 4B,C, p < 0.05). The difference is that, compared with the model group, the L. paracasei L9 group showed a significant decrease in the abundances of Gemella, Mycoplasma, and Corynebacterium_1, while the Klebsiella increased significantly (Figure 4B,C, p < 0.05). The Linear Discriminant Analysis Effect Size (LEfse) was used to evaluate the influences of significantly different species among different groups. As we can see, Gemella, Coriobacteriaceae_UCG_002, Escherichia_Shigella, and Pasteurella were the communities with the highest LDA scores in the control, S. salivarius K12, L. paracasei L9, and model groups, respectively (Figure 4D).

3.4. Biofilm Staining

Figure 5A shows the SEM images of S. mutans biofilms after the 24 h of treatment with probiotics, we viewed its microstructure using scanning electron microscopy (SEM) under the 10 μm or 5 μm scales. The top and bottom are the S. mutans biofilms of the control (CK), L. paracasei L9, and S. salivarius K12 groups. It can be seen that the bacteria of the CK group are enveloped by the biofilms of S. mutans, while the multilayer dense biofilm structure of the L. paracasei L9 group disappears (Figure 5A). Instead, the biofilms show a single layer of loose microstructure (Figure 5A). The rod-like structure of L. paracasei L9 is completely exposed to the biofilms, presenting the dense and discontinuous biofilms with a certain thickness (Figure 5A). In S. salivarius K12 group, the S. salivarius K12 is mixed with S. mutans to form the dense biofilms (Figure 5A).
Figure 5B shows the absorbance values of biofilm staining of S. mutans after the 24 h of treatment with probiotics. It is obvious that the absorbance value of the L. paracasei L9 group was lower and that of the S. salivarius K12 group was higher compared to the CK group. L. paracasei L9 inhibited the promotion of biofilm formation, while S. salivarius K12 promoted the participation of S. mutans in the biofilm formation.

4. Discussion

The probiotics can prevent or mitigate dental caries, which is a well-established concept in the field of oral health [27]. Notably, Lactobacillus plantarum has been shown to effectively treat caries caused by Candida albicans [28], highlighting its therapeutic potential. Additionally, Lactobacillus rhamnosus has been found to continuously regulate the cariogenic potential of S. mutans by inhibiting acid production, thereby mitigating the risk of dental caries [29]. In recent years, the role of Lacticaseibacillus paracasei in alleviating dental caries has also been progressively elucidated, including its ability to suppress the formation of S. mutans biofilms and production of bioactive substances, as well as enhancing the levels of salivary neutrophil peptides [30,31]. This study contributes to the expanding corpus of knowledge by demonstrating the efficacy of the L. paracasei L9 strain in mitigating the cariogenic phenotype in a murine model. The mitigation manifests as a diminishment in caries damages, reduced expressions of cariogenic factors, and inhibition of initial S. mutans adhesion [32]. While other strains of Lacticaseibacillus paracasei have been identified to possess anti-caries effects [33], this investigation singularly identified L. paracasei L9 as uniquely capable of alleviating caries damages and inhibiting initial S. mutans adhesion. This finding provides a more robust strategy for incorporating L. paracasei L9 into functional foods, particularly those targeted at oral health products, thereby enhancing its application within the realm of oral healthcare [34].
Biofilms, a collective lifestyle of microorganisms, exhibit a myriad of emergent properties encompassing interfacial aggregation, surface adhesion, water retention, nutrient acquisition, enhanced resistance, and collective coordination [35,36,37,38,39]. Upon formation, bacterial biofilms serve as a sanctuary for microorganisms, significantly amplifying their resilience against antimicrobial agents and their ability to evade host’s immune system, thereby facilitating recalcitrant and recurrent infections. Within the oral cavity, dental caries arises from biofilms formed by the pathogenic S. mutans on the initial proteinaceous coating of the dental matrix [40,41,42]. Consequently, the inhibition of bacterial biofilm formation, particularly that of S. mutans, is vital for the preservation of oral health. In light of the adverse effects of antimicrobial agents, biocontrol strategies have emerged as a promising alternative. This study aimed at elucidating the potential of L. paracasei L9 to mitigate dental caries in the oral environment. Utilizing a co-culture system with S. mutans, this investigation focused on assessing the impact of L. paracasei L9 on the formation of S. mutans biofilms. To emulate the oral ecosystem, S. mutans were cultivated in artificial saliva medium supplemented with 1% sucrose throughout the experiment [43]. Following a 24 h co-culture period, the viable cells and metabolites secreted by L. paracasei L9 exhibited a pronounced inhibitory effect on the assembly of S. mutans biofilms. This finding indicates that live L. paracasei L9 can effectively suppress the development of S. mutans biofilms through the secretion of its metabolites, thereby offering a protective barrier against dental caries. The gene Spap is regulated by a surface protein P1 secreted by caries-causing bacteria that binds specifically to receptors on saliva-acquired membranes, thereby promoting initial bacterial adhesion, the first stage of dental plaque biofilm formation. It has been shown that the relative expression of the Spap gene in S. mutans with high adhesion capacity is higher than that in bacteria with weak adhesion capacity during initial adhesion, and its significant down-regulation indicate that the addition of L. paracasei L9 may inhibit the initial adhesion of S. mutans by regulating adhesin-receptor binding. The two-component luxs/AI-2 system in the density-sensing system of S. mutans is activated with its increase in S. mutans [44]. Luxs is a key enzyme for autoinducer-2 (AI-2), while luxs and the ciaH gene co-regulation of wooly sulfobacteriocin has been shown to reduce the biofilm forming ability of S. mutans with the luxs mutation [45]. Similarly to the results of the present study, the downregulation of Luxs gene was accompanied by a significant reduction in caries score in mice. Therefore, the addition of L. paracasei L9 significantly inhibited the initial adhesion of S. mutans to the tooth surface. With the development of biofilms, S. mutans convert carbohydrates from oral intake into extracellular polysaccharides via glucosyltransferases, which promotes bacterial adhesion mediated by insoluble polysaccharides. Glucosyltransferases (GTF) are regulated by gtf genes, of which gtfB and gtfC genes are closely associated with sucrose-dependent adhesion in S. mutans. It has been shown that the relative gene expressions of gtfB, spaP, and luxS in S. mutans were significantly upregulated in the biofilms. Moreover, the expressions of gtf genes in biofilms of S. mutans were higher than the planktonic state. This result was slightly different from that of Wudi-Cong et al. [46,47]. Their results showed that the expressions of the three gtf genes of S. mutans were consistently upregulated during caries formation. The decrease in gtfD expression may reduce the availability of soluble sugars for GTF-D synthesis and thus reduce the availability of GTF-B metabolic substrate. Therefore, the decreases in relative expressions of gtfB and gtfD genes suggest that L. paracasei L9 significantly inhibits the formation and development of dental plaque biofilms.
Dental caries, a multifactorial chronic disease, is closely associated with the disruption of oral microbial homeostasis [48]. The oral microbiota, composed of billions of microorganisms, is one of the most intricate microbial ecosystems in the human body [49]. Under normal circumstances, these microbes co-exist in a delicate balance that sustains oral health. However, when this equilibrium is disrupted, particularly when the oral environment favors the overgrowth of certain pathogens, such as the S. mutans, the onset of oral diseases like caries becomes inevitable [50,51]. In this experiment, the introduction of L. paracasei L9 significantly optimized the oral microbial structure, inhibiting the overgrowth of potential pathogens such as Pseudomonas aeruginosa, Veillonella, Klebsiella, and Gemella, while simultaneously promoting the proliferations of beneficial bacteria from the Lactobacillus genus and Streptococcus salivarius. This positive ecological regulation effectively reduced the risks of dental caries, periodontal disease, halitosis, and oral tumors, and also had a positive impact on the prevention of systemic diseases such as sepsis, highlighting the significant potential of L. paracasei L9 in the maintenance of both oral and systemic health [52,53,54]. Through the intervention of L. paracasei L9, the oral microbial environment is optimized, the balance of microbiota is restored, thus offering a safe, natural, and effective approach for oral health maintenance. This study not only underscores the potential of probiotics in the prevention and treatment of oral diseases, but also provides a new perspective on exploring the links between oral diseases and overall health.
In the model group, the abundances of pathogenic bacteria in the L. paracasei L9 group decreased significantly. For example, the abundances of Pasteurella and Gemella decreased. In contrast, the abundance of beneficial Klebsiella increased significantly. Relatively, the most bacteria with high abundances in the model group were pathogenic bacteria, such as Pasteurella and Methylobacterium. However, the abundances of these bacteria in L. paracasei L9 group were very low. Therefore, it can be concluded that L. paracasei L9 may optimize the oral microbial environment.
This experiment exhibits certain reference significance for the prevention and alleviation of dental caries. However, it still has some limitations. For example, we have not carried out relevant population experiments and have not explored whether L. paracasei L9 can inhibite the S. mutans biofilms formation through interference quorum sensing. In the future, we plan to recruit a group of toddler volunteers to carry out relevant experiments to observe the influence of L. paracasei L9 on their oral microbiota.

5. Conclusions

In conclusion, an intervention with L. paracasei L9 can repress the expressions of cariogenic factors and inhibit the initial adhesion of S. mutans and the subsequent formation and development of dental biofilm, mitigating the severity of caries formation and induced damages. Restraining the dysbiosis of oral microbiota is a key functional mechanism. These findings build a solid scientific foundation for the potential application of L. paracasei L9 in the prevention and treatment of dental caries.

Author Contributions

X.P.: Investigation, writing—original draft preparation. B.F.: data curation, investigation. J.W.: writing—original draft preparation, methodology. Z.Z.: data curation, investigation. Y.L.: methodology. J.L.: visualization, supervision. H.G.: conceptualization. R.W.: visualization, supervision. M.Z.: conceptualization, funding acquisition, writing—review and editing. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Key R&D Program of China (2023YFF1104501), National Center of Technology Innovation for Dairy (No. 2022-KYGG-6), R&D Program of Beijing Municipal Education Commission (23JF0006).

Institutional Review Board Statement

The animal study protocol was approved by the China Agricultural University Laboratory Animal Welfareand Animal Experimental Ethical Inspection (Protocol code: AW01210202-4-3; Date of approval: 3 December 2020).

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding author.

Conflicts of Interest

The authors declare that there is no conflict of interest.

References

  1. Baker, J.L.; Edlund, A. Exploiting the oral microbiome to prevent tooth decay: Has evolution already provided the best Tools? Front. Microbiol. 2019, 9, 3323. [Google Scholar] [CrossRef] [PubMed]
  2. Bowen, W.H.; Burne, R.A.; Wu, H.; Koo, H. Oral biofilms: Pathogens, matrix, and polymicrobial interactions in microenvironments. Trent Microbiol. 2018, 26, 229–242. [Google Scholar] [CrossRef] [PubMed]
  3. Li, Z.; Fu, R.; Huang, X.; Wen, X.; Zhang, L. A decade of progress: Bibliometric analysis of trends and hotspots in oral microbiome research (2013–2022). Front. Cell Infect. Microbiol. 2023, 13, 1195127. [Google Scholar] [CrossRef] [PubMed]
  4. He, X.S.; Shi, W.Y. Oral microbiology: Past, present and future. Int. J. Oral Sci. 2009, 1, 47–58. [Google Scholar] [CrossRef]
  5. Takahashi, N.; Nyvad, B. Caries ecology revisited: Microbial dynamics and the caries process. Caries Res. 2008, 42, 409–418. [Google Scholar] [CrossRef]
  6. Klinke, T.; Kneist, S.; de Soet, J.J.; Kuhlisch, E.; Mauersberger, S.; Förster, A.; Klimm, W. Acid production by oral strains of Candida albicans and Lactobacilli. Caries Res. 2009, 43, 83–91. [Google Scholar] [CrossRef]
  7. Marchant, S.; Brailsford, S.R.; Twomey, A.C.; Roberts, G.J.; Beighton, D. The predominant microflora of nursing caries lesions. Caries Res. 2001, 35, 397–406. [Google Scholar] [CrossRef]
  8. Raja, M.; Hannan, A.; Ali, K. Association of oral candidal carriage with dental caries in children. Caries Res. 2010, 44, 272–276. [Google Scholar] [CrossRef]
  9. Luo, A.H.; Yang, D.Q.; Xin, B.C.; Paster, B.J.; Qin, J. Microbial profiles in saliva from children with and without caries in mixed dentition. Oral Dis. 2012, 18, 595–601. [Google Scholar] [CrossRef]
  10. Frencken, J.E.; Sharma, P.; Stenhouse, L.; Green, D.; Laverty, D.; Dietrich, T. Global epidemiology of dental caries and severe periodontitis—A comprehensive review. J. Clin. Periodontol. 2017, 44, S94–S105. [Google Scholar] [CrossRef]
  11. Sivamaruthi, B.S.; Kesika, P.; Chaiyasut, C. A review of the role of probiotic supplementation in dental caries. Probiotics Antimicrob. Proteins 2020, 12, 1300–1309. [Google Scholar] [CrossRef] [PubMed]
  12. Inchingolo, F.; Inchingolo, A.M.; Malcangi, G.; De Leonardis, N.; Sardano, R.; Pezzolla, C.; de Ruvo, E.; Di Venere, D.; Palermo, A.; Inchingolo, A.D.; et al. The benefits of probiotics on oral health: Systematic review of the literature. Pharmaceuticals 2023, 16, 1313. [Google Scholar] [CrossRef] [PubMed]
  13. Fejerskov, O. Changing paradigms in concepts on dental caries: Consequences for oral health care. Caries Res. 2004, 38, 182–191. [Google Scholar] [CrossRef] [PubMed]
  14. Nozari, A.; Motamedifar, M.; Seifi, N.; Hatamizargaran, Z.; Ranjbar, M.A. The effect of iranian customary used probiotic yogurt on the children’s salivary cariogenic microflora. J. Dent. 2015, 16, 81–86. [Google Scholar]
  15. Brignone, D.; Radmann, P.; Behr, J.; Vogel, R.F. Boosting the growth of the probiotic strain Lactobacillus paracasei ssp. paracasei F19. Arch. Microbiol. 2017, 199, 853–862. [Google Scholar] [CrossRef]
  16. Keyes, P.H. Dental caries in the molar teeth of rats. J. Dent. Res. 1958, 37, 1088–1099. [Google Scholar] [CrossRef]
  17. Salli, K.M.; Forssten, S.D.; Lahtinen, S.J.; Ouwehand, A.C. Influence of sucrose and xylitol on an early Streptococcus mutans biofilm in a dental simulator. Arch. Oral Biol. 2016, 70, 39–46. [Google Scholar] [CrossRef]
  18. Wu, D. The Dynamic Changes of Virulence Factors and Cariogenic Bacteria in Plaque Biofilms with the Development of Dental Caries. Master’s Thesis, Zunyi Medical University, Zunyi, China, 2011. [Google Scholar]
  19. Merritt, J.; Qi, F.; Goodman, S.D.; Anderson, M.H.; Shi, W. Mutation of luxS affects biofilm formation in Streptococcus mutans. Infect. Immun. 2003, 71, 1972–1979. [Google Scholar] [CrossRef]
  20. Tsang, P.; Merritt, J.; Shi, W.; Qi, F. IrvA-dependent and irvA-independent pathways for mutacin gene regulation in Streptococcus mutans. FEMS Microbiol. Lett. 2006, 261, 231–234. [Google Scholar] [CrossRef]
  21. Yousefi, B.; Ghaderi, S.; Rezapoor-Lactooyi, A.; Amiri, N.; Verdi, J.; Shoae-Hassani, A. Hydroxy decenoic acid down regulates gtfB and gtfC expression and prevents Streptococcus mutans adherence to the cell surfaces. Ann. Clin. Microbiol. Antimicrob. 2012, 11, 21. [Google Scholar] [CrossRef]
  22. Lima, B.D.; de Lira, S.P.; Kossuga, M.H.; Goncalves, R.B.; Berlinck, R.G.S.; Kamiya, R.U. Halistanol sulfate A and rodriguesines A and B are antimicrobial and antibiofilm agents against the cariogenic bacterium Streptococcus mutans. Rev. Bras. Farmacogn. 2014, 24, 651–659. [Google Scholar] [CrossRef]
  23. Mattos-Graner, R.O.; Napimoga, M.H.; Fukushima, K.; Duncan, M.J.; Smith, D.J. Comparative analysis of Gtf isozyme production and diversity in isolates of Streptococcus mutans with different biofilm growth phenotypes. J. Clin. Microbiol. 2004, 42, 4586–4592. [Google Scholar] [CrossRef] [PubMed]
  24. Cury, J.A.; Koo, H. Extraction and purification of total RNA from Sreptococcus mutans biofilms. Anal. Biochem. 2007, 365, 208–214. [Google Scholar] [CrossRef] [PubMed]
  25. Köchl, S.; Niederstätter, H.; Parson, W. DNA extraction and quantitation of forensic samples using the phenol-chloroform method and real-time PCR. Methods Mol. Biol. 2005, 297, 13–30. [Google Scholar]
  26. Zheng, Y.; Wu, F.; Zhang, M.; Fang, B.; Zhao, L.; Dong, L.; Zhou, X.; Ge, S. Hypoglycemic effect of camel milk powder in type 2 diabetic patients: A randomized, double-blind, placebo-controlled trial. Food Sci. Nutr. 2021, 9, 4461–4472. [Google Scholar] [CrossRef]
  27. Zhang, J.; Wang, Q.; Duan, Z. Preventive effects of probiotics on dental caries in vitro and in vivo. BMC Oral Health 2024, 24, 915. [Google Scholar] [CrossRef]
  28. Zhang, Q.; Qin, S.; Xu, X.; Zhao, J.; Zhang, H.; Liu, Z.; Chen, W.; Deng, W. Inhibitory effect of Lactobacillus plantarum CCFM8724 towards Streptococcus mutans- and Candida albicans-Induced caries in rats. Oxid. Med. Cell Longev. 2020, 2020, 4345804. [Google Scholar] [CrossRef]
  29. Jung, H.-Y.; Cai, J.-N.; Yoo, S.C.; Kim, S.-H.; Jeon, J.-G.; Kim, D. Collagen peptide in a combinatorial treatment with Lactobacillus rhamnosus inhibits the cariogenic properties of Streptococcus mutans: An in vitro study. Int. J. Mol. Sci. 2022, 23, 1860. [Google Scholar] [CrossRef]
  30. Zhao, Z.; Wu, J.; Sun, Z.; Fan, J.; Liu, F.; Zhao, W.; Liu, W.-H.; Zhang, M.; Hung, W.-L. Postbiotics derived from L. paracasei ET-22 inhibit the formation of S. mutans biofilms and bioactive Substances: An analysis. Molecules 2023, 28, 1236. [Google Scholar] [CrossRef]
  31. Wattanarat, O.; Nirunsittirat, A.; Piwat, S.; Manmontri, C.; Teanpaisan, R.; Pahumunto, N.; Makeudom, A.; Sastraruji, T.; Krisanaprakornkit, S. Significant elevation of salivary human neutrophil peptides 1-3 levels by probiotic milk in preschool children with severe early childhood caries: A randomized controlled trial. Clin. Oral Investig. 2020, 25, 2891–2903. [Google Scholar] [CrossRef]
  32. Żyła, T.; Kawala, B.; Antoszewska-Smith, J.; Kawala, M. Black stain and dental caries: A review of the literature. BioMed. Res. Int. 2015, 2015, 469392. [Google Scholar] [CrossRef] [PubMed]
  33. Teanpaisan, R.; Piwat, S.; Tianviwat, S.; Sophatha, B.; Kampoo, T. Effect of long-term consumption of Lactobacillus paracasei SD1 on reducing mutans streptococci and caries risk: A randomized placebo-controlled trial. Dent. J. 2015, 3, 43–54. [Google Scholar] [CrossRef] [PubMed]
  34. Mantzourani, I.; Terpou, A.; Bekatorou, A.; Mallouchos, A.; Alexopoulos, A.; Kimbaris, A.; Bezirtzoglou, E.; Koutinas, A.A.; Plessas, S. Functional pomegranate beverage production by fermentation with a novel synbiotic L. paracasei biocatalyst. Food Chem. 2020, 308, 125658. [Google Scholar] [CrossRef] [PubMed]
  35. Zheng, Y.; Yang, Y.; Liu, X.; Liu, P.; Li, X.; Zhang, M.; Zhou, E.; Zhao, Z.; Wang, X.; Zhang, Y.; et al. Accelerated corrosion of 316L stainless steel in a simulated oral environment via extracellular electron transfer and acid metabolites of subgingival microbiota. Bioact. Mater. 2024, 35, 56–66. [Google Scholar] [CrossRef]
  36. Zheng, X.; Chen, L.; Zeng, W.; Liao, W.; Wang, Z.; Tian, X.; Fang, R.; Sun, Y.; Zhou, T. Antibacterial and anti-biofilm efficacy of Chinese dragon’s blood against Staphylococcus aureus isolated from infected wounds. Front. Microbiol. 2021, 12, 672943. [Google Scholar] [CrossRef]
  37. Zheng, T.; Jing, M.; Gong, T.; Yan, J.; Wang, X.; Xu, M.; Zhou, X.; Zeng, J.; Li, Y. Regulatory mechanisms of exopolysaccharide synthesis and biofilm formation in Streptococcus mutans. J. Oral Microbiol. 2023, 15, 2225257. [Google Scholar] [CrossRef]
  38. Zheng, S.; Bawazir, M.; Dhall, A.; Kim, H.-E.; He, L.; Heo, J.; Hwang, G. Implication of surface properties, bacterial motility, and hydrodynamic conditions on bacterial surface sensing and their initial adhesion. Front. Bioeng. Biotechnol. 2021, 9, 643722. [Google Scholar] [CrossRef]
  39. Hannig, C.; Hannig, M. The oral cavity-a key system to understand substratum-dependent bioadhesion on solid surfaces in man. Clin. Oral Investig. 2009, 13, 123–139. [Google Scholar] [CrossRef]
  40. Zou, P.; Liu, J.; Li, P.; Luan, Q. Antifungal activity, synergism with fluconazole or amphotericin B and potential mechanism of direct current against Candida albicans biofilms and persisters. Antibiotics 2024, 13, 521. [Google Scholar] [CrossRef]
  41. Zeng, Y.; Fadaak, A.; Alomeir, N.; Wu, T.T.; Rustchenko, E.; Qing, S.; Bao, J.; Gilbert, C.; Xiao, J. Lactobacillus plantarum disrupts S. mutans-C. albicans cross-kingdom biofilms. Front. Cell Infect. Microbiol. 2022, 12, 872012. [Google Scholar] [CrossRef]
  42. Zanetta, P.; Squarzanti, D.F.; di Coste, A.; Rolla, R.; Valletti, P.A.; Garzaro, M.; Dell’Era, V.; Amoruso, A.; Pane, M.; Azzimonti, B. In Vitro selection of Lactobacillus and Bifidobacterium probiotic strains for the management of oral pathobiont infections associated to systemic diseases. Int. J. Mol. Sci. 2022, 23, 16163. [Google Scholar] [CrossRef] [PubMed]
  43. Díaz-Garrido, N.; Lozano, C.P.; Kreth, J.; Giacaman, R.A.; McBain, A.J. Competition and caries on enamel of a dual-species biofilm model with Streptococcus mutans and Streptococcus sanguinis. Appl. Environ. Microbiol. 2020, 86, e01262-20. [Google Scholar] [CrossRef] [PubMed]
  44. Yuan, K.; Hou, L.; Jin, Q.; Niu, C.; Mao, M.; Wang, R.; Huang, Z. Comparative transcriptomics analysis of Streptococcus mutans with disruption of LuxS/AI-2 quorum sensing and recovery of methyl cycle. Arch. Oral Biol. 2021, 127, 105137. [Google Scholar] [CrossRef] [PubMed]
  45. Wang, X.; Li, X.; Ling, J. Streptococcus gordonii LuxS/autoinducer-2 quorum-sensing system modulates the dual-species biofilm formation with Streptococcus mutans. J. Basic Microbiol. 2017, 57, 605–616. [Google Scholar] [CrossRef]
  46. Zhang, L.; Meng, Y.; Li, J.; Yu, J.; Mu, G.; Tuo, Y. Lactiplantibacillus plantarum Y42 in biofilm and planktonic states improves intestinal barrier integrity and modulates gut microbiota of Balb/c Mice. Foods 2022, 11, 1451. [Google Scholar] [CrossRef]
  47. Zhang, L.; Chen, X.; Ren, B.; Zhou, X.; Cheng, L. Helicobacter pylori in the oral cavity: Current evidence and potential survival strategies. Int. J. Mol. Sci. 2022, 23, 13646. [Google Scholar] [CrossRef]
  48. Zhu, J.; Chu, W.; Luo, J.; Yang, J.; He, L.; Li, J. Dental materials for oral microbiota dysbiosis: An update. Front. Cell Infect. Microbiol. 2022, 12, 900918. [Google Scholar] [CrossRef]
  49. Lozano, C.P.; Díaz-Garrido, N.; Kreth, J.; Giacaman, R.A. Streptococcus mutans and Streptococcus sanguinis expression of competition-related genes, under sucrose. Caries Res. 2019, 53, 194–203. [Google Scholar] [CrossRef]
  50. Wuri, G.; Liu, F.; Sun, Z.; Fang, B.; Zhao, W.; Hung, W.-L.; Liu, W.-H.; Zhang, X.; Wang, R.; Wu, F.; et al. Lactobacillus paracasei ET-22 and derived postbiotics reduce halitosis and modulate oral microbiome dysregulation–a randomized, double-blind placebo-controlled clinical trial. Food Funct. 2023, 14, 7335–7346. [Google Scholar] [CrossRef]
  51. Zumsteg, Z.S.; Luu, M.; Rosenberg, P.S.; Elrod, J.K.; Bray, F.; Vaccarella, S.; Gay, C.; Lu, D.J.; Chen, M.M.; Chaturvedi, A.K.; et al. Global epidemiologic patterns of oropharyngeal cancer incidence trends. J. Natl. Cancer Inst. 2023, 115, 1544–1554. [Google Scholar] [CrossRef]
  52. Zou, R.; Zhao, L.; Shen, D.; Wu, Y. TrkA serves as a virulence modulator in Porphyromonas gingivalis by maintaining heme acquisition and pathogenesis. Front. Cell Infect. Microbiol. 2022, 12, 1012316. [Google Scholar] [CrossRef] [PubMed]
  53. Ren, Z.; Chen, L.; Li, J.; Li, Y. Inhibition of Streptococcus mutans polysaccharide synthesis by molecules targeting glycosyltransferase activity. J. Oral Microbiol. 2016, 8, 31095. [Google Scholar] [CrossRef] [PubMed]
  54. Noda, M.; Sugihara, N.; Sugimoto, Y.; Hayashi, I.; Sugimoto, S.; Danshiitsoodol, N.; Sugiyama, M. Lactobacillus reuteri BM53-1 produces a compound that inhibits sticky glucan synthesis by Streptococcus mutans. Microorganisms 2021, 9, 1390. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Effects of L. paracasei L9 and S. salivarius K12 on dental caries in mice. (A) The process and modeling methods of this experiment. (B) Schematic diagrams of the occlusal surface of mouse teeth. (C) Grade E, Ds, and Dm grade caries scores. (D) The S. mutans count in oral cavity. * p < 0.05, ** p < 0.01, versus model group.
Figure 1. Effects of L. paracasei L9 and S. salivarius K12 on dental caries in mice. (A) The process and modeling methods of this experiment. (B) Schematic diagrams of the occlusal surface of mouse teeth. (C) Grade E, Ds, and Dm grade caries scores. (D) The S. mutans count in oral cavity. * p < 0.05, ** p < 0.01, versus model group.
Foods 13 04118 g001
Figure 2. The gene expressions of caries-causing factors in mouse dental plaque. (AC) The relative expression histograms of spap (A), luxs (B), and ciaH (C) genes. (DF) The relative expression histogram of gtf gene. (G) The relative expression histogram of ldh genes. * p < 0.05, ** p < 0.01, *** p < 0.001, versus the model group.
Figure 2. The gene expressions of caries-causing factors in mouse dental plaque. (AC) The relative expression histograms of spap (A), luxs (B), and ciaH (C) genes. (DF) The relative expression histogram of gtf gene. (G) The relative expression histogram of ldh genes. * p < 0.05, ** p < 0.01, *** p < 0.001, versus the model group.
Foods 13 04118 g002
Figure 3. Effects of L. paracasei L9 and S. salivarius K12 on oral microbial structure. (A) Percent of community abundance on Class level. (B) PCoA on Family level.
Figure 3. Effects of L. paracasei L9 and S. salivarius K12 on oral microbial structure. (A) Percent of community abundance on Class level. (B) PCoA on Family level.
Foods 13 04118 g003
Figure 4. Analysis of bacterial abundance differences between the L. paracasei L9 or S. salivarius K12 or control group and model group. (A) Bacterial abundance differences between the control and model groups. (B) Bacterial abundance differences between the S. salivarius K12 and model groups. (C) Bacterial abundance differences between the L. paracasei L9 and model groups. (D) The LEfse results of L. paracasei L9, S. salivarius K12, control, and model groups. * p < 0.05, ** p < 0.01, *** p < 0.001.
Figure 4. Analysis of bacterial abundance differences between the L. paracasei L9 or S. salivarius K12 or control group and model group. (A) Bacterial abundance differences between the control and model groups. (B) Bacterial abundance differences between the S. salivarius K12 and model groups. (C) Bacterial abundance differences between the L. paracasei L9 and model groups. (D) The LEfse results of L. paracasei L9, S. salivarius K12, control, and model groups. * p < 0.05, ** p < 0.01, *** p < 0.001.
Foods 13 04118 g004
Figure 5. Effects of L. paracasei L9 and S. salivarius K12 on formation of S. mutans biofilms. (A) SEM images of S. mutans biofilms after a 24 h treatment with probiotics. 5000 and 10,000 are magnification. (B) The absorbance values after the staining of S. mutans biofilm. *** p < 0.001.
Figure 5. Effects of L. paracasei L9 and S. salivarius K12 on formation of S. mutans biofilms. (A) SEM images of S. mutans biofilms after a 24 h treatment with probiotics. 5000 and 10,000 are magnification. (B) The absorbance values after the staining of S. mutans biofilm. *** p < 0.001.
Foods 13 04118 g005
Table 1. The primers screened for specifically recognizing variant streptococci and Streptococcus oralis.
Table 1. The primers screened for specifically recognizing variant streptococci and Streptococcus oralis.
NumberForward Primers (5′-3′)Reverse Primers (5′-3′)Product Length (bp)
B1AGCGTTGTCCGGATTTATTGGAGCGTTGTCCGGATTTATTGG95
B2GCCTACAGCTCAGAGATGCTATTCTGCCATACACCACTCATGAATTGA180
B3AGCAATGCAGCCATCTACAAATACGAACTTTGCCGTTATTGTCA98
B4ACTGTTCCCCTTTTGGCTGTCAACTTGCTTTGATGACTGTGGC93
B5TGTACCCCGTATCGTTCCTGTGAAAGACTGGAGTTGCAATGTGAATA175
Table 2. The primers for caries-causing factors.
Table 2. The primers for caries-causing factors.
PrimersForward Sequences (5′-3′)Reverse Sequences (5′-3′)Reference
spaPTGATGTTGCTTCTTCTATGGAGCAGGTTAGTGTATGTAAGCTGT[18]
luxsCCCTATGTTCGCTTGATTGGGGAGTCAATCATGCCGTCAATGCG[19]
ciaHGCGAAGTGGAGTCAAAAACCAACTCTCCAAGCGATTTTGC[20]
gtfBCGAACAGCTTCTAATGGTGAAAAGCTTTTGGCTGCATTGCTATCATCA[21]
gtfCTGATTAACATGGATAACAGGCCAAACTGTTAGTGATCAGA[22]
gtfDCCAATATTCCGACAGCCTATGTCACCATAATAAAGACGTGTAATTGAA[23]
ldhCTTGATACTGCTCGTTTCCGTCGAGTCACCATGTTCACCCAT[18]
recAGCCTATGCTGCTGCTCTTGTCACCAATATCTCCGTCAATCTC[18]
S. mutansGCCTACAGCTCAGAGATGCTATTCTGCCATACACCACTCATGAATTGAThis study
Table 3. Alpha-diversity index difference test table.
Table 3. Alpha-diversity index difference test table.
Type of IndexControlModelL9K12p Value
(Model–Control)
p Value
(L9–Model)
p Value
(K12–Model)
Sobs119.9 ± 62.915102.57 ± 27.96984.3 ± 36.314128.33 ± 28.4650.5080.2820.073
Shannon1.792 ± 0.2611.662 ± 0.4641.659 ± 0.2771.966 ± 0.2840.4720.9840.093
Simpson0.259 ± 0.0520.344 ± 0.1330.298 ± 0.1110.241 ± 0.0650.0840.4500.036 *
Ace130.94 ± 65.275125.28 ± 31.646118.6 ± 39.195161.83 ± 45.610.8350.7150.080
Chao132.71 ± 67.921119.56 ± 29.068106.95 ± 36.224153.25 ± 32.3050.6390.4580.036 *
*: p < 0.05.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Pu, X.; Fang, B.; Wu, J.; Zhao, Z.; Liu, Y.; Li, J.; Gao, H.; Wang, R.; Zhang, M. Effects of Lacticaseibacillus paracasei L9 on Oral Microbiota and Cariogenic Factors in Streptococcus mutans-Infected Mice. Foods 2024, 13, 4118. https://doi.org/10.3390/foods13244118

AMA Style

Pu X, Fang B, Wu J, Zhao Z, Liu Y, Li J, Gao H, Wang R, Zhang M. Effects of Lacticaseibacillus paracasei L9 on Oral Microbiota and Cariogenic Factors in Streptococcus mutans-Infected Mice. Foods. 2024; 13(24):4118. https://doi.org/10.3390/foods13244118

Chicago/Turabian Style

Pu, Xinyao, Bing Fang, Jianmin Wu, Zhi Zhao, Yue Liu, Jingyu Li, Haina Gao, Ran Wang, and Ming Zhang. 2024. "Effects of Lacticaseibacillus paracasei L9 on Oral Microbiota and Cariogenic Factors in Streptococcus mutans-Infected Mice" Foods 13, no. 24: 4118. https://doi.org/10.3390/foods13244118

APA Style

Pu, X., Fang, B., Wu, J., Zhao, Z., Liu, Y., Li, J., Gao, H., Wang, R., & Zhang, M. (2024). Effects of Lacticaseibacillus paracasei L9 on Oral Microbiota and Cariogenic Factors in Streptococcus mutans-Infected Mice. Foods, 13(24), 4118. https://doi.org/10.3390/foods13244118

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop