Influences of Growth-Related Myopathies on Peptide Patterns of In Vitro Digested Cooked Chicken Breast and Stress-Related Responses in an Intestinal Caco-2 Cell Model
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials, Chemicals and Reagents
2.2. Samples and Sample Preparation
2.3. In Vitro Protein Digestion
2.4. Peptidomic Analysis
2.5. Cell Viability Assay
2.6. Absolute Transcript Abundance Analysis
2.7. Statistical Analysis
3. Results
3.1. Differences in the Peptidomic Profiles of Digested Chicken Breasts
3.2. The Effects of Growth-Related Myopathies on Caco-2 Cell Viability
3.3. Gene Expression Analysis
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Petracci, M.; Soglia, F.; Madruga, M.; Carvalho, L.; Ida, E.; Estévez, M. Wooden-Breast, White Striping, and Spaghetti Meat: Causes, Consequences and Consumer Perception of Emerging Broiler Meat Abnormalities. Compr. Rev. Food Sci. Food Saf. 2019, 18, 565–583. [Google Scholar] [CrossRef] [PubMed]
- Barbut, S. Recent Myopathies in Broiler’s Breast Meat Fillets. World’s Poult. Sci. J. 2019, 75, 559–582. [Google Scholar] [CrossRef]
- Sihvo, H.-K.; Immonen, K.; Puolanne, E. Myodegeneration with Fibrosis and Regeneration in the Pectoralis Major Muscle of Broilers. Vet. Pathol. 2014, 51, 619–623. [Google Scholar] [CrossRef] [PubMed]
- Griffin, J.R.; Moraes, L.; Wick, M.; Lilburn, M.S. Onset of White Striping and Progression into Wooden Breast as Defined by Myopathic Changes Underlying Pectoralis Major Growth. Estimation of Growth Parameters as Predictors for Stage of Myopathy Progression. Avian Pathol. 2018, 47, 2–13. [Google Scholar] [CrossRef]
- Kindlein, L.; TZ, F.; Driemeier, D.; Nascimento, V.; Vieira, S.; Moraes, L.; King, A.; Sainz, R. Occurrence and Severity of White Striping in Broilers Until 50d of Age Fed with High and Low-Energy Diets: Body Weight, Histopathological Changes and Meat Quality. J. Vet. Sci. Technol. 2017, 8, 1000478. [Google Scholar] [CrossRef]
- Hosotani, M.; Kawasaki, T.; Hasegawa, Y.; Wakasa, Y.; Hoshino, M.; Takahashi, N.; Ueda, H.; Takaya, T.; Iwasaki, T.; Watanabe, T. Physiological and Pathological Mitochondrial Clearance Is Related to Pectoralis Major Muscle Pathogenesis in Broilers With Wooden Breast Syndrome. Front. Physiol. 2020, 11, 579. [Google Scholar] [CrossRef] [PubMed]
- Malila, Y.; Thanatsang, K.; Arayamethakorn, S.; Uengwetwanit, T.; Srimarut, Y.; Petracci, M.; Strasburg, G.M.; Rungrassamee, W.; Visessanguan, W. Absolute Expressions of Hypoxia-Inducible Factor-1 Alpha (HIF1A) Transcript and the Associated Genes in Chicken Skeletal Muscle with White Striping and Wooden Breast Myopathies. PLoS ONE 2019, 14, 220904. [Google Scholar] [CrossRef]
- Soglia, F.; Mudalal, S.; Babini, E.; Di Nunzio, M.; Mazzoni, M.; Sirri, F.; Cavani, C.; Petracci, M. Histology, Composition, and Quality Traits of Chicken Pectoralis Major Muscle Affected by Wooden Breast Abnormality. Poult. Sci. 2016, 95, 651–659. [Google Scholar] [CrossRef]
- Soglia, F.; Gao, J.; Mazzoni, M.; Puolanne, E.; Cavani, C.; Petracci, M.; Ertbjerg, P. Superficial and Deep Changes of Histology, Texture and Particle Size Distribution in Broiler Wooden Breast Muscle during Refrigerated Storage. Poult. Sci. 2017, 96, 3465–3472. [Google Scholar] [CrossRef]
- Thanatsang, K.V.; Malila, Y.; Arayamethakorn, S.; Srimarut, Y.; Tatiyaborworntham, N.; Uengwetwanit, T.; Panya, A.; Rungrassamee, W.; Visessanguan, W. Nutritional Properties and Oxidative Indices of Broiler Breast Meat Affected by Wooden Breast Abnormality. Animals 2020, 10, 2272. [Google Scholar] [CrossRef] [PubMed]
- Li, B.; Dong, X.; Puolanne, E.; Ertbjerg, P. Effect of Wooden Breast Degree on Lipid and Protein Oxidation and Citrate Synthase Activity of Chicken Pectoralis Major Muscle. LWT 2022, 154, 112884. [Google Scholar] [CrossRef]
- Costa Filho, D.V.; Rocha, T.C.d.; de Carvalho, J.M.; de Carvalho, L.M.; Galvão, M.d.S.; Pedrao, M.R.; Estévez, M.; Madruga, M.S. Oxidative Stability of White Striping Chicken Breasts: Effect of Cold Storage and Heat Treatments. Poult. Sci. 2023, 102, 102826. [Google Scholar] [CrossRef]
- Papah, M.B.; Brannick, E.M.; Schmidt, C.J.; Abasht, B. Evidence and Role of Phlebitis and Lipid Infiltration in the Onset and Pathogenesis of Wooden Breast Disease in Modern Broiler Chickens. Avian Pathol. 2017, 46, 623–643. [Google Scholar] [CrossRef] [PubMed]
- Abasht, B.; Papah, M.B.; Qiu, J. Evidence of Vascular Endothelial Dysfunction in Wooden Breast Disorder in Chickens: Insights through Gene Expression Analysis, Ultra-Structural Evaluation and Supervised Machine Learning Methods. PLoS ONE 2021, 16, e0243983. [Google Scholar] [CrossRef] [PubMed]
- Törnvall, U. Pinpointing Oxidative Modifications in Proteins—Recent Advances in Analytical Methods. Anal. Methods 2010, 2, 1638–1650. [Google Scholar] [CrossRef]
- Soladoye, O.P.; Juárez, M.L.; Aalhus, J.L.; Shand, P.; Estévez, M. Protein Oxidation in Processed Meat: Mechanisms and Potential Implications on Human Health. Compr. Rev. Food Sci. Food Saf. 2015, 14, 106–122. [Google Scholar] [CrossRef] [PubMed]
- Estévez, M.; Xiong, Y. Intake of Oxidized Proteins and Amino Acids and Causative Oxidative Stress and Disease: Recent Scientific Evidences and Hypotheses. J. Food Sci. 2019, 84, 387–396. [Google Scholar] [CrossRef]
- Hardbower, D.M.; de Sablet, T.; Chaturvedi, R.; Wilson, K.T. Chronic Inflammation and Oxidative Stress. Gut Microbes 2013, 4, 475–481. [Google Scholar] [CrossRef] [PubMed]
- Huang, X.; Ahn, D.U. Lipid Oxidation and Its Implications to Meat Quality and Human Health. Food Sci. Biotechnol. 2019, 28, 1275–1285. [Google Scholar] [CrossRef]
- Srimarut, Y.; Phanphuet, A.; Trithavisup, T.; Rattanawongsa, W.; Saenmuangchin, R.; Klamchuen, A.; Malila, Y. Estimating In Vitro Protein Digestion and Protein Digestibility Corrected Amino Acid Score of Chicken Breasts Affected by White Striping and Wooden Breast Abnormalities. Foods 2024, 13, 159. [Google Scholar] [CrossRef] [PubMed]
- Trithavisup, T.; Krobthong, S.; Yingchutrakul, Y.; Sanpinit, P.; Malila, Y. Impact of Wooden Breast Myopathy on in Vitro Protein Digestibility, Metabolomic Profile, and Cell Cytotoxicity of Cooked Chicken Breast Meat. Poult. Sci. 2024, 103, 103261. [Google Scholar] [CrossRef]
- Sun, H.; Chow, E.C.; Liu, S.; Du, Y.; Pang, K.S. The Caco-2 Cell Monolayer: Usefulness and Limitations. Expert Opin. Drug Metab. Toxicol. 2008, 4, 395–411. [Google Scholar] [CrossRef] [PubMed]
- Mor, A.; Tankiewicz-Kwedlo, A.; Krupa, A.; Pawlak, D. Role of Kynurenine Pathway in Oxidative Stress during Neurodegenerative Disorders. Cells 2021, 10, 1603. [Google Scholar] [CrossRef] [PubMed]
- Merry, T.L.; Ristow, M. Nuclear Factor Erythroid-Derived 2-like 2 (NFE2L2, Nrf2) Mediates Exercise-Induced Mitochondrial Biogenesis and the Anti-Oxidant Response in Mice. J. Physiol. 2016, 594, 5195–5207. [Google Scholar] [CrossRef] [PubMed]
- Qian, Z.; Zhou, T.; Gurguis, C.I.; Xu, X.; Wen, Q.; Lv, J.; Fang, F.; Hecker, L.; Cress, A.E.; Natarajan, V.; et al. Nuclear Factor, Erythroid 2-like 2-Associated Molecular Signature Predicts Lung Cancer Survival. Sci. Rep. 2015, 5, 16889. [Google Scholar] [CrossRef] [PubMed]
- Villavicencio Tejo, F.; Quintanilla, R.A. Contribution of the Nrf2 Pathway on Oxidative Damage and Mitochondrial Failure in Parkinson and Alzheimer’s Disease. Antioxidants 2021, 10, 1069. [Google Scholar] [CrossRef]
- McCord, J.M.; Fridovich, I. Superoxide Dismutase: An Enzymic Function for Erythrocuprein (Hemocuprein). J. Biol. Chem. 1969, 244, 6049–6055. [Google Scholar] [CrossRef]
- Fukai, T.; Ushio-Fukai, M. Superoxide Dismutases: Role in Redox Signaling, Vascular Function, and Diseases. Antioxid. Redox Signal. 2011, 15, 1583–1606. [Google Scholar] [CrossRef]
- Milholli, L.A.; Dalbó, J.; Couto, C.V.M.S.; Oliveira, M.M.; Santos, J.G.d.; Peterle, G.T.; Archanjo, A.B.; Silva, P.I.; Boeloni, J.N.; Nunes, F.D.; et al. Effects of the Juçara Fruit (Euterpe edulis Martius) Pulp and Lyophilized Extract on NRF2, KEAP1, SOD1, and GPX2 Expression in Human Colorectal Cancer Cell Lines. Braz. J. Med. Biol. Res. 2023, 56, e12558. [Google Scholar] [CrossRef]
- Bunton-Stasyshyn, R.K.A.; Saccon, R.A.; Fratta, P.; Fisher, E.M.C. SOD1 Function and Its Implications for Amyotrophic Lateral Sclerosis Pathology: New and Renascent Themes. Neuroscientist 2015, 21, 519–529. [Google Scholar] [CrossRef] [PubMed]
- Al-Zharani, M.; Alkahtane, A.A.; AL-Johani, N.S.; Almutairi, B.; Alkeraishan, N.; Alarifi, S.; Alrajeh, S.M.; Yaseen, K.N.; Aljarba, N.H.; Nasr, F.A.; et al. Investigating the Effect of Resveratrol on Apoptosis and Regulation of Gene Expression of Caco-2 Cells: Unravelling Potential Implications for Colorectal Cancer Treatment. Open Chem. 2024, 22, 20240012. [Google Scholar] [CrossRef]
- Semenza, G.L. Hydroxylation of HIF-1: Oxygen Sensing at the Molecular Level. Physiology 2004, 19, 176–182. [Google Scholar] [CrossRef]
- Barbut, S.; Mitchell, R.; Hall, P.; Bacon, C.; Bailey, R.; Owens, C.M.; Petracci, M. Review: Myopathies in Broilers: Supply Chain Approach to Provide Solutions to Challenges Related to Raising Fast Growing Birds. Poult. Sci. 2024, 103, 103801. [Google Scholar] [CrossRef]
- Lowry, O.H.; Rosebrough, N.J.; Farr, A.L.; Randall, R.J. Protein Measurement with the Folin Phenol Reagent. J. Biol. Chem. 1951, 193, 265–275. [Google Scholar] [CrossRef]
- Tyanova, S.; Temu, T.; Cox, J. The MaxQuant Computational Platform for Mass Spectrometry-Based Shotgun Proteomics. Nat. Protoc. 2016, 11, 2301–2319. [Google Scholar] [CrossRef]
- Tyanova, S.; Temu, T.; Sinitcyn, P.; Carlson, A.; Hein, M.Y.; Geiger, T.; Mann, M.; Cox, J. The Perseus Computational Platform for Comprehensive Analysis of (Prote)Omics Data. Nat. Methods 2016, 13, 731–740. [Google Scholar] [CrossRef]
- Pang, Z.; Lu, Y.; Zhou, G.; Hui, F.; Xu, L.; Viau, C.; Spigelman, A.F.; MacDonald, P.E.; Wishart, D.S.; Li, S.; et al. MetaboAnalyst 6.0: Towards a Unified Platform for Metabolomics Data Processing, Analysis and Interpretation. Nucleic Acids Res. 2024, 52, W398–W406. [Google Scholar] [CrossRef] [PubMed]
- OECD. Test No. 439: In Vitro Skin Irritation: Reconstructed Human Epidermis Test Method; OECD Guidelines for the Testing of Chemicals, Section 4; OECD: Paris, France, 2021; ISBN 9789264242845. Available online: https://doi.org/10.1787/9789264242845-en (accessed on 6 March 2024).
- MatTek Corporation. MTT Effective Time-50 (ET-50) Protocol For Use with EpiOral™ (ORL-200) or EpiGingival (GIN-100) Tissue Models I. Storage of Tissue (ORL-200 or GIN-100) and MTT Kit (MTT-100). Available online: https://www.mattek.com/wp-content/uploads/ORL-200_GIN-100-Protocol-MK-24-007-0003.pdf (accessed on 6 March 2024).
- MatTek Corporation. In Vitro Skin Irritation Test For Medical Device Extracts Table of Contents. Available online: https://www.mattek.com/wp-content/uploads/EPI-200-SIT-Medical-Devices-Testing-Protocol-MK-24-007-0121_08_28_2023.pdf (accessed on 6 March 2024).
- Malila, Y.; Thanatsang, K.V.; Sanpinit, P.; Arayamethakorn, S.; Soglia, F.; Zappaterra, M.; Bordini, M.; Rungrassamee, W.; Davoli, R.; Petracci, M. Differential Expression Patterns of Genes Associated with Metabolisms, Muscle Growth and Repair in Pectoralis Major Muscles of Fast- and Medium-Growing Chickens. PLoS ONE 2022, 17, e0275160. [Google Scholar] [CrossRef]
- Soglia, F.; Silva, A.K.; Lião, L.M.; Laghi, L.; Petracci, M. Effect of Broiler Breast Abnormality and Freezing on Meat Quality and Metabolites Assessed by 1 H-NMR Spectroscopy. Poult. Sci. 2019, 98, 7139–7150. [Google Scholar] [CrossRef]
- Miner-Williams, W.M.; Stevens, B.R.; Moughan, P.J. Are Intact Peptides Absorbed from the Healthy Gut in the Adult Human? Nutr. Res. Rev. 2014, 27, 308–329. [Google Scholar] [CrossRef] [PubMed]
- Adams, D.J. Dipeptide and Tripeptide Conjugates as Low-Molecular-Weight Hydrogelators. Macromol. Biosci. 2011, 11, 160–173. [Google Scholar] [CrossRef]
- United States Department of Agriculture Foreign Agricultural Service. Livestock and Poultry: World Markets and Trade. Available online: https://apps.fas.usda.gov/psdonline/circulars/livestock_poultry.pdf (accessed on 30 August 2024).
- Tasoniero, G.; Cullere, M.; Cecchinato, M.; Puolanne, E.; Dalle Zotte, A. Technological Quality, Mineral Profile, and Sensory Attributes of Broiler Chicken Breasts Affected by White Striping and Wooden Breast Myopathies. Poult. Sci. 2016, 95, 2707–2714. [Google Scholar] [CrossRef] [PubMed]
- Tijare, V.V.; Yang, F.L.; Kuttappan, V.A.; Alvarado, C.Z.; Coon, C.N.; Owens, C.M. Meat Quality of Broiler Breast Fillets with White Striping and Woody Breast Muscle Myopathies. Poult. Sci. 2016, 95, 2167–2173. [Google Scholar] [CrossRef] [PubMed]
- Xing, T.; Zhao, X.; Han, M.; Cai, L.; Deng, S.; Zhou, G.; Xu, X. A Comparative Study of Functional Properties of Normal and Wooden Breast Broiler Chicken Meat with NaCl Addition1 1This Research Was Funded by China Agricultural Research System (Beijing, China, CARS-42) and National Natural Science Foundation of China (31571854). Poult. Sci. 2017, 96, 3473–3481. [Google Scholar] [CrossRef] [PubMed]
- Tasoniero, G.; Bertram, H.C.; Young, J.F.; Dalle Zotte, A.; Puolanne, E. Relationship between Hardness and Myowater Properties in Wooden Breast Affected Chicken Meat: A Nuclear Magnetic Resonance Study. LWT 2017, 86, 20–24. [Google Scholar] [CrossRef]
- Soglia, F.; Laghi, L.; Canonico, L.; Cavani, C.; Petracci, M. Functional Property Issues in Broiler Breast Meat Related to Emerging Muscle Abnormalities. Food Res. Int. 2016, 89, 1071–1076. [Google Scholar] [CrossRef]
- Mudalal, S.; Lorenzi, M.; Soglia, F.; Cavani, C.; Petracci, M. Implications of White Striping and Wooden Breast Abnormalities on Quality Traits of Raw and Marinated Chicken Meat. Animal 2015, 9, 728–734. [Google Scholar] [CrossRef]
- Chen, L.R.; Suyemoto, M.M.; Sarsour, A.H.; Cordova, H.A.; Oviedo-Rondón, E.O.; Wineland, M.; Barnes, H.J.; Borst, L.B. Temporal Characterization of Wooden Breast Myopathy (“Woody Breast”) Severity and Correlation with Growth Rate and Lymphocytic Phlebitis in Three Commercial Broiler Strains and a Random-Bred Broiler Strain. Avian Pathol. 2019, 48, 319–328. [Google Scholar] [CrossRef] [PubMed]
- Zambonelli, P.; Zappaterra, M.; Soglia, F.; Petracci, M.; Sirri, F.; Cavani, C.; Davoli, R. Detection of Differentially Expressed Genes in Broiler Pectoralis Major Muscle Affected by White Striping—Wooden Breast Myopathies. Poult. Sci. 2016, 95, 2771–2785. [Google Scholar] [CrossRef]
- Sihvo, H.-K.; Airas, N.; Lindén, J.; Puolanne, E. Pectoral Vessel Density and Early Ultrastructural Changes in Broiler Chicken Wooden Breast Myopathy. J. Comp. Pathol. 2018, 161, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Malila, Y.; Uengwetwanit, T.; Arayamethakorn, S.; Srimarut, Y.; Thanatsang, K.V.; Soglia, F.; Strasburg, G.M.; Rungrassamee, W.; Visessanguan, W. Transcriptional Profiles of Skeletal Muscle Associated With Increasing Severity of White Striping in Commercial Broilers. Front. Physiol. 2020, 11, 580. [Google Scholar] [CrossRef] [PubMed]
- Malila, Y.; Uengwetwanit, T.; Thanatsang, K.V.; Arayamethakorn, S.; Srimarut, Y.; Petracci, M.; Soglia, F.; Rungrassamee, W.; Visessanguan, W. Insights Into Transcriptome Profiles Associated With Wooden Breast Myopathy in Broilers Slaughtered at the Age of 6 or 7 Weeks. Front. Physiol. 2021, 12, 691194. [Google Scholar] [CrossRef]
- Chang, Y.B.; Kim, H.; Lee, S.K.; Kim, H.-J.; Jeong, A.-H.; Suh, H.J.; Ahn, Y. Characteristics and Absorption Rate of Whey Protein Hydrolysates Prepared Using Flavourzyme after Treatment with Alcalase and Protamex. Molecules 2023, 28, 7969. [Google Scholar] [CrossRef]
- Kęska, P.; Rohn, S.; Halagarda, M.; Wójciak, K.M. Peptides from Different Carcass Elements of Organic and Conventional Pork—Potential Source of Antioxidant Activity. Antioxidants 2020, 9, 835. [Google Scholar] [CrossRef]
- Gupta, P.K. Chapter 1—General Toxicology. In Illustrated Toxicology; Gupta, P.K., Ed.; Academic Press: Cambridge, MA, USA, 2018; pp. 1–65. ISBN 978-0-12-813213-5. [Google Scholar]
- Shao, D.; Gao, Z.; Zhao, Y.; Fan, M.; Zhao, X.; Wei, Q.; Pan, M.; Ma, B. Sulforaphane Suppresses H2O2-Induced Oxidative Stress and Apoptosis via the Activation of AMPK/NFE2L2 Signaling Pathway in Goat Mammary Epithelial Cells. Int. J. Mol. Sci. 2023, 24, 1070. [Google Scholar] [CrossRef] [PubMed]
- Dobrowolny, G.; Aucello, M.; Musarò, A. Muscle Atrophy Induced by SOD1G93A Expression Does Not Involve the Activation of Caspase in the Absence of Denervation. Skelet. Muscle 2011, 1, 3. [Google Scholar] [CrossRef] [PubMed]
- Baldelli, S.; Aquilano, K.; Rotilio, G.; Ciriolo, M.R. Glutathione and Copper, Zinc Superoxide Dismutase Are Modulated by Overexpression of Neuronal Nitric Oxide Synthase. Int. J. Biochem. Cell Biol. 2008, 40, 2660–2670. [Google Scholar] [CrossRef] [PubMed]
- Thomas, S.; Kotamraju, S.; Zielonka, J.; Harder, D.R.; Kalyanaraman, B. Hydrogen Peroxide Induces Nitric Oxide and Proteosome Activity in Endothelial Cells: A Bell-Shaped Signaling Response. Free Radic. Biol. Med. 2007, 42, 1049–1061. [Google Scholar] [CrossRef]
Accession NO. | Gene ID | Sequence (5′-3′) | Amplicon Size (bp) | Annealing Temperature (°C) | Template Used (ng) |
---|---|---|---|---|---|
AF208487.1 | HIF1A | F: TCACCTGAGCCTAATAGTCC | 121 | 55 | 500 |
R: ATGGGTTCTTTGCTTCTGTG | |||||
KJ891696.1 | NFE2L2 | F: CACATCCAGTCAGAAACCAG | 143 | 60 | 25 |
R: GCCGAAGAAACCTCATTGTC | |||||
NM_000454.5 | SOD1 | F: TCTGTGATCTCACTCTCAGG | 168 | 60 | 100 |
R: AGGGAATGTTTATTGGGCGA |
Sample | % Mass Distribution |
---|---|
Normal | 85.13 |
WB | 86.64 |
WS | 84.43 |
WS + WB | 83.65 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Malila, Y.; Saensa-ard, S.; Kunyanee, C.; Petpiroon, N.; Kosit, N.; Charoenlappanit, S.; Phaonakrop, N.; Srimarut, Y.; Aueviriyavit, S.; Roytrakul, S. Influences of Growth-Related Myopathies on Peptide Patterns of In Vitro Digested Cooked Chicken Breast and Stress-Related Responses in an Intestinal Caco-2 Cell Model. Foods 2024, 13, 4042. https://doi.org/10.3390/foods13244042
Malila Y, Saensa-ard S, Kunyanee C, Petpiroon N, Kosit N, Charoenlappanit S, Phaonakrop N, Srimarut Y, Aueviriyavit S, Roytrakul S. Influences of Growth-Related Myopathies on Peptide Patterns of In Vitro Digested Cooked Chicken Breast and Stress-Related Responses in an Intestinal Caco-2 Cell Model. Foods. 2024; 13(24):4042. https://doi.org/10.3390/foods13244042
Chicago/Turabian StyleMalila, Yuwares, Sunitta Saensa-ard, Chanikarn Kunyanee, Nalinrat Petpiroon, Nantanat Kosit, Sawanya Charoenlappanit, Narumon Phaonakrop, Yanee Srimarut, Sasitorn Aueviriyavit, and Sittiruk Roytrakul. 2024. "Influences of Growth-Related Myopathies on Peptide Patterns of In Vitro Digested Cooked Chicken Breast and Stress-Related Responses in an Intestinal Caco-2 Cell Model" Foods 13, no. 24: 4042. https://doi.org/10.3390/foods13244042
APA StyleMalila, Y., Saensa-ard, S., Kunyanee, C., Petpiroon, N., Kosit, N., Charoenlappanit, S., Phaonakrop, N., Srimarut, Y., Aueviriyavit, S., & Roytrakul, S. (2024). Influences of Growth-Related Myopathies on Peptide Patterns of In Vitro Digested Cooked Chicken Breast and Stress-Related Responses in an Intestinal Caco-2 Cell Model. Foods, 13(24), 4042. https://doi.org/10.3390/foods13244042