Exploring the Neuroprotective Effects of Grape Seed Procyanidins on Amyloid-β-Induced Toxicity in Caenorhabditis elegans
Abstract
1. Introduction
2. Materials and Methods
2.1. Standards and Reagents
2.2. Caenorhabditis elegans Strains
2.3. Grape Seed Polyphenol Extract (GSPE)
2.3.1. GSPE Preparation
2.3.2. GSPE Characterization
2.4. C. elegans Maintenance
2.5. Paralysis Assay
2.6. Lifespan Assay
2.7. Chemotaxis Assays
2.8. Proteasomal Activity
2.9. Gene Expression Assay
2.10. Statistical Analysis
3. Results
3.1. Characterization of the Grape Seed Polyphenol Extract (GSPE)
3.2. Paralysis Assays
3.3. Longevity Assays
3.4. Chemotaxis Assays
3.5. Proteasomal Activity
3.6. Gene Expression Assays
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Breijyeh, Z.; Karaman, R. Comprehensive Review on Alzheimer’s Disease: Causes and Treatment. Molecules 2020, 25, 5789. [Google Scholar] [CrossRef] [PubMed]
- DeTure, M.A.; Dickson, D.W. The neuropathological diagnosis of Alzheimer’s disease. Mol. Neurodegener. 2019, 14, 32–39. [Google Scholar] [CrossRef] [PubMed]
- Bukhari, S.N.A. Dietary Polyphenols as Therapeutic Intervention for Alzheimer’s Disease: A Mechanistic Insight. Antioxidants 2022, 11, 554. [Google Scholar] [CrossRef] [PubMed]
- Yu, T.W.; Lane, H.Y.; Lin, C.H. Novel Therapeutic Approaches for Alzheimer’s Disease: An Updated Review. Int. J. Mol. Sci. 2021, 22, 8208. [Google Scholar] [CrossRef]
- Niu, H.; Álvarez-Álvarez, I.; Guillén-Grima, F.; Aguinaga-Ontoso, I. Prevalence and incidence of Alzheimer’s disease in Europe: A meta-analysis. Neurología 2017, 32, 523–532. [Google Scholar] [CrossRef]
- Stefaniak, O.; Dobrzyńska, M.; Drzymała-Czyż, S.; Przysławski, J. Diet in the Prevention of Alzheimer’s Disease: Current Knowledge and Future Research Requirements. Nutrients 2022, 21, 4564. [Google Scholar] [CrossRef]
- Grant, W.B.; Blake, S.M. Diet’s Role in Modifying Risk of Alzheimer’s Disease: History and Present Understanding. J. Alzheimer’s Dis. 2023, 4, 1353–1382. [Google Scholar] [CrossRef]
- Hayden, E.Y.; Yamin, G.; Beroukhim, S.; Chen, B.; Kibalchenko, M.; Jiang, L.; Ho, L.; Wang, J.; Pasinetti, G.M.; Teplow, D.B. Inhibiting amyloid β-protein assembly: Size-activity relationships among grape seed-derived polyphenols. J. Neurochem. 2015, 135, 416–430. [Google Scholar] [CrossRef]
- Wang, Y.J.; Thomas, P.; Zhong, J.H.; Bi, F.F.; Kosaraju, S.; Pollard, A.; Fenech, M.; Zhou, X.F. Consumption of Grape Seed Extract Prevents Amyloid-β Deposition and Attenuates Inflammation in Brain of an Alzheimer’s Disease Mouse. Neurotox. Res. 2009, 15, 3–14. [Google Scholar] [CrossRef]
- Pasinetti, G.M.; Ho, L. Role of grape seed polyphenols in Alzheimer’s disease neuropathology. Nutr. Diet. Suppl. 2010, 2, 97–103. [Google Scholar] [CrossRef]
- Lian, Q.; Nie, Y.; Zhang, X.; Tan, B.; Cao, H.; Chen, W.; Gao, W.; Chen, J.; Liang, Z.; Lai, H.; et al. Effects of grape seed proanthocyanidin on Alzheimer’s disease in vitro and in vivo. Exp. Ther. Med. 2016, 12, 1681–1692. [Google Scholar] [CrossRef] [PubMed]
- Sun, Q.; Jia, N.; Li, X.; Yang, J.; Chen, G. Grape seed proanthocyanidins ameliorate neuronal oxidative damage by inhibiting GSK-3β-dependent mitochondrial permeability transition pore opening in an experimental model of sporadic Alzheimer’s disease. Aging 2019, 11, 4107–4124. [Google Scholar] [CrossRef] [PubMed]
- Serra, A.; Macià, A.; Romero, M.P.; Valls, J.; Bladé, C.; Arola, L.; Motilva, M.J. Bioavailability of procyanidin dimers and trimers and matrix food effects in in vitro and in vivo models. Br. J. Nutr. 2010, 103, 944–952. [Google Scholar] [CrossRef] [PubMed]
- Elejalde, E.; Villarán, M.C.; Esquivel, A.; Alonso, R.M. Bioaccessibility and Antioxidant Capacity of Grape Seed and Grape Skin Phenolic Compounds After Simulated In Vitro Gastrointestinal Digestion. Plant Foods Hum. Nutr. 2024, 79, 432–439. [Google Scholar] [CrossRef]
- Chen, T.; Ferruzzi, M.G.; Wu, Q.; Simon, J.E.; Talcott, S.T.; Wang, J.; Ho, L.; Todd, G.; Cooper, B.; Pasinetti, G.M.; et al. Influence of diabetes on plasma pharmacokinetics and brain bioavailability of grape polyphenols and their phase II metabolites in the Zucker diabetic fatty rat. Mol. Nutr. Food Res. 2017, 61, 1700111. [Google Scholar] [CrossRef]
- Wang, J.; Tang, C.; Ferruzzi, M.G.; Gong, B.; Song, B.J.; Janle, E.M.; Chen, T.; Cooper, B.; Varghese, M.; Cheng, A.; et al. Role of standardized grape polyphenol preparation as a novel treatment to improve synaptic plasticity through attenuation of features of metabolic syndrome in a mouse model. Mol. Nutr. Food Res. 2013, 57, 2091–2102. [Google Scholar] [CrossRef]
- Faria, A.; Meireles, M.; Fernandes, I.; Santos-Buelga, C.; González-Manzano, S.; Dueñas, M.; de Freitas, V.; Mateus, N.; Calhau, C. Flavonoid metabolites transport across a human BBB model. Food Chem. 2014, 149, 190–196. [Google Scholar] [CrossRef]
- Cox, C.J.; Choudhary, S.; Peacey, E.; Perkinton, M.S.; Perry, V.H.; Williams, R.J. Dietary (−)-epicatechin as a potent inhibitor of βγ-secretase APP processing and amyloid plaque formation in vivo. J. Neurosci. 2015, 32, 5144–5151. [Google Scholar]
- Wang, J.; Ferruzzi, M.G.; Ho, L.; Blount, J.; Janle, E.M.; Gong, B.; Pan, Y.; Gowda, G.N.; Raftery, D.; Arrieta-Cruz, I.; et al. Brain-targeted proanthocyanidin metabolites for Alzheimer’s disease treatment. J. Neurosci. 2012, 32, 5144–5150. [Google Scholar] [CrossRef]
- Cuevas, E.; Limón, D.; Pérez-Severiano, F.; Díaz, A.; Ortega, L.; Zenteno, E.; Guevara, J. Antioxidant effects of epicatechin on the hippocampal toxicity caused by amyloid-beta 25-35 in rats. Eur. J. Pharmacol. 2009, 15, 122–127. [Google Scholar] [CrossRef]
- Wang, D.; Ho, L.; Faith, J.; Ono, K.; Janle, E.M.; Lachcik, P.J.; Cooper, B.R.; Jannasch, A.H.; D’Arcy, B.R.; Williams, B.A.; et al. Role of intestinal microbiota in the generation of polyphenol-derived phenolic acid mediated attenuation of Alzheimer’s disease β-amyloid oligomerization. Mol. Nutr. Food Res. 2015, 59, 1025–1040. [Google Scholar] [CrossRef] [PubMed]
- Shen, P.; Yue, Y.; Zheng, J.; Park, Y. Caenorhabditis elegans: A Convenient In Vivo Model for Assessing the Impact of Food Bioactive Compounds on Obesity, Aging, and Alzheimer’s Disease. Annu. Rev. Food Sci. Technol. 2018, 9, 1–22. [Google Scholar] [CrossRef] [PubMed]
- Link, C.D. C. elegans Models of Age-Associated Neurodegenerative Diseases: Lessons from Transgenic Worm Models of Alzheimer’s Disease. Exp. Gerontol. 2006, 41, 1007–1013. [Google Scholar] [CrossRef] [PubMed]
- Fay, D.S.; Fluet, A.; Johnson, C.J.; Link, C.D. In Vivo Aggregation of β-Amyloid Peptide Variants. J. Neurochem. 1998, 71, 1616–1625. [Google Scholar] [CrossRef]
- Margie, O.; Palmer, C.; Chin-Sang, I. C. elegans Chemotaxis Assay. J. Vis. Exp. 2013, 74, e50069. [Google Scholar]
- Chen, W.; Lin, H.R.; Wei, C.M.; Luo, X.H.; Sun, M.L.; Yang, Z.Z.; Chen, X.Y.; Wang, H.B. Echinacoside, a Phenylethanoid Glycoside from Cistanche deserticola, Extends Lifespan of Caenorhabditis elegans and Protects from Aβ-Induced Toxicity. Biogerontology 2018, 19, 47–65. [Google Scholar] [CrossRef]
- Dosanjh, L.E.; Brown, M.K.; Rao, G.; Link, C.D.; Luo, Y. Behavioral Phenotyping of a Transgenic Caenorhabditis elegans Expressing Neuronal Amyloid-β. J. Alzheimer’s Dis. 2010, 19, 681–690. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Zhang, Y.; Chen, D.; Smith, M.A.; Zhang, B.; Pan, X. Selection of reliable reference genes in Caenorhabditis elegans for analysis of nanotoxicity. PLoS ONE 2012, 7, e31849. [Google Scholar] [CrossRef]
- González-Manzano, S.; Rivas-Gonzalo, J.C.; Santos-Buelga, C. Extraction of flavan-3-ols from grape seed and skin into wine using simulated maceration. Anal. Chim. Acta 2004, 513, 283–289. [Google Scholar] [CrossRef]
- Cai, W.J.; Huang, J.H.; Zhang, S.Q.; Wu, B.; Kapahi, P.; Zhang, X.M.; Shen, Z.Y. Icariin and Its Derivative Icariside II Extend Healthspan via Insulin/IGF-1 Pathway in C. elegans. PLoS ONE 2011, 6, e28835. [Google Scholar] [CrossRef] [PubMed]
- Diomede, L.; Rigacci, S.; Romeo, M.; Stefani, M.; Salmona, M. Oleuropein Aglycone Protects Transgenic C. elegans Strains Expressing Aβ42 by Reducing Plaque Load and Motor Deficit. PLoS ONE 2013, 8, e58893. [Google Scholar] [CrossRef] [PubMed]
- Bai, X.; Liu, C.M.; Li, H.J.; Zhang, Z.P.; Cui, W.B.; An, F.L.; Zhang, Z.X.; Wang, D.S.; Fei, D.Q. Ethyl caffeate attenuates Aβ-induced toxicity in Caenorhabditis elegans AD models via the insulin/insulin-like growth factor-1 signaling pathway. Bioorg. Chem. 2023, 139, 106714. [Google Scholar] [CrossRef] [PubMed]
- Wu, Y.; Wu, Z.; Butko, P.; Christen, Y.; Lambert, M.P.; Klein, W.L.; Link, C.D.; Luo, Y. Amyloid-β-Induced Pathological Behaviors Are Suppressed by Ginkgo biloba Extract EGB 761 and Ginkgolides in Transgenic Caenorhabditis elegans. J. Neurosci. Off. J. Soc. Neurosci. 2006, 26, 13102–13113. [Google Scholar] [CrossRef]
- Aparecida Paiva, F.; de Freitas Bonomo, L.; Ferreira Boasquivis, P.; Borges Raposo de Paula, I.T.; Guerra, J.F.D.C.; Mendes Leal, W.; Silva, M.E.; Pedrosa, M.L.; Oliveira, R.D.P. Carqueja (Baccharis trimera) Protects against Oxidative Stress and β-Amyloid-Induced Toxicity in Caenorhabditis elegans. Oxid. Med. Cell Longev. 2015, 7, 740162. [Google Scholar]
- Du, F.; Zhou, L.; Jiao, Y.; Bai, S.; Wang, L.; Ma, J.; Fu, X. Ingredients in Zijuan Pu’er Tea Extract Alleviate β-Amyloid Peptide Toxicity in a Caenorhabditis elegans Model of Alzheimer’s Disease Likely through Daf-16. Molecules 2019, 24, 729. [Google Scholar] [CrossRef]
- Liu, S.; Xiao, C.; Wang, F. Comparison of Two Varieties Fig (Peggy Red and Green) Peel Extracts by Liquid Chromatography-Tandem Mass Spectrometry Analysis and for Neuroprotective Efficacy in Caenorhabditis elegans. J. Med. Food 2023, 26, 14–26. [Google Scholar] [CrossRef]
- Rezaee, N.; Fernando, W.B.; Hone, E.; Sohrabi, H.R.; Johnson, S.K.; Gunzburg, S.; Martins, R.N. Potential of Sorghum Polyphenols to Prevent and Treat Alzheimer’s Disease: A Review Article. Front. Aging Neurosci. 2021, 6, 729949. [Google Scholar] [CrossRef]
- Snow, A.D.; Castillo, G.M.; Nguyen, B.P.; Choi, P.Y.; Cummings, J.A.; Cam, J.; Hu, Q.; Lake, T.; Pan, W.; Kastin, A.J.; et al. The Amazon Rain Forest Plant Uncaria tomentosa (Cat’s Claw) and Its Specific Proanthocyanidin Constituents Are Potent Inhibitors and Reducers of Both Brain Plaques and Tangles. Sci. Rep. 2019, 9, 561–574. [Google Scholar] [CrossRef]
- Link, C.D. Expression of Human F8-Amyloid Peptide in Transgenic Caenorhabditis elegans. Proc. Natl. Acad. Sci. USA 1995, 92, 9368–9372. [Google Scholar] [CrossRef]
- Ayuda-Durán, B.; Garzón-García, L.; González-Manzano, S.; Santos-Buelga, C.; González-Paramás, A.M. Insights into the Neuroprotective Potential of Epicatechin: Effects against Aβ-Induced Toxicity in Caenorhabditis elegans. Antioxidants 2024, 13, 79. [Google Scholar] [CrossRef] [PubMed]
- Regitz, C.; Dußling, L.M.; Wenzel, U. Amyloid-beta (Aβ1–42)-induced paralysis in Caenorhabditis elegans is inhibited by the polyphenol quercetin through activation of protein degradation pathways. Mol. Nutr. Food Res. 2014, 58, 1931–1940. [Google Scholar] [CrossRef] [PubMed]
- Regitz, C.; Fitzenberger, E.; Mahn, F.L.; Dußling, L.M.; Wenzel, U. Resveratrol reduces amyloid-beta (Aβ₁₋₄₂)-induced paralysis through targeting proteostasis in an Alzheimer model of Caenorhabditis elegans. Eur. J. Nutr. 2016, 55, 741–747. [Google Scholar] [CrossRef] [PubMed]
- Abbas, S.; Wink, M. Epigallocatechin gallate inhibits beta amyloid oligomerization in Caenorhabditis elegans and affects the daf-2/insulin-like signaling pathway. Phytomedicine 2010, 17, 902–909. [Google Scholar] [CrossRef]
- Colizzi, C. The protective effects of polyphenols on Alzheimer’s disease: A systematic review. Alzheimer’s Dement. 2018, 5, 184–196. [Google Scholar] [CrossRef]
- Chahar, M.K.; Sharma, N.; Dobhal, M.P.; Joshi, Y.C. Flavonoids: A versatile source of anticancer drugs. Pharmacogn. Rev. 2011, 5, 1–12. [Google Scholar]
- Leclerc, M.; Dudonné, S.; Calon, F. Can Natural Products Exert Neuroprotection without Crossing the Blood-Brain Barrier? Int. J. Mol. Sci. 2021, 22, 3356. [Google Scholar] [CrossRef]
- Yang, S.; Rosenwald, A. Small GTPase proteins in macroautophagy. Small GTPases 2018, 9, 409–414. [Google Scholar] [CrossRef]
- Gea-González, A.; Hernández-García, S.; Henarejos-Escudero, P.; Martínez-Rodríguez, P.; García-Carmona, F.; Gandía-Herrero, F. Polyphenols from traditional Chinese medicine and Mediterranean diet are effective against Aβ toxicity in vitro and in vivo in Caenorhabditis elegans. Food Funct. 2022, 7, 1206–1217. [Google Scholar] [CrossRef]
- Chen, Y.; Wang, Y.; Qin, Q.; Zhang, Y.; Xie, L.; Xiao, J.; Cao, Y.; Su, Z.; Chen, Y. Carnosic acid ameliorated Aβ-mediated (amyloid-β peptide) toxicity, cholinergic dysfunction and mitochondrial defect in Caenorhabditis elegans of Alzheimer’s Model. Food Funct. 2022, 13, 4624–4640. [Google Scholar] [CrossRef]
- Zhang, X.G.; Wang, X.; Zhou, T.T.; Wu, X.F.; Peng, Y.; Zhang, W.Q.; Li, S.; Zhao, J. Scorpion Venom Heat-Resistant Peptide Protects Transgenic Caenorhabditis elegans from β-Amyloid Toxicity. Front. Pharmacol. 2016, 7, 227–238. [Google Scholar] [CrossRef] [PubMed]
- Ksiezak-Reding, H.; Ho, L.; Santa-Maria, I.; Diaz-Ruiz, C.; Wang, J.; Pasinetti, G.M. Ultrastructural alterations of Alzheimer’s disease paired helical filaments by grape seed-derived polyphenols. Neurobiol. Aging 2012, 33, 1427–1439. [Google Scholar] [CrossRef] [PubMed]
- Guéroux, M.; Fleau, C.; Slozeck, M.; Laguerre, M.; Pianet, I. Epigallocatechin 3-Gallate as an Inhibitor of Tau Phosphorylation and Aggregation: A Molecular and Structural Insight. J. Prev. Alzheimer’s Dis. 2017, 4, 218–225. [Google Scholar] [PubMed]
- Hornedo-Ortega, R.; Álvarez-Fernández, M.A.; Cerezo, A.B.; Richard, T.; Troncoso, A.M.A.; Garcia-Parrilla, M.A.C. Protocatechuic Acid: Inhibition of Fibril Formation, Destabilization of Preformed Fibrils of Amyloid-β and α-Synuclein, and Neuroprotection. J. Agric. Food Chem. 2016, 19, 7722–7732. [Google Scholar] [CrossRef]
- Tang, Y.; Xiong, R.; Wu, A.G.; Yu, C.L.; Zhao, Y.; Qiu, W.Q.; Wang, X.L.; Teng, J.F.; Liu, J.; Chen, H.X.; et al. Polyphenols Derived from Lychee Seed Suppress Aβ(1-42)-Induced Neuroinflammation. Int. J. Mol. Sci. 2018, 19, 2109. [Google Scholar] [CrossRef]
- Hipp, M.S.; Park, S.H.; Hartl, F.U. Proteostasis impairment in protein-misfolding and -aggregation diseases. Trends Cell Biol. 2014, 24, 506–514. [Google Scholar] [CrossRef]
- Kapulkin, V.; Hiester, B.G.; Link, C.D. Compensatory Regulation among ER Chaperones in C. elegans. FEBS Lett. 2005, 579, 3063–3068. [Google Scholar] [CrossRef]
- Navarro-Hortal, M.D.; Romero-Márquez, J.M.; Osta, S.; Jiménez-Trigo, V.; Muñoz-Ollero, P.; Varela-López, A. Natural Bioactive Products and Alzheimer’s Disease Pathology: Lessons from Caenorhabditis elegans Transgenic Models. Diseases 2022, 10, 28. [Google Scholar] [CrossRef]
- Ayuda-Durán, B.; González-Manzano, S.; Gil-Sánchez, I.; Victoria Moreno-Arribas, M.; Bartolomé, B.; Sanz-Buenhombre, M.; Guadarrama, A.; Santos-Buelga, C.; González-Paramás, A.M. Antioxidant Characterization and Biological Effects of Grape Pomace Extracts Supplementation in Caenorhabditis elegans. Foods 2019, 8, 75. [Google Scholar] [CrossRef]
- Nixon, R.A. The role of autophagy in neurodegenerative disease. Nat. Med. 2013, 19, 983–997. [Google Scholar] [CrossRef]
- Wolfe, D.M.; Lee, J.H.; Kumar, A.; Lee, S.; Orenstein, S.J.; Nixon, R.A. Autophagy Failure in Alzheimer’s Disease and the Role of Defective Lysosomal Acidification. Eur. J. Neurosci. 2013, 37, 1949–1961. [Google Scholar] [CrossRef] [PubMed]
- Ernstrom, G.G.; Xie, X.; Huang, D.; Rubinstein, J.L. Vacuolar H+-ATPase determines daughter cell fates through asymmetric segregation of the nucleosome remodeling and deacetylase complex. eLife 2023, 12, e82856. [Google Scholar]
- Huang, G.; Ma, Y.; Xie, D.; Zhao, C.; Zhu, L.; Xie, G.; Wu, P.; Wang, W.; Zhao, Z.; Cai, Z. Evaluation of Nanoplastics Toxicity in the Soil Nematode Caenorhabditis elegans by ITRAQ-Based Quantitative Proteomics. Sci. Total Environ. 2023, 862, 160646. [Google Scholar] [CrossRef] [PubMed]
- Lin, H.; Gao, Y.; Zhang, C.; Ma, B.; Wu, M.; Cui, X.; Wang, H. Autophagy Regulation Influences β-Amyloid Toxicity in Transgenic Caenorhabditis elegans. Front. Aging Neurosci. 2022, 14, 885145. [Google Scholar] [CrossRef]
- Lőrincz, P.; Juhász, G. Autophagosome-lysosome fusion. J. Mol. Bio 2020, 432, 2462–2482. [Google Scholar] [CrossRef]
- Jonson, L.; Vikesa, J.; Krogh, A.; Nielsen, L.K.; Hansen, T.Ø.; Borup, R.; Johnsen, A.H.; Christiansen, J.; Nielsen, F.C. Molecular Composition of IMP1 Ribonucleoprotein Granules. Mol. Cell. Proteoms 2011, 10, M110.005611. [Google Scholar]
- Mizushima, N.; Yoshimori, T.; Ohsumi, Y. The Role of Atg Proteins in Autophagosome Formation. Annu. Rev. Cell Dev. Biol. 2011, 27, 107–132. [Google Scholar] [CrossRef]
- Dashwood, W.M.; Carter, O.; Al-Fageeh, M.; Li, Q.; Dashwood, R.H. Lysosomal trafficking of beta-catenin induced by the tea polyphenol epigallocatechin-3-gallate. Mutat. Res. 2005, 591, 161–172. [Google Scholar] [CrossRef]
- Devika, P.T.; Prince, P.S. Preventive effect of (−)-epigallocatechin-gallate (EGCG) on lysosomal enzymes in heart and subcellular fractions in isoproterenol-induced myocardial infarcted Wistar rats. Chem. Biol. Interact. 2008, 172, 245–252. [Google Scholar] [CrossRef]
- Secker, C.; Motzny, A.Y.; Kostova, S.; Buntru, A.; Helmecke, L.; Reus, L.; Steinfort, R.; Brusendorf, L.; Boeddrich, A.; Neuendorf, N.; et al. The polyphenol EGCG directly targets intracellular amyloid-β aggregates and promotes their lysosomal degradation. J. Neurochem. 2023, 166, 294–317. [Google Scholar] [CrossRef]
Gene | Forward | Reverse |
---|---|---|
vha-5 | CTTCATGGAAACGCGACTGT | CGGTAACGAACACCATGTGC |
cpr-5 | CTCCGACGCTATTCCAGACC | GCGTAGGCGGTAGATCCAAA |
epg-8 | GCGGTAAACGCTACACAAAGA | CCATCCGCTGAGATTCCTGG |
imp-2 | CGCTGCTTTTGAAGCCTTGT | AGTGTCCGCTGTTGAGGATG |
rab-7 | TTCCTCACACGCGACGTAAA | CGGCTCCACGATAAAAAGCG |
act-1 | CCAGGAATTGCTGATCGTATG | GGAGAGGGAAGCGAGGATAG |
Peak | Pseudomolecular Ion [M-H]− (m/z) | MS2 Fragment Ions (m/z) | Tentative Identification |
---|---|---|---|
1 | 577 | 425, 407 | Procyanidin dimer B3 |
2 | 577 | 425, 407 | Procyanidin dimer B1 |
3 | 865 | 577, 425, 407 | B-type procyanidin trimer |
4 | 577 | 425, 407 | Procyanidin dimer B4 |
5 | 577 | 425, 407 | Procyanidin dimer B2 |
6 | 289 | - | Epicatechin |
7 | 729 | 577, 289 | Galloyled procyanidin dimer |
8 | 577 | 425, 407 | Procyanidin dimer B5 |
9 | 729 | 577, 289 | Galloyled procyanidin dimer |
10 | 729 | 577, 289 | Galloyled procyanidin dimer |
11 | 729 | 577, 289 | Galloyled procyanidin dimer |
Compound | Concentration * (mg/g) |
---|---|
Epicatechin | 14.80 ± 0.23 |
B-type procyanidin dimers | 69.65 ± 0.35 |
Galloyled procyanidin dimers | 40.53 ± 0.31 |
B-type procyanidin trimer | 37.85 ± 0.28 |
Total flavan-3-ols | 162.83 |
Assay | Mean (Days) 1 | p vs. Control (Log Rank) | Maximum 10% (Days) 2 | p vs. Control (ANOVA) |
---|---|---|---|---|
Control | 11.99 ± 0.44 | 19.10 ± 0.79 | ||
GSPE (100 µg/mL) | 13.69 ± 0.42 | 0.009 | 20.70 ± 1.34 | 0.009 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
González-Manzano, S.; Ayuda-Durán, B.; Martín-Sanz, R.; Garzón-García, L.; Santos-Buelga, C.; González-Paramás, A.M. Exploring the Neuroprotective Effects of Grape Seed Procyanidins on Amyloid-β-Induced Toxicity in Caenorhabditis elegans. Foods 2024, 13, 3865. https://doi.org/10.3390/foods13233865
González-Manzano S, Ayuda-Durán B, Martín-Sanz R, Garzón-García L, Santos-Buelga C, González-Paramás AM. Exploring the Neuroprotective Effects of Grape Seed Procyanidins on Amyloid-β-Induced Toxicity in Caenorhabditis elegans. Foods. 2024; 13(23):3865. https://doi.org/10.3390/foods13233865
Chicago/Turabian StyleGonzález-Manzano, Susana, Begoña Ayuda-Durán, Roberto Martín-Sanz, Lidia Garzón-García, Celestino Santos-Buelga, and Ana María González-Paramás. 2024. "Exploring the Neuroprotective Effects of Grape Seed Procyanidins on Amyloid-β-Induced Toxicity in Caenorhabditis elegans" Foods 13, no. 23: 3865. https://doi.org/10.3390/foods13233865
APA StyleGonzález-Manzano, S., Ayuda-Durán, B., Martín-Sanz, R., Garzón-García, L., Santos-Buelga, C., & González-Paramás, A. M. (2024). Exploring the Neuroprotective Effects of Grape Seed Procyanidins on Amyloid-β-Induced Toxicity in Caenorhabditis elegans. Foods, 13(23), 3865. https://doi.org/10.3390/foods13233865