Anti-Inflammatory Effects of Novel Probiotic Lactobacillus rhamnosus RL-H3-005 and Pedicoccus acidilactici RP-H3-006: In Vivo and In Vitro Evidence
Abstract
1. Introduction
2. Materials and Methods
2.1. Raw Materials and Chemical Reagents
2.2. Strain Culture
2.3. Preliminary Screening of Anti-Inflammatory Probiotics
2.4. Tolerance to Low pH and Bile
2.5. Safety Evaluation
2.5.1. Hemolytic Assay
2.5.2. Production of Toxic Metabolites
2.5.3. Antibiotic Susceptibility Test
2.6. Antimicrobial Activity Assessment
2.7. Detection of Cell Surface Properties
2.7.1. Surface Hydrophobicity
2.7.2. Bacterial Auto-Aggregation
2.7.3. Adhesion to HT-29 Cells
2.8. Molecular Identification
2.9. Comprehensive Evaluation
2.10. Cell Model Analysis
2.11. DSS-Induced Colitis
2.12. Analysis of Inflammation and Oxidative Stress Levels
2.13. Histopathology Analysis
2.14. Microbial Analysis
2.15. Statistical Analysis
3. Results
3.1. Preliminary Assessment of the Anti-Inflammatory LAB
3.2. Evaluation of the Probiotic Properties of the Five LAB
3.2.1. Acid and Bile Salt Tolerance
3.2.2. Characterization of Safety Evaluation
3.2.3. Results of Antimicrobial Activity
3.2.4. Preliminary Assessment of Bacterial Surface Characterization
3.2.5. Comprehensive Analysis
3.3. RL5 and RP6 Inhibited LPS-Induced Inflammation and Oxidative Damage in RAW264.7 Cells
3.4. Oral Administration of RL5 and RP6 Improved the Symptoms of Experimental Colitis
3.5. Oral Administration of RL5 and RP6 Regulated Proinflammatory Cytokine Secretion and Oxidative Stress in DSS-Induced Colitis Mice
3.6. Oral Administration of RL5 and RP6 Regulates the Gut Microbiota in DSS-Induced Colitis Mice
4. Discussions
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- de Melo Pereira, G.V.; de Oliveira Coelho, B.; Magalhães Júnior, A.I.; Thomaz-Soccol, V.; Soccol, C.R. How to select a probiotic? A review and update of methods and criteria. Biotechnol. Adv. 2018, 36, 2060–2076. [Google Scholar] [CrossRef] [PubMed]
 - Georgieva, M.; Georgiev, K.; Hvarchanova, N. Chapter 29—Probiotics: Past, present, and future challenges. In Probiotics in the Prevention and Management of Human Diseases; Dwivedi, M.K., Amaresan, N., Sankaranarayanan, A., Kemp, E.H., Eds.; Academic Press: Cambridge, MA, USA, 2022; pp. 431–448. [Google Scholar] [CrossRef]
 - Hao, R.; Liu, Q.; Wang, L.; Jian, W.; Cheng, Y.; Zhang, Q.; Hayer, K.; Kamarudin Raja Idris, R.; Zhang, Y.; Lu, H.; et al. Anti-inflammatory effect of Lactiplantibacillus plantarum T1 cell-free supernatants through suppression of oxidative stress and NF-κB- and MAPK-signaling pathways. Appl. Environ. Microbiol. 2023, 89, e0060823. [Google Scholar] [CrossRef] [PubMed]
 - Liu, C.H.; Qi, X.F.; Liu, X.L.; Sun, Y.; Mao, K.D.; Shen, G.Q.; Ma, Y.; Li, Q.M. Anti-inflammatory probiotics HF05 and HF06 synergistically alleviate ulcerative colitis and secondary liver injury. FOOD Funct. 2024, 15, 3765–3777. [Google Scholar] [CrossRef] [PubMed]
 - Zhang, Y.; Li, Y.; Ren, X.; Zhang, X.; Wu, Z.; Liu, L. The positive correlation of antioxidant activity and prebiotic effect about oat phenolic compounds. Food Chem. 2023, 402, 134231. [Google Scholar] [CrossRef] [PubMed]
 - Yang, J.; Yang, H.; Li, Y. The triple interactions between gut microbiota, mycobiota and host immunity. Crit. Rev. Food Sci. Nutr. 2023, 63, 11604–11624. [Google Scholar] [CrossRef]
 - López-Almada, G.; Mejía-León, M.E.; Salazar-López, N.J. Probiotic, Postbiotic, and Paraprobiotic Effects of Lactobacillus rhamnosus as a Modulator of Obesity-Associated Factors. Foods 2024, 13, 3529. [Google Scholar] [CrossRef]
 - Liu, C.; Liu, X.; Sun, Y.; Qi, X.; Ma, Y.; Wang, R. Anti-inflammatory probiotic Lactiplantibacillus plantarum HF05 screening from Qula: Genomic analysis and alleviating effect on intestinal inflammation. Food Biosci. 2023, 55, 103002. [Google Scholar] [CrossRef]
 - Ebrahiminejad, A.; Sepahi, A.A.; Yadegar, A.; Meyfour, A. Pasteurized form of a potential probiotic lactobacillus brevis IBRC-M10790 exerts anti-inflammatory effects on inflammatory bowel disease in vitro. BMC Complement. Med. Ther. 2024, 24, 258. [Google Scholar] [CrossRef]
 - Kim, M.Y.; Hyun, I.K.; An, S.; Kim, D.; Kim, K.H.; Kang, S.S. In vitro anti-inflammatory and antibiofilm activities of bacterial lysates from lactobacilli against oral pathogenic bacteria. Food Funct. 2022, 13, 12755–12765. [Google Scholar] [CrossRef]
 - Lim, J.-J.; Jung, A.H.; Joo Suh, H.; Choi, H.-S.; Kim, H. Lactiplantibacillus plantarum K8-based paraprobiotics prevents obesity and obesity-induced inflammatory responses in high fat diet-fed mice. Food Res. Int. 2022, 155, 111066. [Google Scholar] [CrossRef]
 - Wang, J.; Li, M.; Gao, Y.; Li, H.; Fang, L.; Liu, C.; Liu, X.; Min, W. Effects of Exopolysaccharides from Lactiplantibacillus plantarum JLAU103 on Intestinal Immune Response, Oxidative Stress, and Microbial Communities in Cyclophosphamide-Induced Immunosuppressed Mice. J. Agric. Food Chem. 2022, 70, 2197–2210. [Google Scholar] [CrossRef] [PubMed]
 - Nithya, A.; Misra, S.; Panigrahi, C.; Dalbhagat, C.G.; Mishra, H.N. Probiotic potential of fermented foods and their role in non-communicable diseases management: An understanding through recent clinical evidences. Food Chem. Adv. 2023, 3, 100381. [Google Scholar] [CrossRef]
 - Huang, Z.P.; Liu, B.D.; Xiao, L.L.; Liao, M.M.; Huang, L.J.; Zhao, X.G.; Ma, K.; Wang, R.X.; Ji, F.; Li, W.; et al. Effects of breast-fed infants-derived Limosilactobacillus reuteri and Bifidobacterium breve ameliorate DSS-induced colitis in mice. Iscience 2024, 27, 110902. [Google Scholar] [CrossRef] [PubMed]
 - Liang, H.; Luo, Z.; Miao, Z.; Shen, X.; Li, M.; Zhang, X.; Chen, J.; Ze, X.; Chen, Q.; He, F. Lactobacilli and bifidobacteria derived from infant intestines may activate macrophages and lead to different IL-10 secretion. Biosci. Biotechnol. Biochem. 2020, 84, 2558–2568. [Google Scholar] [CrossRef] [PubMed]
 - Li, H.X.; Cheng, S.S.; Wang, Y.H.; Sun, Y.L.; Zhang, J.X.; Sun, M.S.; Man, C.X.; Zhang, Y.; Jiang, Y.J. Lactobacillus plantarum J26 alleviates alcohol-induced oxidative liver injury by regulating the Nrf2 signaling pathway. Food Sci. Hum. Wellness 2024, 13, 2068–2078. [Google Scholar] [CrossRef]
 - Liu, M.; Zhang, X.; Hao, Y.; Ding, J.; Shen, J.; Xue, Z.; Qi, W.; Li, Z.; Song, Y.; Zhang, T.; et al. Protective effects of a novel probiotic strain, Lactococcus lactis ML2018, in colitis: In vivo and in vitro evidence. Food Funct. 2019, 10, 1132–1145. [Google Scholar] [CrossRef]
 - Diguță, C.F.; Nițoi, G.D.; Matei, F.; Luță, G.; Cornea, C.P. The Biotechnological Potential of Pediococcus spp. Isolated from Kombucha Microbial Consortium. Foods 2020, 9, 1780. [Google Scholar] [CrossRef]
 - Sui, L.; Zhu, X.; Wu, D.; Ma, T.; Tuo, Y.; Jiang, S.; Qian, F.; Mu, G. In vitro assessment of probiotic and functional properties of Bacillus coagulans T242. Food Biosci. 2020, 36, 100675. [Google Scholar] [CrossRef]
 - Barbosa, T.M.; Serra, C.R.; La Ragione, R.M.; Woodward, M.J.; Henriques, A.O. Screening for bacillus isolates in the broiler gastrointestinal tract. Appl. Environ. Microbiol. 2005, 71, 968–978. [Google Scholar] [CrossRef]
 - Kavitha, M.; Raja, M.; Perumal, P. Evaluation of probiotic potential of Bacillus spp. isolated from the digestive tract of freshwater fish Labeo calbasu (Hamilton, 1822). Aquac. Rep. 2018, 11, 59–69. [Google Scholar] [CrossRef]
 - Xu, M.; Hu, M.; Han, J.; Wang, L.; He, Y.; Kulyar, M.F.; Zhang, X.; Lu, Y.; Mu, S.; Su, H.; et al. The Therapeutic Effects of Lactic Acid Bacteria Isolated from Spotted Hyena on Dextran Sulfate Sodium-Induced Ulcerative Colitis in Mice. Foods 2024, 16, 3682. [Google Scholar] [CrossRef] [PubMed]
 - Horn, N.; Wegmann, U.; Dertli, E.; Mulholland, F.; Collins, S.R.; Waldron, K.W.; Bongaerts, R.J.; Mayer, M.J.; Narbad, A. Spontaneous mutation reveals influence of exopolysaccharide on Lactobacillus johnsonii surface characteristics. PLoS ONE 2013, 8, e59957. [Google Scholar] [CrossRef] [PubMed]
 - Liu, W.; Chen, M.; Duo, L.; Wang, J.; Guo, S.; Sun, H.; Menghe, B.; Zhang, H. Characterization of potentially probiotic lactic acid bacteria and bifidobacteria isolated from human colostrum. Journal of Dairy Science. 2020, 103, 4013–4025. [Google Scholar] [CrossRef] [PubMed]
 - Wang, Z.; Dang, S.; Xing, Y.; Li, Q.; Yan, H. Applying Rank Sum Ratio (RSR) to the Evaluation of Feeding Practices Behaviors, and Its Associations with Infant Health Risk in Rural Lhasa, Tibet. Int. J. Environ. Res. Public Health 2015, 12, 15173–15181. [Google Scholar] [CrossRef]
 - Murthy, S.N.; Cooper, H.S.; Shim, H.; Shah, R.S.; Ibrahim, S.A.; Sedergran, D.J. Treatment of dextran sulfate sodium-induced murine colitis by intracolonic cyclosporin. Dig. Dis. Sci. 1993, 38, 1722–1734. [Google Scholar] [CrossRef]
 - Cao, Y.; Gao, J.; Zhang, L.; Qin, N.; Zhu, B.; Xia, X. Jellyfish skin polysaccharides enhance intestinal barrier function and modulate the gut microbiota in mice with DSS-induced colitis. Food Funct. 2021, 12, 10121–10135. [Google Scholar] [CrossRef]
 - Liu, H.; Yan, C.; Teng, Y.; Guo, J.; Liang, C.; Xia, X. Gut microbiota and d-ribose mediate the anti-colitic effect of punicalagin in DSS-treated mice. Food Funct. 2024, 15, 7108–7123. [Google Scholar] [CrossRef]
 - Coronas, R.; Zara, G.; Gallo, A.; Rocchetti, G.; Lapris, M.; Petretto, G.L.; Zara, S.; Fancello, F.; Mannazzu, I. Propionibacteria as promising tools for the production of pro-bioactive scotta: A proof-of-concept study. Front. Microbiol. 2023, 14, 1223741. [Google Scholar] [CrossRef]
 - Wan, L.Y.M.; Chen, Z.J.; Shah, N.P.; El-Nezami, H. Modulation of Intestinal Epithelial Defense Responses by Probiotic Bacteria. Crit. Rev. Food Sci. Nutr. 2016, 56, 2628–2641. [Google Scholar] [CrossRef]
 - Binda, S.; Hill, C.; Johansen, E.; Obis, D.; Pot, B.; Sanders, M.E.; Tremblay, A.; Ouwehand, A.C. Criteria to Qualify Microorganisms as "Probiotic" in Foods and Dietary Supplements. Front. Microbiol. 2020, 11, 1662. [Google Scholar] [CrossRef]
 - Ma, C.; Liu, Q.; Zhang, S.; Qu, A.; Liu, Q.; Lv, J.; Pang, X. Lactobacillus Kefir M20 Adaptation to Bile Salts: A Novel Pathway for Cholesterol Reduction. Foods 2024, 13, 3380. [Google Scholar] [CrossRef] [PubMed]
 - Fidanza, M.; Panigrahi, P.; Kollmann, T. Lactiplantibacillus plantarum–Nomad and Ideal Probiotic. Front. Microbiol. 2021, 12, 712236. [Google Scholar] [CrossRef] [PubMed]
 - Ayyash, M.M.; Abdalla, A.K.; AlKalbani, N.S.; Baig, M.A.; Turner, M.S.; Liu, S.Q.; Shah, N.P. Invited review: Characterization of new probiotics from dairy and nondairy products-Insights into acid tolerance, bile metabolism and tolerance, and adhesion capability. J. Dairy Sci. 2021, 104, 8363–8379. [Google Scholar] [CrossRef] [PubMed]
 - Peng, X.; Ed-Dra, A.; Yue, M. Whole genome sequencing for the risk assessment of probiotic lactic acid bacteria. Crit. Rev. Food Sci. Nutr. 2023, 63, 11244–11262. [Google Scholar] [CrossRef]
 - Nagpal, R.; Wang, S.; Ahmadi, S.; Hayes, J.; Gagliano, J.; Subashchandrabose, S.; Kitzman, D.W.; Becton, T.; Read, R.; Yadav, H. Human-origin probiotic cocktail increases short-chain fatty acid production via modulation of mice and human gut microbiome. Sci. Rep. 2018, 8, 12649. [Google Scholar] [CrossRef]
 - Collado, M.C.; Jalonen, L.; Meriluoto, J.; Salminen, S. Protection mechanism of probiotic combination against human pathogens: In vitro adhesion to human intestinal mucus. Asia Pac. J. Clin. Nutr. 2006, 15, 570–575. [Google Scholar]
 - Fina, D.; Pallone, F. What is the role of cytokines and chemokines in IBD? Inflamm. Bowel Dis. 2008, 14 (Suppl. 2), S117–S118. [Google Scholar] [CrossRef]
 - Li, J.; Jia, J.; Teng, Y.; Xie, C.; Li, C.; Zhu, B.; Xia, X. Gastrodin Alleviates DSS-Induced Colitis in Mice through Strengthening Intestinal Barrier and Modulating Gut Microbiota. Foods 2024, 13, 2460. [Google Scholar] [CrossRef]
 - Al Zahrani, A.J.; Shori, A.B.; Al-Judaibi, E. Fermented Soymilk with Probiotic Lactobacilli and Bifidobacterium Strains Ameliorates Dextran-Sulfate-Sodium-Induced Colitis in Rats. Nutrients 2024, 16, 3478. [Google Scholar] [CrossRef]
 - Baek, J.; Kim, J.H.; Kim, W. Potential Anti-Allergy and Immunomodulatory Properties of Lactococcus lactis LB 1022 Observed In Vitro and in an Atopic Dermatitis Mouse Model. J. Microbiol. Biotechnol. 2023, 33, 823–830. [Google Scholar] [CrossRef]
 - Roessner, A.; Kuester, D.; Malfertheiner, P.; Schneider-Stock, R. Oxidative stress in ulcerative colitis-associated carcinogenesis. Pathol. Res. Pract. 2008, 204, 511–524. [Google Scholar] [CrossRef] [PubMed]
 - Cristofori, F.; Dargenio, V.N.; Dargenio, C.; Miniello, V.L.; Barone, M.; Francavilla, R. Anti-Inflammatory and Immunomodulatory Effects of Probiotics in Gut Inflammation: A Door to the Body. Front. Immunol. 2021, 12, 578386. [Google Scholar] [CrossRef] [PubMed]
 - Zhang, H.; Shen, G.; Lu, H.; Jiang, C.; Hu, W.; Jiang, Q.; Xiang, X.; Wang, Z.; Chen, L. Psidium guajava Seed Oil Reduces the Severity of Colitis Induced by Dextran Sulfate Sodium by Modulating the Intestinal Microbiota and Restoring the Intestinal Barrier. Foods 2024, 13, 2668. [Google Scholar] [CrossRef]
 - Cheng, S.; Li, H.; Huang, Y.; Su, Y.; Li, Y.; Jia, A.; Jiang, Y.; Zhang, Y.; Man, C. Lactobacillus gasseri JM1 Isolated from Infant Feces Alleviates Colitis in Mice via Protecting the Intestinal Barrier. Nutrients 2022, 15, 139. [Google Scholar] [CrossRef] [PubMed]
 - El Kaoutari, A.; Armougom, F.; Gordon, J.I.; Raoult, D.; Henrissat, B. The abundance and variety of carbohydrate-active enzymes in the human gut microbiota. Nat. Rev. Microbiol. 2013, 11, 497–504. [Google Scholar] [CrossRef] [PubMed]
 - Zhang, Y.; Tu, S.; Ji, X.; Wu, J.; Meng, J.; Gao, J.; Shao, X.; Shi, S.; Wang, G.; Qiu, J.; et al. Dubosiella newyorkensis modulates immune tolerance in colitis via the L-lysine-activated AhR-IDO1-Kyn pathway. Nat. Commun. 2024, 15, 1333. [Google Scholar] [CrossRef]
 






| Gene | Forward Sequence | Reverse Sequence | 
|---|---|---|
| IL-10 | GGTTGCCAAGCCTTATCGGA | GAGAAATCGATGACAGCGCC | 
| IL-6 | CTCAGCGCTGAGTTG | CCTGTAGCCCACGTCGTAGC | 
| TNF-α | CGGGCAGGTCTACTTTGGAG | ACCCTGAGCCATAATCCCCT | 
| iNOS | TGAGTTCCGAAGCAAGCCAA | AGACCTCAACAGAGCCCTCA | 
| GAPDH | TGTGTCCGTCGTGGATCTGA | TTGCTGTTGAAGTCGCAGGAG | 
| Groups | NO (μmol/L) | |
|---|---|---|
| 1 | Control | 5.31 ± 0.05 | 
| 2 | LPS | 43.83 ± 0.31 | 
| 3 | LPS+RL-H3-001 | 38.32 ± 0.12 | 
| 4 | LPS+RL-H3-002 | 22.71 ± 0.92 ** | 
| 5 | LPS+RL-H3-004 | 33.89 ± 1.21 | 
| 6 | LPS+RL-H3-005 | 20.43 ± 0.21 ** | 
| 7 | LPS+RL-H3-006 | 46.83 ± 0.01 | 
| 8 | LPS+RL-H3-010 | 37.83 ± 1.12 | 
| 9 | LPS+RP-H3-002 | 39.83 ± 0.24 | 
| 10 | LPS+RP-H3-003 | 56.83 ± 0.26 | 
| 11 | LPS+RP-H3-004 | 36.83 ± 0.09 | 
| 12 | LPS+RP-H3-006 | 18.56 ± 0.48 ** | 
| 13 | LPS+RP-H3-008 | 40.22 ± 0.89 | 
| 14 | LPS+RP-H3-009 | 40.98 ± 0.33 | 
| 15 | LPS+RP-H3-012 | 47.93 ± 0.52 | 
| 16 | LPS+RP-H3-014 | 39.02 ± 0.01 | 
| 17 | LPS+RP-H3-017 | 41.83 ± 1.81 | 
| 18 | LPS+RP-H3-018 | 52.39 ± 1.71 | 
| 19 | LPS+RF-H1-005 | 44.76 ± 0.76 | 
| 20 | LPS+RF-H1-009 | 49.03 ± 0.01 | 
| 21 | LPS+RF-H1-010 | 58.83 ± 0.30 | 
| 22 | LPS+RF-H1-012 | 31.93 ± 0.29 * | 
| 23 | LPS+RF-H1-014 | 30.47 ± 0.01 * | 
| Strain | Hemolytic Activity a | Production of Toxic Metabolites b | Antibiotic Susceptibility c | |||||||
|---|---|---|---|---|---|---|---|---|---|---|
| LD | OD | NR | AMP | C | VA | GEN | SM | CAR | ||
| RL-H3-002 | γ | - | - | - | S | S | R | R | R | R | 
| RL-H3-005 | γ | - | - | - | S | S | R | R | S | R | 
| RP-H3-006 | γ | - | - | - | S | R | R | R | S | S | 
| RF-H1-012 | γ | - | - | - | R | S | R | R | R | S | 
| RF-H1-014 | γ | - | - | - | R | S | R | R | R | S | 
| Strain | E. coli ATCC 25922 | S. aureus ATCC 29213 | L. monocytogenes ATCC 19115 | 
|---|---|---|---|
| RL-H3-002 | - | 22.4 ± 1.0 | 28.9 ± 0.6 | 
| RL-H3-005 | - | 23.1 ± 1.7 | 26.3 ± 0.8 | 
| RP-H3-006 | - | 17.0 ± 0.9 | 24.9 ± 1.1 | 
| RF-H1-012 | - | - | 7.2 ± 1.3 | 
| RF-H1-014 | - | - | - | 
| Isolate | RSR Rank a | Probit | RSR Regression | Species | GenBank | 
|---|---|---|---|---|---|
| RL-H3-005 | 4 | 6.64 | 0.73 | Lactobacillus rhamnosus | OR743464 | 
| RP-H3-006 | 4 | 5.84 | 0.59 | Pediococcus acidilactici | OR743466 | 
| RL-H3-002 | 3 | 5.25 | 0.49 | Lactobacillus rhamnosus | OR743465 | 
| RF-H1-012 | 3 | 4.74 | 0.40 | Enterococcus faecalis | OR743467 | 
| RF-H1-014 | 2 | 4.16 | 0.29 | Enterococcus faecalis | OR743468 | 
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.  | 
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, S.; Li, Y.; Sui, D.; Ren, Q.; Ai, C.; Li, M.; Zhao, S.; Li, H.; Song, S.; Ren, X. Anti-Inflammatory Effects of Novel Probiotic Lactobacillus rhamnosus RL-H3-005 and Pedicoccus acidilactici RP-H3-006: In Vivo and In Vitro Evidence. Foods 2024, 13, 3676. https://doi.org/10.3390/foods13223676
Li S, Li Y, Sui D, Ren Q, Ai C, Li M, Zhao S, Li H, Song S, Ren X. Anti-Inflammatory Effects of Novel Probiotic Lactobacillus rhamnosus RL-H3-005 and Pedicoccus acidilactici RP-H3-006: In Vivo and In Vitro Evidence. Foods. 2024; 13(22):3676. https://doi.org/10.3390/foods13223676
Chicago/Turabian StyleLi, Shugang, Yixuan Li, Donglin Sui, Qingyu Ren, Chunqing Ai, Mingxin Li, Shouhao Zhao, Huan Li, Shuang Song, and Xiaomeng Ren. 2024. "Anti-Inflammatory Effects of Novel Probiotic Lactobacillus rhamnosus RL-H3-005 and Pedicoccus acidilactici RP-H3-006: In Vivo and In Vitro Evidence" Foods 13, no. 22: 3676. https://doi.org/10.3390/foods13223676
APA StyleLi, S., Li, Y., Sui, D., Ren, Q., Ai, C., Li, M., Zhao, S., Li, H., Song, S., & Ren, X. (2024). Anti-Inflammatory Effects of Novel Probiotic Lactobacillus rhamnosus RL-H3-005 and Pedicoccus acidilactici RP-H3-006: In Vivo and In Vitro Evidence. Foods, 13(22), 3676. https://doi.org/10.3390/foods13223676
        
