Balanced Fertilization Enhances the Nutritional Value and Flavor Profile of Tomato Fruits
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Materials and Growth Conditions
2.2. Treatments
2.3. Determination of Contents
2.3.1. Measurement of Vitamin C and Nitrate Contents
2.3.2. Determination of Sugar and Acid Contents
2.3.3. Determination of the Pigment Content of Tomato Fruits
2.3.4. Determination of Polyphenols’ Composition
2.3.5. Determination of Enzyme Activity Associated with Sugar Synthesis
2.3.6. Determination of Volatile Components
2.3.7. qRT-PCR Analysis
2.4. Statistical Analysis
3. Results
3.1. Balanced Fertilization Altered the Nitrate and Ascorbic Acid Levels
3.2. Balanced Fertilization Changed the Lycopene, Lutein, and Violaxanthin
3.3. Balanced Fertilization Influenced the Sugar and Acid Components
3.4. Balanced Fertilization Influenced Enzymatic Activities Related to Sucrose Metabolism
3.5. Balanced Fertilization Influenced Gene Expression Related to Sucrose Metabolism
3.6. Pearson’s Correlation Analysis and Principal Component Analysis of Nutritional Quality in Tomato Fruits
3.7. Balanced Fertilization Influenced Polyphenol Composition
3.8. Pearson’s Correlation Analysis and Principal Component Analysis of Polyphenols in Tomato Fruits
3.9. Balanced Fertilization Influenced Volatile Components
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Khan, U.M.; Sevindik, M.; Zarrabi, A.; Nami, M.; Ozdemir, B.; Kaplan, D.N.; Selamoglu, Z.; Hasan, M.; Kumar, M.; Sharifi-Rad, J.; et al. Lycopene: Food Sources, Biological Activities, and Human Health Benefits. Oxid. Med. Cell Longev. 2021, 2021, 2713511. [Google Scholar] [CrossRef]
- Rosa-Martínez, E.; García-Martínez, M.D.; Adalid-Martínez, A.M.; Pereira-Dias, L.; Casanova, C.; Soler, E.; Figàs, M.R.; Raigón, M.D.; Plazas, M.; Soler, S.; et al. Fruit composition profile of pepper, tomato and eggplant varieties grown under uniform conditions. Food Res. Int. 2021, 147, 110531. [Google Scholar] [CrossRef] [PubMed]
- Joyce, V.E.; Dwayne, D.K.; Walmsley, A.M. Tomato (Lycopersicum esculentum). Methods Mol. Biol. 2006, 343, 459–473. [Google Scholar]
- Oltman, A.; Jervis, S.; Drake, M. Consumer Attitudes and Preferences for Fresh Market Tomatoes. J. Food Sci. 2014, 79, S2091–S2097. [Google Scholar] [CrossRef]
- Bruyn, J.W.; Garretsen, F.; Kooistra, E. Variation in taste and chemical composition of the tomato (Lycopersicon esculentum Mill). Euphytica 1971, 20, 214–227. [Google Scholar] [CrossRef]
- Liu, H.; Meng, F.; Miao, H.; Chen, S.; Yin, T.; Hu, S.; Shao, Z.; Liu, Y.; Gao, L.; Zhu, C.; et al. Effects of postharvest methyl jasmonate treatment on main health-promoting components and volatile organic compounds in cherry tomato fruits. Food Chem. 2018, 263, 194–200. [Google Scholar] [CrossRef] [PubMed]
- Chang, Y.; Zhang, X.; Wang, C.; Ma, N.; Xie, J.; Zhang, J. Fruit Quality Analysis and Flavor Comprehensive Evaluation of Cherry Tomatoes of Different Colors. Foods 2024, 13, 1898. [Google Scholar] [CrossRef] [PubMed]
- Piombino, P.; Sinesio, F.; Moneta, E.; Cammareri, M.; Genovese, A.; Lisanti, M.T.; Mogno, M.R.; Peparaio, M.; Termolino, P.; Moio, L.; et al. Investigating physicochemical, volatile and sensory parameters playing a positive or a negative role on tomato liking. Food Res. Int. 2013, 50, 409–419. [Google Scholar] [CrossRef]
- Quinet, M.; Angosto, T.; Yuste-Lisbona, F.J.; Blanchard-Gros, R.; Bigot, S.; Martinez, J.-P.; Lutts, S. Tomato Fruit Development and Metabolism. Front. Plant Sci. 2019, 10, 1554. [Google Scholar] [CrossRef]
- Han, H.; Chen, X.-L.; Liu, Y.-Z.; Zhou, T.; Alam, S.M.; Khan, M.A. Foliar spraying magnesium promotes soluble sugar accumulation by inducing the activities of sucrose biosynthesis and transport in citrus fruits. Sci. Hortic. 2024, 324, 112593. [Google Scholar] [CrossRef]
- Wang, C.; Wang, Y.; Wang, M.; Han, H.; Luo, Y.; Ding, W.; Xu, W.; Zhong, Y.; Huang, H.; Qu, S. Soluble sugars accumulation and related gene expression during fruit development in Cucurbita maxima Duchesne. Sci. Hortic. 2020, 272, 109520. [Google Scholar] [CrossRef]
- Taware, A.S.; Rathod, P.B.; Katariya, A.P.; Tagad, C.K.; Wagh, P.S.; Sonar, J.P.; Deshmukh, S.U.; Kanagare, A.B. +Technological Advancement in the Development of Nano Fertilizers for Sustainable Agriculture. J. Soil Sci. Plant Nutr. 2024, 24, 1592–1608. [Google Scholar] [CrossRef]
- Ofoe, R.; Mousavi, S.M.N.; Thomas, R.H.; Abbey, L. Foliar application of pyroligneous acid acts synergistically with fertilizer to improve the productivity and phytochemical properties of greenhouse-grown tomato. Sci. Rep. 2024, 14, 1934. [Google Scholar] [CrossRef] [PubMed]
- Wei, X.; Xie, B.; Wan, C.; Song, R.; Zhong, W.; Xin, S.; Song, K. Enhancing Soil Health and Plant Growth through Microbial Fertilizers: Mechanisms, Benefits, and Sustainable Agricultural Practices. Agronomy 2024, 14, 609. [Google Scholar] [CrossRef]
- Zhou, N.; Chen, Y.; Wang, J.; Yang, W.; Wang, Y. Reducing Chemical Fertilizer Application in Greenhouse Vegetable Cultivation under Different Residual Levels of Nutrient. Agriculture 2023, 13, 1174. [Google Scholar] [CrossRef]
- Malhi, S.S.; Goerzen, D.W. Improving yield in alfalfa seed stands with balanced fertilization. J. Plant Nutr. 2010, 33, 2157–2166. [Google Scholar]
- Wei, M.; Zhang, A.; Chao, Y.; Wang, H.; Pan, H.; Lou, Y.; Zhuge, Y. Long-term effect of fertilizer and manure application on the balance of soil organic carbon and yield sustainability in fluvo-aquic soil. Arch. Agron. Soil Sci. 2020, 66, 1520–1531. [Google Scholar] [CrossRef]
- Wang, J.L.; Liu, K.L.; Zhao, X.Q.; Zhang, H.Q.; Li, D.; Li, J.J.; Shen, R.F. Balanced fertilization over four decades has sustained soil microbial communities and improved soil fertility and rice productivity in red paddy soil. Sci. Total. Environ. 2021, 793, 148664. [Google Scholar] [CrossRef] [PubMed]
- Tang, S.; Pan, W.; Tang, R.; Ma, Q.; Zhou, J.; Zheng, N.; Wang, J.; Sun, T.; Wu, L. Effects of balanced and unbalanced fertilisation on tea quality, yield, and soil bacterial community. Appl. Soil Ecol. 2022, 175, 104442. [Google Scholar] [CrossRef]
- Dhawan, G.; Dheri, G.S.; Gill, A.A.S. Long-term use of balanced fertilization decreases nitrogen losses in a maize-wheat system on Inceptisol of north India. Arch. Agron. Soil Sci. 2022, 68, 395–412. [Google Scholar] [CrossRef]
- Liu, W.K.; Yang, Q.C.; Qiu, Z.P. Spatiotemporal changes of nitrate and Vc contents in hydroponic lettuce treated with various nitrogen-free solutions. Acta Agric. Scand. Sect. B—Soil Plant Sci. 2012, 62, 286–290. [Google Scholar] [CrossRef]
- Zhang, S.; Chen, H.; Gao, M.; Gu, C.; Wang, R. Effects of different iron treatments on wine grape berry quality and peel flavonoid contents. Food Sci. Nutr. 2022, 10, 3598–3607. [Google Scholar] [CrossRef]
- Nagy, A.; Riczu, P.; Tamás, J. Spectral evaluation of apple fruit ripening and pigment content alteration. Sci. Hortic. 2016, 201, 256–264. [Google Scholar] [CrossRef]
- Chen, X.; Yang, S.; Yang, H.; Zhang, J.; Huang, Y.; Zhang, Y. Extraction of flavonoids and phenolics from fruit. Biomass Convers. Biorefinery 2024, 14, 16831–16841. [Google Scholar] [CrossRef]
- Wei, S.; Xiao, X.; Wei, L.; Li, L.; Li, G.; Liu, F.; Xie, J.; Yu, J.; Zhong, Y. Development and comprehensive HS-SPME/GC-MS analysis optimization, comparison, and evaluation of different cabbage cultivars (Brassica oleracea L. var. capitata L.) volatile components. Food Chem. 2021, 340, 128166. [Google Scholar] [CrossRef] [PubMed]
- Li, Z.; Zhao, B.; Wang, Q.; Cao, X.; Zhang, J. Differences in Chemical Composition of Soil Organic Carbon Resulting From Long-Term Fertilization Strategies. PLoS ONE 2015, 10, e0124359. [Google Scholar] [CrossRef] [PubMed]
- Malundo, T.M.M.; Shewfelt, R.L.; Scott, J.W. Flavor quality of fresh tomato (Lycopersicon esculentum Mill.) as affected by sugar and acid levels. Postharvest Biol. Technol. 1995, 6, 103–110. [Google Scholar] [CrossRef]
- Cao, G.; Zhao, M.; Bi, S.; Cao, S.; Wang, W.; Li, H. Effects of balanced fertilization on growth and fruit quality of ‘Huang-guan’ pear on desert area. Yingyong Shengtai Xuebao 2018, 29, 2477–2484. [Google Scholar]
- Li, W.X.; Zhang, Y.; Tang, Z.Q.; Yu, J.H. Effects of balanced fertilization on growth, quality, mineral elements contents and yield of tomato cultivated in substrate in greenhouse. Acta Agric. Zhejiangensis 2022, 34, 1648–1660. [Google Scholar]
- Bona, E.; Cantamessa, S.; Massa, N.; Manassero, P.; Marsano, F.; Copetta, A.; Lingua, G.; D’agostino, G.; Gamalero, E.; Berta, G. Arbuscular mycorrhizal fungi and plant growth-promoting pseudomonads improve yield, quality and nutritional value of tomato: A field study. Mycorrhiza 2017, 27, 1–11. [Google Scholar] [CrossRef]
- Miao, Y.N.; Ren, J.L.; Zhang, Y.; Chen, X.M.; Qi, M.F.; Li, T.L.; Zhang, G.X.; Liu, Y.F. Effect of low root-zone temperature on photosynthesis, root structure and mineral element absorption of tomato seedlings. Sci. Hortic. 2023, 315, 111956. [Google Scholar] [CrossRef]
- Ruan, Y.-L.; Jin, Y.; Yang, Y.-J.; Li, G.-J.; Boyer, J.S. Sugar Input, Metabolism, and Signaling Mediated by Invertase: Roles in Development, Yield Potential, and Response to Drought and Heat. Mol. Plant 2010, 3, 942–955. [Google Scholar] [CrossRef] [PubMed]
- Zhu, Z.; Liu, R.; Li, B.; Tian, S. Characterisation of genes encoding key enzymes involved in sugar metabolism of apple fruit in controlled atmosphere storage. Food Chem. 2013, 141, 3323–3328. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.J.; Liu, L.; Wang, Y.; Tao, H.; Fan, J.; Zhao, Z.; Guo, Y. Effects of soil water stress on fruit yield, quality and their relationship with sugar metabolism in ‘Gala’ apple. Sci. Hortic. 2019, 258, 108753. [Google Scholar] [CrossRef]
- Shi, K.; Liu, Z.; Wang, J.; Zhu, S.; Huang, D. Nitric oxide modulates sugar metabolism and maintains the quality of red raspberry during storage. Sci. Hortic. 2019, 256, 108611. [Google Scholar] [CrossRef]
- Wulfert, S.; Schilasky, S.; Krueger, S. Transcriptional and Biochemical Characterization of Cytosolic Pyruvate Kinases in Arabidopsis thaliana. Plants 2020, 9, 353. [Google Scholar] [CrossRef]
- Leskow, C.C.; Conte, M.; del Pozo, T.; Bermúdez, L.; Lira, B.S.; Gramegna, G.; Baroli, I.; Burgos, E.; Zavallo, D.; Kamenetzky, L.; et al. The cytosolic invertase NI6 affects vegetative growth, flowering, fruit set, and yield in tomato. J. Exp. Bot. 2021, 72, 2525–2543. [Google Scholar] [CrossRef]
- Huang, Y.-X.; Yin, Y.-G.; Sanuki, A.; Fukuda, N.; Ezura, H.; Matsukura, C. Phosphoenolpyruvate carboxykinase (PEPCK) deficiency affects the germination, growth and fruit sugar content in tomato (Solanum lycopersicum L.). Plant Physiol. Biochem. 2015, 96, 417–425. [Google Scholar] [CrossRef] [PubMed]
- Zhao, B.Y.; Qi, K.; Yi, X.; Chen, G.; Liu, X.; Qi, X.; Zhang, S. Identification of hexokinase family members in pear (Pyrus x bretschneideri) and functional exploration of PbHXK1 in modulating sugar content and plant growth. Gene 2019, 711, 143932. [Google Scholar] [CrossRef]
- Worrell, A.C.; Bruneau, J.-M.; Summerfelt, K.; Boersig, M.; Voelker, T.A. Expression of a maize sucrose phosphate synthase in tomato alters leaf carbohydrate partitioning. Plant Cell 1991, 3, 1121. [Google Scholar] [CrossRef] [PubMed]
- Cho, M.-H.; Jang, A.; Bhoo, S.H.; Jeon, J.-S.; Hahn, T.-R. Manipulation of triose phosphate/phosphate translocator and cytosolic fructose-1,6-bisphosphatase, the key components in photosynthetic sucrose synthesis, enhances the source capacity of transgenic Arabidopsis plants. Photosynth. Res. 2012, 111, 261–268. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Chen, G.; Zhang, J.; Shen, H.; Kang, J.; Feng, P.; Xie, Q.; Hu, Z. Suppression of a hexokinase gene, SlHXK1, leads to accelerated leaf senescence and stunted plant growth in tomato. Plant Sci. 2020, 298, 110544. [Google Scholar] [CrossRef] [PubMed]
- Gülüt, K.Y.; Şentürk, G.G. Impact of nitrogen fertilizer type and application rate on growth, nitrate accumulation, and postharvest quality of spinach. PeerJ 2024, 12, e17726. [Google Scholar] [CrossRef] [PubMed]
- Namitha, K.K.; Negi, P.S. Chemistry and Biotechnology of Carotenoids. Crit. Rev. Food Sci. Nutr. 2010, 50, 728–760. [Google Scholar] [CrossRef] [PubMed]
- Takemura, M.; Sahara, T.; Misawa, N. Violaxanthin: Natural function and occurrence, biosynthesis, and heterologous production. Appl. Microbiol. Biotechnol. 2021, 105, 6133–6142. [Google Scholar] [CrossRef] [PubMed]
- Arthanari, M.; Dhanapalan, S. Quantification of β-carotene, lycopene, and chlorophyll content in tomato fruits of enrichment of chicken feathers composting. Int. J. Recycl. Org. Waste Agric. 2019, 8, 473–477. [Google Scholar] [CrossRef]
- Jin, N.; Jin, L.; Wang, S.; Meng, X.; Ma, X.; He, X.; Zhang, G.; Luo, S.; Lyu, J.; Yu, J. A Comprehensive Evaluation of Effects on Water-Level Deficits on Tomato Polyphenol Composition, Nutritional Quality and Antioxidant Capacity. Antioxidants 2022, 11, 1585. [Google Scholar] [CrossRef]
- Lombardo, S.; Pandino, G.; Mauromicale, G. The nutraceutical response of two globe artichoke cultivars to contrasting NPK fertilizer regimes. Food Res. Int. 2015, 76, 852–859. [Google Scholar] [CrossRef]
- Heimler, D.; Romani, A.; Ieri, F. Plant polyphenol content, soil fertilization and agricultural management: A review. Eur. Food Res. Technol. 2017, 243, 1107–1115. [Google Scholar] [CrossRef]
- Buttery, R.G.; Seifert, R.M.; Guadagni, D.G.; Ling, L.C. Characterization of additional volatile components of tomato. J. Agric. Food Chem. 1971, 19, 524–529. [Google Scholar] [CrossRef]
- Rebouças, T.; Porto, J.; Jesus, J.; Moraes, M. Effects of different nitrogen sources and levels on tomato fruit quality. Acta Hortic. 2015, 1106, 79–84. [Google Scholar] [CrossRef]
- Ozores-Hampton, M.; Simonne, E.; McAvoy, G.; Roka, F.; Stansly, P.; Shukla, S.; Robert, P.; Morga, K.; Cushman, K.; Parmenter, D.; et al. Nitrogen Best Managenment Practice with Tomato Production in Florida in the 2005–2006 Season. Proc. Fla. State Hort. Soc. 2006, 119, 284–288. [Google Scholar]
- Wang, L.; Baldwin, E.A.; Plotto, A.; Luo, W.; Raithore, S.; Yu, Z.; Bai, J. Effect of methyl salicylate and methyl jasmonate pre-treatment on the volatile profile in tomato fruit subjected to chilling temperature. Postharvest Biol. Technol. 2015, 108, 28–38. [Google Scholar] [CrossRef]
- Tieman, D.; Taylor, M.; Schauer, N.; Fernie, A.R.; Hanson, A.D.; Klee, H.J. Tomato aromatic amino acid decarboxylases participate in synthesis of the flavor volatiles 2-phenylethanol and 2-phenylacetaldehyde. Proc. Natl. Acad. Sci. USA 2006, 103, 8287–8292. [Google Scholar] [CrossRef]
Treatments | Fertilizer Dosage (kg/ha) | ||
---|---|---|---|
N | P2O5 | K2O | |
CK0 | 0 | 0 | 0 |
CK | 355.5 | 576 | 1093.5 |
T1 | 575.7 | 246.75 | 797.7 |
T2 | 503.7 | 216 | 697.5 |
Gene Number | Name | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
---|---|---|---|
Solyc03g121070.2 | HK1 | GCACTATACAGAATACAGGATG | AATGAGAGGCAGCAAGAA |
Solyc06g066440.2 | HK2 | ATCCAATACCTCCTTGAAGA | ATACAATCCGCCATCCAT |
Solyc01g106010.2 | FBP | CTCTTGACACATCCTAACATC | ATTGCTACGCCACCATAT |
Solyc01g049650.2 | PK1 | CCTGCTGAGTCTACGAAT | ATAATCTTAACCACCGATGC |
Solyc01g106780.2 | PK2 | TGGTCAGGTGGAAGTTAT | CCAGAATCTCGGAAGGTA |
Solyc12g088160.1 | PEPCK | TGGTCAGGTGGAAGTTAT | CCAGAATCTCGGAAGGTA |
Solyc07g045110.1 | SPS | TATTCGTCCTTCCATTCTGA | GTCTTCATCCTCAACAACAA |
Solyc02g081300.2 | SS | GCTCAAGGACAGGACTAA | GCTCATACATCTTCTTCATCTC |
Solyc03g083910.2 | AI | CGGAATTGGATTGTGGAAT | CAGGTCAGCAGATTCACT |
Solyc01g058010.2 | NI | GCGTATAATCACTGGTAGC | GAATCCACTGCCTTCTTAG |
Solyc03g078400.2 | Actin | TGTCCCTATCTACGAGGGTTATGC | AGTTAAATCACGACCAGCAAGAT |
Content (μg·g−1 DW) | CK0 | CK | T1 | T2 |
---|---|---|---|---|
Quercetin | 103.56 ± 2.65 c | 462.50 ± 5.59 b | 772.65 ± 6.18 a | 612.32 ± 7.95 ab |
Rutin | 125.21 ± 8.87 ab | 115.85 ± 9.64 b | 156.69 ± 16.54 a | 114.04 ± 2.82 b |
Naringenin | 2.31 ± 0.11 b | 2.32 ± 0.20 b | 3.57 ± 0.11 a | 2.95 ± 0.31 ab |
p-Hydroxybenzoic acid | 9.22 ± 0.83 c | 9.99 ± 0.57 c | 17.74 ± 0.62 a | 14.55 ± 1.24 b |
Protocatechuic acid | 8.39 ± 0.69 d | 33.26 ± 3.01 c | 76.79 ± 1.52 a | 53.15 ± 1.74 b |
Cinnamic acid | 0.799 ± 0.08 b | 1.16 ± 0.08 a | 1.08 ± 0.04 a | 1.02 ± 0.09 ab |
4-coumalic acid | 1.86 ± 0.08 c | 2.60 ± 0.08 b | 4.00 ± 0.16 a | 2.10 ± 0.14 c |
Gallic acid | 50.379 ± 1.40 d | 60.55 ± 0.73 c | 93.22 ± 1.6 b | 100.47 ± 3.5 a |
Benzoic acid | 123.93 ± 2.03 ab | 126.06 ± 2.66 b | 139.46 ± 1.52 a | 113.42 ± 5.7 c |
Ferulic acid | 1.52 ± 0.25 c | 1.32 ± 0.15 c | 5.66 ± 0.13 a | 2.32 ± 0.12 b |
Caffeic acid | 21.04 ± 0.96 ab | 23.83 ± 0.92 a | 20.30 ± 1.14 b | 15.53 ± 0.62 c |
Cynarin | 26.54 ± 0.96 c | 31.57 ± 1.32 bc | 51.96 ± 4.08 a | 37.35 ± 1.4 b |
2,5-dihydroxybenzoic acid | 155.51 ± 4.00 c | 153.81 ± 3.16 c | 554.16 ± 5.67 a | 231.08 ± 5.18 b |
Categories | Volatile Compounds | Chemical Formulas | Contents (µg·kg−1) | |||
---|---|---|---|---|---|---|
CK0 | CK | T1 | T2 | |||
Alcohols | Ethanol | C2H6O | 293.95 ± 63.58 b | 315.17 ± 30.18 b | 496.97 ± 44.72 a | 317.34 ± 13.51 b |
2-Octanol, (S)- | C8H18O | 4.43 ± 0.69 b | 4.77 ± 0.86 b | 6.92 ± 0.33 a | 2.8 ± 0.42 b | |
1-Butanol, 3-methyl- | C5H12O | 9.28 ± 0.55 b | 7.44 ± 0.89 b | 19.14 ± 0.42 a | 15.45 ± 2.11 a | |
Methane, isocyanato- | C5H12O | 4.94 ± 0.94 b | 6.24 ± 0.07 ab | 8.62 ± 0.65 a | 8.34 ± 1.13 a | |
1-Penten-3-ol | C5H10O | 1.73 ± 0.1 a | 1.53 ± 0.05 a | 2.58 ± 1.05 a | 1.69 ± 0.14 a | |
1-Pentanol | C5H12O | 2.04 ± 0.87 c | 7.24 ± 1.82 b | 12.59 ± 0.66 a | 2 ± 0.42 c | |
1-Hexanol | C6H14O | 106.57 ± 5.3 b | 139.25 ± 44.49 b | 326.23 ± 30.07 a | 173.32 ± 26.88 b | |
1-Ethynylcyclohexanol | C8H12O | 1.3 ± 0.4 b | 3.21 ± 0.68 a | 3.49 ± 0.18 a | 2.41 ± 0.09 ab | |
(Z)-3-Hexen-1-ol | C6H12O | 132.22 ± 6.88 b | 145.45 ± 10.4 b | 604.48 ± 48.38 a | 515.16 ± 53.93 a | |
Methyl nonyl ether | C16H34O | 2.36 ± 0.5 b | 2.23 ± 0.92 b | 6.95 ± 0.27 a | 4.17 ± 0.8 b | |
1-Heptanol | C7H16O | n.d. | 4.37 ± 0.21 | 4.02 ± 0.15 | 3.73 ± 0.11 | |
2-Octen-1-ol | C8H16O | 2.13 ± 0.3 b | 1.07 ± 0.08 b | 6.34 ± 0.6 a | 4.82 ± 0.88 a | |
Hept-(4Z)-en-1-ol | C7H14O | 0.33 ± 0.16 c | 1.26 ± 0.14 bc | 4.41 ± 0.4 a | 2.58 ± 0.52 b | |
Benzyl alcohol | C7H8O | 0.54 ± 0.03 a | 0.67 ± 0.28 a | 0.97 ± 0.22 a | 0.71 ± 0.16 a | |
l-Phenylethyl Alcohol | C8H10O | 1.03 ± 0.06 c | 1.86 ± 0.46 bc | 3.84 ± 0.39 a | 2.56 ± 0.48 b | |
Aldehydes | 2-Butenal, 2-methyl-, (E)- | C5H8O | 3.3 ± 0.82 a | 5.03 ± 0.44 a | 6.06 ± 1.22 a | 4.4 ± 1.19 a |
3-Hexenal | C6H10O | 2.31 ± 0.54 b | 4.32 ± 0.6 b | 10.23 ± 1.06 a | 4.08 ± 1.33 b | |
Hexanal <n-> | C6H12O | 16.71 ± 1.74 b | 22.43 ± 3.25 b | 40.04 ± 4.73 a | 41.78 ± 0.5 a | |
(E)-2-Heptenal | C7H12O | n.d. | n.d. | 2.23 ± 0.09 | n.d. | |
Pent-(2E)-enal | C6H10O | 106.1 ± 10.28 b | 131.09 ± 23.43 b | 283.16 ± 15.84 a | 232.62 ± 5.24 a | |
Cyclohexane, 1,1’-(2-methyl-1,3-propanediyl) bis- | C6H10O | 87.57 ± 3.69 b | 133.50 ± 13.73 b | 234.83 ± 7.5 a | 225.09 ± 27.97 a | |
2-Cyclohexen-1-ol | C6H10O | 120.28 ± 10.28a | 97.86 ± 23.43 b | 89.1115.84 b | 121.69 ± 5.24 a | |
(E)-2-Hexenal | C6H12O | 2.97 ± 0.58 b | 1.89 ± 0.52 b | 4.56 ± 0.4 a | 1.81 ± 0.26 b | |
Octanal | C8H16O | 2.26 ± 1.01 a | 2.11 ± 0.38 a | 3.72 ± 1.86 a | 1.33 ± 0.33 a | |
2-Isobutylthiazole | C6H10O | 1.94 ± 0.94d | 2.30 ± 1.01c | 3.43 ± 0.64a | 2.87 ± 1.23b | |
Nonanal | C9H18O | 2.49 ± 0.51 b | 2.14 ± 0.26 b | 9.07 ± 0.39 a | 3.3 ± 0.78 b | |
Benzaldehyde | C7H6O | 2.96 ± 0.64 b | 3.56 ± 0.06 b | 14.55 ± 2.34 a | 6.22 ± 0.49 b | |
(Z)-4-Decenal | C10H18O | n.d. | n.d. | 1.37 ± 0.12 | 1.25 ± 0.09 | |
Esters | Acetate <ethyl-> | C4H8O2 | 3.69 ± 0.58 a | 3.28 ± 0.5 a | 4.11 ± 0.31 a | 3.71 ± 0.52 a |
1-Butanol, 3-methyl-, acetate | C7H14O2 | n.d. | 3.21 | 3.21 | 2.75 | |
Hex-(3Z)-enyl acetate | C8H14O2 | 2.95 ± 1.1 b | 3.4 ± 1.25 b | 10.89 ± 0.38 a | 3.84 ± 1.06 b | |
Butyl salicylate | C11H14O3 | 1.58 ± 0.7 b | 0.7 ± 0.47 b | 4.64 ± 0.75 a | 1.75 ± 0.47 b | |
Methyl N-phenyl carbamate | C8H9NO2 | n.d. | n.d. | 40.72 ± 2.30 | 36.46 ± 1.29 | |
Ketones | Penten-3-one | C5H8O | 5.91 ± 0.51 b | 6.45 ± 0.02 b | 9.81 ± 0.88 a | 6.92 ± 0.21 b |
Cycloheptadecanone | C17H32O | 2.37 ± 0.55 b | 2.75 ± 1.11 b | 5.56 ± 0.55 a | 1.47 ± 0.09 b | |
2-Octanone | C8H16O | 1.2 ± 0.24 b | 2.88 ± 0.04 ab | 5.13 ± 0.9 a | 4.63 ± 1.67 ab | |
Hept-5-en-2-one <6-methyl-> | C8H14O | 3.79 ± 2.03 c | 13.03 ± 2.37 b | 19.59 ± 0.77 a | 12.11 ± 0.75 b | |
2-Hydroxy acetophenone | C8H8O2 | 0.55 ± 0.19 a | 0.31 ± 0.07 a | 0.79 ± 0.39 a | 0.4 ± 0.06 a | |
Geranyl acetone | C13H22O | 2.07 ± 0.93 b | 5.38 ± 0.98 a | 5.09 ± 0.61 ab | 4.49 ± 0.91 ab | |
trans-á-Ionone | C13H20O | 0.33 ± 0.16 c | 1.26 ± 0.14 bc | 4.41 ± 0.4 a | 2.58 ± 0.52 b | |
Hydrocarbons | p-Xylene | C8H10 | n.d. | n.d. | n.d. | 0.56 ± 0.01 |
Tridecane | C13H28 | n.d. | n.d. | n.d. | 0.07 ± 0.01 | |
Phenols | Phenol, 2-methoxy- | C7H8O2 | 2.64 ± 0.26 c | 3.17 ± 0.19 c | 11 ± 1.25 a | 8.24 ± 1.09 b |
Eugenol | C10H12O2 | 0.62 ± 0.12 b | 0.96 ± 0.21 ab | 1.56 ± 0.12 a | 1.27 ± 0.29 ab | |
Carvacrol | C10H14O | 0.6 ± 0.1 b | 1.58 ± 0.41 ab | 1.97 ± 0.12 a | 1.14 ± 0.48 ab | |
Others | Furan <2-pentyl-> | C9H14O | 185.67 ± 17.93 b | 186.47 ± 15.68 b | 296.51 ± 42.66 a | 249.9 ± 20.22 ab |
2-Isobutylthiazole | C7H11NS | 4.13 ± 0.85 b | 3.46 ± 0.56 b | 9.12 ± 0.39 a | 1.72 ± 0.85 b | |
Total content (µg·kg−1) | 1129.84 | 1286.28 | 2644.02 | 2047.53 |
Characteristic Aroma Component | Aroma Type | Content (µg·kg−1) | |||
---|---|---|---|---|---|
CK0 | CK | T1 | T2 | ||
1-Penten-3-ol | Fruity | 1.73 ± 0.1 a | 1.53 ± 0.05 a | 2.58 ± 1.05 a | 1.69 ± 0.14 a |
(Z)-3-Hexen-1-ol, | Grassy, green | 132.22 ± 6.88 b | 145.45 ± 10.4 b | 604.48 ± 48.38 a | 515.16 ± 53.93 a |
l-Phenylethyl Alcohol | Floral | 1.03 ± 0.06 c | 1.86 ± 0.46 bc | 3.84 ± 0.39 a | 2.56 ± 0.48 b |
3-Hexenal | Grassy, green | 2.31 ± 0.54 b | 4.32 ± 0.6 b | 10.23 ± 1.06 a | 4.08 ± 1.33 b |
Hexanal <n-> | Grassy, green | 16.71 ± 1.74 b | 22.43 ± 3.25 b | 40.04 ± 4.73 a | 41.78 ± 0.5 a |
(E)-2-Heptenal | Grassy | n.d. | n.d. | 2.23 ± 0.09 | n.d. |
(E)-2-Hexenal | Grassy, green | 2.97 ± 0.58 b | 1.89 ± 0.52 b | 4.56 ± 0.4 a | 1.81 ± 0.26 b |
Penten-3-one | Fruity | 5.91 ± 0.51 b | 6.45 ± 0.02 b | 9.81 ± 0.88 a | 6.92 ± 0.21 b |
Hept-5-en-2-one <6-methyl-> | Fruity | 3.79 ± 2.03 c | 13.03 ± 2.37 b | 19.59 ± 0.77 a | 12.11 ± 0.75 b |
trans-á-Ionone | Fruity, aromatic | 0.33 ± 0.16 c | 1.26 ± 0.14 bc | 4.41 ± 0.4 a | 2.58 ± 0.52 b |
2-Isobutylthiazole | Fruity, green | 4.13 ± 0.85 b | 3.46 ± 0.56 b | 9.12 ± 0.39 a | 1.72 ± 0.85 b |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, W.; Zhang, Y.; Tang, Z.; Wang, J.; Wu, Y.; Yu, J. Balanced Fertilization Enhances the Nutritional Value and Flavor Profile of Tomato Fruits. Foods 2024, 13, 3599. https://doi.org/10.3390/foods13223599
Li W, Zhang Y, Tang Z, Wang J, Wu Y, Yu J. Balanced Fertilization Enhances the Nutritional Value and Flavor Profile of Tomato Fruits. Foods. 2024; 13(22):3599. https://doi.org/10.3390/foods13223599
Chicago/Turabian StyleLi, Wangxiong, Yang Zhang, Zhongqi Tang, Junwen Wang, Yue Wu, and Jihua Yu. 2024. "Balanced Fertilization Enhances the Nutritional Value and Flavor Profile of Tomato Fruits" Foods 13, no. 22: 3599. https://doi.org/10.3390/foods13223599
APA StyleLi, W., Zhang, Y., Tang, Z., Wang, J., Wu, Y., & Yu, J. (2024). Balanced Fertilization Enhances the Nutritional Value and Flavor Profile of Tomato Fruits. Foods, 13(22), 3599. https://doi.org/10.3390/foods13223599