Fresh and Browned Lotus Root Extracts Promote Cholesterol Metabolism in FFA-Induced HepG2 Cells through Different Pathways
Abstract
:1. Introduction
2. Materials and Methods
2.1. Preparation of Lotus Root Extracts before and after Browning and Identification of the Extracts
2.1.1. Browning of Fresh Lotus Roots
2.1.2. Extraction of Substances from Fresh and Browned Lotus Roots
2.2. Cell Culture and Treatment
2.3. Cell Viability Assay
2.4. Measurement of Intracellular TC and TG Levels
2.5. RT-PCR
2.6. Western Blot
2.7. Statistical Analysis
3. Results and Discussion
3.1. Selection of Monomer Compounds in FLRE and BLRE
3.2. Cell Viability Assay to Determine the Doses of Each Group
3.3. Effect on TC and TG
3.4. FLRE Could Motivate the Synthesis of Bile Acid through FXR/FGF19-CYP7A1/CYP27A1 Pathway
3.4.1. Effect of FLRE and BLRE on the Expression of Genes and Proteins Related to Cholesterol Biotransformation
3.4.2. Effect of the Principal Monomer Components from FLRE and BLRE on the Expression of Genes and Proteins Related to Cholesterol Biotransformation
3.5. FLRE Could Promote the Clearance and Efflux of Cholesterol by Activating LDLR and ABCA1
3.5.1. Effect of FLRE and BLRE on LDLR and ABCA1 Expressions
3.5.2. Effect of the Principal Monomer Components of FLRE and BLRE on LDLR and ABCA1 Expression
3.6. BLRE Could Regulate SREBP2-HMGCR-Mediated Synthesis of Cholesterol
3.6.1. Effect of FLRE and BLRE on Cholesterol Synthesis Related Genes and Protein Expression
3.6.2. Effect of the Principal Monomer Components from FLRE and BLRE on Cholesterol-Synthesis-Related Genes and Protein Expression
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Jung, E.; Kong, S.Y.; Ro, Y.S.; Ryu, H.H.; Shin, S.D. Serum Cholesterol Levels and Risk of Cardiovascular Death: A Systematic Review and a Dose-Response Meta-Analysis of Prospective Cohort Studies. Int. J. Environ. Res. Public Health 2022, 19, 8272. [Google Scholar] [CrossRef]
- Luo, J.; Yang, H.; Song, B.-L. Mechanisms and regulation of cholesterol homeostasis. Nat. Rev. Mol. Cell Biol. 2020, 21, 225–245. [Google Scholar] [CrossRef]
- Byrnes, K.; Blessinger, S.; Bailey, N.T.; Scaife, R.; Liu, G.; Khambu, B. Therapeutic regulation of autophagy in hepatic metabolism. Acta Pharm. Sin. B 2022, 12, 33–49. [Google Scholar] [CrossRef] [PubMed]
- Jiang, L.; Zhang, H.; Xiao, D.; Wei, H.; Chen, Y. Farnesoid X receptor (FXR): Structures and ligands. Comput. Struct. Biotechnol. J. 2021, 19, 2148–2159. [Google Scholar] [CrossRef] [PubMed]
- Guthrie, G.; Vonderohe, C.; Burrin, D. Fibroblast growth factor 15/19 expression, regulation, and function: An overview. Mol. Cell Endocrinol. 2022, 548, 111617. [Google Scholar] [CrossRef] [PubMed]
- Go, G.-W.; Mani, A. Low-density lipoprotein receptor (LDLR) family orchestrates cholesterol homeostasis. Yale J. Biol. Med. 2012, 85, 19–28. [Google Scholar]
- Yu, X.-H.; Fu, Y.-C.; Zhang, D.-W.; Yin, K.; Tang, C.-K. Foam cells in atherosclerosis. Clin. Chim. Acta 2013, 424, 245–252. [Google Scholar] [CrossRef]
- Mok, E.H.K.; Leung, C.O.N.; Zhou, L.; Lei, M.M.L.; Leung, H.W.; Tong, M.; Wong, T.L.; Lau, E.Y.T.; Ng, I.O.L.; Ding, J.; et al. Caspase-3-Induced Activation of SREBP2 Drives Drug Resistance via Promotion of Cholesterol Biosynthesis in Hepatocellular Carcinoma. Cancer Res. 2022, 82, 3102–3115. [Google Scholar] [CrossRef]
- Kim, H.; Kim, D.-H.; Seo, K.-H.; Chon, J.-W.; Nah, S.-Y.; Bartley, G.E.; Arvik, T.; Lipson, R.; Yokoyama, W. Modulation of the intestinal microbiota is associated with lower plasma cholesterol and weight gain in hamsters fed chardonnay grape seed flour. J. Agric. Food Chem. 2015, 63, 1460–1467. [Google Scholar] [CrossRef]
- Lebeau, P.F.; Byun, J.H.; Platko, K.; Saliba, P.; Sguazzin, M.; MacDonald, M.E.; Paré, G.; Steinberg, G.R.; Janssen, L.J.; Igdoura, S.A.; et al. Caffeine blocks SREBP2-induced hepatic PCSK9 expression to enhance LDLR-mediated cholesterol clearance. Nat. Commun. 2022, 13, 770. [Google Scholar] [CrossRef]
- Liang, J.; Wang, C.; Peng, J.; Li, W.; Jin, Y.; Liu, Q.; Meng, Q.; Liu, K.; Sun, H. Naringin regulates cholesterol homeostasis and inhibits inflammation via modulating NF-κB and ERK signaling pathways in vitro. Die Pharm. 2016, 71, 101–108. [Google Scholar]
- Wu, Y.-R.; Shi, X.-Y.; Ma, C.-Y.; Zhang, Y.; Xu, R.-X.; Li, J.-J. Liraglutide improves lipid metabolism by enhancing cholesterol efflux associated with ABCA1 and ERK1/2 pathway. Cardiovasc. Diabetol. 2019, 18, 146. [Google Scholar] [CrossRef]
- Wu, Y.-R.; Li, L.; Sun, X.-C.; Wang, J.; Ma, C.-Y.; Zhang, Y.; Qu, H.-L.; Xu, R.-X.; Li, J.-J. Diallyl disulfide improves lipid metabolism by inhibiting PCSK9 expression and increasing LDL uptake via PI3K/Akt-SREBP2 pathway in HepG2 cells. Nutr. Metab. Cardiovasc. Dis. 2021, 31, 322–332. [Google Scholar] [CrossRef] [PubMed]
- Hu, M.; Skibsted, L.H. Antioxidative capacity of rhizome extract and rhizome knot extract of edible lotus (Nelumbo nuficera). Food Chem. 2002, 76, 327–333. [Google Scholar] [CrossRef]
- Jiang, Y.; Ng, T.B.; Liu, Z.; Wang, C.; Li, N.; Qiao, W.; Liua, F. Immunoregulatory and anti-HIV-1 enzyme activities of antioxidant components from lotus (Nelumbo nucifera Gaertn.) rhizome. Biosci. Rep. 2011, 31, 381–390. [Google Scholar] [CrossRef] [PubMed]
- Rumanti, R.M.; Nainggolan, M.; Harahap, U. Phytochemical screening and antidiabetic activity of different leaf extracts from lotus (nelumbo nucifera gaertn.) in streptozotocin induced mice. Asian J. Pharm. Clin. Res. 2017, 10, 190–192. [Google Scholar] [CrossRef]
- You, J.S.; Lee, Y.J.; Kim, K.S.; Kim, S.H.; Chang, K.J. Ethanol extract of lotus (Nelumbo nucifera) root exhibits an anti-adipogenic effect in human pre-adipocytes and anti-obesity and anti-oxidant effects in rats fed a high-fat diet. Nutr. Res. 2014, 34, 258–267. [Google Scholar] [CrossRef]
- Tsuruta, Y.; Nagao, K.; Kai, S.; Tsuge, K.; Yoshimura, T.; Koganemaru, K.; Yanagita, T. Polyphenolic extract of lotus root (edible rhizome of Nelumbo nucifera) alleviates hepatic steatosis in obese diabetic db/db mice. Lipids Health Dis. 2011, 10, 202. [Google Scholar] [CrossRef]
- Li, C.; Li, J.; Yan, S.; Wang, Q. The mechanism of interaction between lotus rhizome polyphenol oxidase and ascorbic acid: Inhibitory activity, thermodynamics, and conformation analysis. J. Food Biochem. 2022, 46, e14047. [Google Scholar] [CrossRef]
- Moon, K.M.; Kwon, E.-B.; Lee, B.; Kim, C.Y. Recent Trends in Controlling the Enzymatic Browning of Fruit and Vegetable Products. Molecules 2020, 25, 2754. [Google Scholar] [CrossRef]
- Li, Y.; Jiang, J.-G. Health functions and structure-activity relationships of natural anthraquinones from plants. Food Funct. 2018, 9, 6063–6080. [Google Scholar] [CrossRef] [PubMed]
- Neilson, A.P.; Song, B.J.; Sapper, T.N.; Bomser, J.A.; Ferruzzi, M.G. Tea catechin auto-oxidation dimers are accumulated and retained by Caco-2 human intestinal cells. Nutr. Res. 2010, 30, 327–340. [Google Scholar] [CrossRef] [PubMed]
- Kren, V.; Martínková, L. Glycosides in medicine: “The role of glycosidic residue in biological activity”. Curr Med Chem 2001, 8, 1303–1328. [Google Scholar] [CrossRef] [PubMed]
- Lamb, Y.N. Rosuvastatin/Ezetimibe: A Review in Hypercholesterolemia. Am J Cardiovasc Drugs 2020, 20, 381–392. [Google Scholar] [CrossRef]
- Mullen, P.J.; Lüscher, B.; Scharnagl, H.; Krähenbühl, S.; Brecht, K. Effect of simvastatin on cholesterol metabolism in C2C12 myotubes and HepG2 cells, and consequences for statin-induced myopathy. Biochem. Pharmacol. 2010, 79, 1200–1209. [Google Scholar] [CrossRef]
- Lake, N.J.; Taylor, R.L.; Trahair, H.; Harikrishnan, K.N.; Curran, J.E.; Almeida, M.; Kulkarni, H.; Mukhamedova, N.; Hoang, A.; Low, H.; et al. TRAK2, a novel regulator of ABCA1 expression, cholesterol efflux and HDL biogenesis. Eur. Heart J. 2017, 38, 3579–3587. [Google Scholar] [CrossRef] [PubMed]
- Lluis, J.M.; Colell, A.; García-Ruiz, C.; Kaplowitz, N.; Fernández-Checa, J.C. Acetaldehyde impairs mitochondrial glutathione transport in HepG2 cells through endoplasmic reticulum stress. Gastroenterology 2003, 124, 708–724. [Google Scholar] [CrossRef]
- Letaief, T.; Garzoli, S.; Laghezza Masci, V.; Mejri, J.; Abderrabba, M.; Tiezzi, A.; Ovidi, E. Valentina Laghezza Masci 3 Antonio Tiezzi 3 and Elisa Ovidi 3. Chemical Composition and Biological Activities of Tunisian Ziziphus lotus Extracts: Evaluation of Drying Effect, Solvent Extraction, and Extracted Plant Parts. Plants 2021, 10, 2651. [Google Scholar] [CrossRef]
- Jane, V.; Higdon, B.F. Tea catechins and polyphenols: Health effects, metabolism, and antioxidant functions. Crit. Rev. Food Sci. Nutr. 2003, 43, 89–143. [Google Scholar]
- Elsayed, A.S.I. Green tea antioxidant effects and its ameliorative role against many diseases. Int. J. Appl. Biol. Pharm. Technol. 2016, 7, 73–94. [Google Scholar]
- Salim, S.; Al-Rejaie, H.M.A.; Mohammed, M.; Ahmed Abdulaziz, M.; Aleisa Alkhamees, A.S.A. Immobilization stress-induced oxidative damage and its amelioration with green and black teas. Afr. J. Pharm. Pharmacol. 2012, 6, 538–545. [Google Scholar]
- Naghma Khan, H.M. Tea Polyphenols in Promotion of Human Health. Nutrients 2018, 11, 39. [Google Scholar] [CrossRef] [PubMed]
- Ming, D.S.; Yu, D.Q.; Yu, S.S. Two new caffeyol glycosides from Forsythia suspensa. J. Asian Nat. Prod. Res. 1999, 1, 327–335. [Google Scholar] [CrossRef]
- Qi, M.; Zhao, S.; Zhou, B.; Zhang, M.; Zhang, H.; Wang, Y.; Hu, P. Probing the degradation mechanism of forsythiaside A and simultaneous determination of three forsythiasides in Forsythia preparations by a single marker. J. Sep. Sci. 2019, 42, 3503–3511. [Google Scholar] [CrossRef] [PubMed]
- Lee, M.R.; Yang, H.J.; Park, K.I.; Ma, J.Y. Lycopus lucidus Turcz. ex Benth. Attenuates free fatty acid-induced steatosis in HepG2 cells and non-alcoholic fatty liver disease in high-fat diet-induced obese mice. Phytomedicine Int. J. Phytother. Phytopharm. 2019, 55, 14–22. [Google Scholar] [CrossRef]
- Yao, H.-R.; Liu, J.; Plumeri, D.; Cao, Y.-B.; He, T.; Lin, L.; Li, Y.; Jiang, Y.-Y.; Li, J.; Shang, J. Lipotoxicity in HepG2 cells triggered by free fatty acids. Am. J. Transl. Res. 2011, 3, 284–291. [Google Scholar]
- Tomonori Nagao, T.H.; Tokimitsu, I. A Green Tea Extract High in Catechins Reduces Body Fat and Cardiovascular Risks in Humans. Obesity 2007, 15, 1473–1483. [Google Scholar] [CrossRef]
- Salau, V.F.; Erukainure, O.L.; Ijomone, O.M.; Islam, S. Caffeic acid regulates glucose homeostasis and inhibits purinergic and cholinergic activities while abating oxidative stress and dyslipidaemia in fructose-streptozotocin-induced diabetic rats. J. Pharm. Pharmacol. 2022, 74, 973–984. [Google Scholar] [CrossRef]
- Cai, X.; Liu, Z.; Dong, X.; Wang, Y.; Zhu, L.; Li, M.; Xu, Y. Hypoglycemic and lipid lowering effects of theaflavins in high-fat diet-induced obese mice. Food Funct. 2021, 12, 9922–9931. [Google Scholar] [CrossRef]
- Mario, A.; Vermeer, T.P.J.M.; Molhuizen, H. Theaflavins from black tea, especially theaflavin-3-gallate, reduce the incorporation of cholesterol into mixed micelles. J. Agric. Food Chem. 2008, 56, 12031–12036. [Google Scholar]
- Huang, F.; Zheng, X.; Ma, X.; Jiang, R.; Zhou, W.; Zhou, S.; Zhang, Y.; Lei, S.; Wang, S.; Kuang, J.; et al. Theabrownin from Pu-erh tea attenuates hypercholesterolemia via modulation of gut microbiota and bile acid metabolism. Nat. Commun. 2019, 10, 4971. [Google Scholar] [CrossRef] [PubMed]
- Zuo, H.; Su, X.; Jin, Y.; Zhang, C.; Wang, L.; Yang, L. Transthyretin Regulated by linc00657/miR-205-5p Promoted Cholesterol Metabolism by Inducing SREBP2-HMGCR and Inhibiting LXRa-CYP7A1. Arch. Med. Res. 2020, 51, 317–326. [Google Scholar] [CrossRef] [PubMed]
- Ren, K.; Li, H.; Zhou, H.-F.; Liang, Y.; Tong, M.; Chen, L.; Zheng, X.-L.; Zhao, G.-J. Mangiferin promotes macrophage cholesterol efflux and protects against atherosclerosis by augmenting the expression of ABCA1 and ABCG1. Aging 2019, 11, 10992–11009. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.-D.; Chen, W.-D.; Moore, D.D.; Huang, W. FXR: A metabolic regulator and cell protector. Cell Res. 2008, 18, 1087–1095. [Google Scholar] [CrossRef]
- Kliewer, S.A.; Mangelsdorf, D.J. Bile Acids as Hormones: The FXR-FGF15/19 Pathway. Dig. Dis. 2015, 33, 327–331. [Google Scholar] [CrossRef]
- Calkin, A.C.; Tontonoz, P. Transcriptional integration of metabolism by the nuclear sterol-activated receptors LXR and FXR. Nat. Rev. Mol. Cell Biol. 2012, 13, 213–224. [Google Scholar] [CrossRef]
- Chiang, J.Y.L. Bile Acid Metabolism and Signaling. Compr. Physiol. 2013, 3, 1191–1212. [Google Scholar] [CrossRef]
- Jia, W.; Rajani, C.; Zheng, X. Targeting the alternative bile acid synthetic pathway for metabolic diseases. Protein Cell 2021, 12, 411–425. [Google Scholar] [CrossRef]
- Chambers, K.F.; Day, P.E.; Aboufarrag, H.T.; Kroon, P.A. Polyphenol Effects on Cholesterol Metabolism via Bile Acid Biosynthesis, CYP7A1: A Review. Nutrients 2019, 11, 2588. [Google Scholar] [CrossRef]
- Lee, E.-A.; Lee, D.-I.; Kim, H.-Y.; Ahn, S.-H.; Seong, H.-R.; Jung, W.H.; Kim, K.Y.; Kim, S.; Rhee, S.D. Cyp7a1 is continuously increased with disrupted Fxr-mediated feedback inhibition in hypercholesterolemic TALLYHO/Jng mice. Biochim. Et Biophys. Acta-Mol. Cell Biol. Lipids 2018, 1863, 20–25. [Google Scholar] [CrossRef]
- Lee, M.-S.; Park, J.-Y.; Freake, H.; Kwun, I.-S.; Kim, Y. Green tea catechin enhances cholesterol 7alpha-hydroxylase gene expression in HepG2 cells. Br. J. Nutr. 2008, 99, 1182–1185. [Google Scholar] [CrossRef] [PubMed]
- Li, G.; Lin, W.; Araya, J.J.; Chen, T.; Timmermann, B.N.; Guo, G.L. A tea catechin, epigallocatechin-3-gallate, is a unique modulator of the farnesoid X receptor. Toxicol. Appl. Pharm. 2012, 258, 268–274. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Lin, Z.; Wang, L.; Guo, X.; Hao, Z.; Li, Z.; Johnston, L.J.; Dong, B. Cooperative Interaction of Phenolic Acids and Flavonoids Contained in Activated Charcoal with Herb Extracts, Involving Cholesterol, Bile Acid, and FXR/PXR Activation in Broilers Fed with Mycotoxin-Containing Diets. Antioxidants 2022, 11, 2200. [Google Scholar] [CrossRef] [PubMed]
- Hong, C.; Duit, S.; Jalonen, P.; Out, R.; Scheer, L.; Sorrentino, V.; Boyadjian, R.; Rodenburg, K.W.; Foley, E.; Korhonen, L.; et al. The E3 ubiquitin ligase IDOL induces the degradation of the low density lipoprotein receptor family members VLDLR and ApoER2. J. Biol. Chem. 2010, 285, 19720–19726. [Google Scholar] [CrossRef] [PubMed]
- Surdo, P.L.; Bottomley, M.J.; Calzetta, A.; Settembre, E.C.; Cirillo, A.; Pandit, S.; Ni, Y.G.; Hubbard, B.; Sitlani, A.; Carfí, A. Mechanistic implications for LDL receptor degradation from the PCSK9/LDLR structure at neutral pH. Embo. Rep. 2011, 12, 1300–1305. [Google Scholar] [CrossRef]
- Jacobo-Albavera, L.; Domínguez-Pérez, M.; Medina-Leyte, D.J.; González-Garrido, A.; Villarreal-Molina, T. The Role of the ATP-Binding Cassette A1 (ABCA1) in Human Disease. Int. J. Mol. Sci. 2021, 22, 1593. [Google Scholar] [CrossRef]
- Li, X.; Guo, J.; Liang, N.; Jiang, X.; Song, Y.; Ou, S.; Hu, Y.; Jiao, R.; Bai, W. 6-Gingerol Regulates Hepatic Cholesterol Metabolism by Up-regulation of LDLR and Cholesterol Efflux-Related Genes in HepG2 Cells. Front. Pharmacol. 2018, 9, 159. [Google Scholar] [CrossRef]
- Yeh, Y.-T.; Chiang, A.-N.; Hsieh, S.-C. Chinese Olive (Canarium album L.) Fruit Extract Attenuates Metabolic Dysfunction in Diabetic Rats. Nutrients 2017, 9, 1123. [Google Scholar] [CrossRef]
- Kuhn, D.J.; Burns, A.C.; Kazi, A.; Dou, Q.P. Direct inhibition of the ubiquitin-proteasome pathway by ester bond-containing green tea polyphenols is associated with increased expression of sterol regulatory element-binding protein 2 and LDL receptor. Biochim. Et Biophys. Acta 2004, 1682, 1–10. [Google Scholar] [CrossRef]
- Hui, C.K.; Majid, N.I.; Yusof, H.M.; Zainol, K.M.; Mohamad, H.; Zin, Z.M. Catechin profile and hypolipidemic activity of Morinda citrifolia leaf water extract. Heliyon 2020, 6, e04337. [Google Scholar] [CrossRef]
- Uto-Kondo, H.; Ayaori, M.; Ogura, M.; Nakaya, K.; Ito, M.; Suzuki, A.; Takiguchi, S.-I.; Yakushiji, E.; Terao, Y.; Ozasa, H.; et al. Coffee consumption enhances high-density lipoprotein-mediated cholesterol efflux in macrophages. Circ. Res. 2010, 106, 779–787. [Google Scholar] [CrossRef] [PubMed]
- Zhao, S.; Cheng, L.; Shi, Y.; Li, J.; Yun, Q.; Yang, H. MIEF2 reprograms lipid metabolism to drive progression of ovarian cancer through ROS/AKT/ mTOR signaling pathway. Cell Death Dis. 2021, 12, 18. [Google Scholar] [CrossRef]
- Osborne, T.F.; Espenshade, P.J. Evolutionary conservation and adaptation in the mechanism that regulates SREBP action: What a long, strange tRIP it’s been. Genes Dev. 2009, 23, 2578–2591. [Google Scholar] [CrossRef] [PubMed]
- Luo, K.; Ma, C.; Xing, S. White tea and its active polyphenols lower cholesterol through reduction of very-low-density lipoprotein production and induction of LDLR expression. Biomed Pharmacother. 2020, 127, 110146. [Google Scholar] [CrossRef]
- Leng, E.; Xiao, Y.; Mo, Z.; Li, Y.; Zhang, Y.; Deng, X.; Zhou, M.; Zhou, C.; He, Z.; He, J.; et al. Synergistic effect of phytochemicals on cholesterol metabolism and lipid accumulation in HepG2 cells. Bmc Complement. Altern. Med. 2018, 18, 122. [Google Scholar] [CrossRef] [PubMed]
- Yang, M.-Y.; Chan, K.-C.; Lee, Y.-J.; Chang, X.-Z.; Wu, C.-H.; Wang, C.-J. Sechium edule Shoot Extracts and Active Components Improve Obesity and a Fatty Liver That Involved Reducing Hepatic Lipogenesis and Adipogenesis in High-Fat-Diet-Fed Rats. J. Agric. Food Chem. 2015, 63, 4587–4596. [Google Scholar] [CrossRef]
- Bhattacharya, R.; Chatterjee, R.; Mandal, A.K.A.; Mukhopadhyay, A.; Basu, S.; Giri, A.K.; Chatterji, U.; Bhattacharjee, P. Theaflavin-Containing Black Tea Extract: A Potential DNA Methyltransferase Inhibitor in Human Colon Cancer Cells and Ehrlich Ascites Carcinoma-Induced Solid Tumors in Mice. Nutr. Cancer 2021, 73, 2447–2459. [Google Scholar] [CrossRef]
- Dev, K.; Singh, S.B.; Porter, T.D. Green and black tea extracts inhibit HMG-CoA reductase and activate AMP kinase to decrease cholesterol synthesis in hepatoma cells. J. Ofnutritional Biochem. 2009, 20, 816–822. [Google Scholar] [CrossRef]
- Gong, L.; Wang, C.; Zhou, H.; Ma, C.; Zhang, Y.; Peng, C.; Li, Y. A review of pharmacological and pharmacokinetic properties of Forsythiaside A. Pharm. Res. 2021, 169, 105690. [Google Scholar] [CrossRef]
Gene | Foward (5′-3′) | Reverse (5′-3′) |
---|---|---|
GAPDH | TGCACCCACCAACTGCTTAGC | GGCATGGACTGTGGTCATGAG |
FXR | ACAGAACAAGTGGCAGGTC | CTGAAGAAACCTTTACACCCCTC |
FGF19 | CTGGAGATCAAGGCAGTCGC | TGCTTCTCGGATCGGTACAC |
CYP7A1 | GCTTGAGGCACGAGAACCT | GAAAGTCGCTGGAATGGTGT |
CYP8B1 | CCCTCTCCTTTGGCTCCATCCTC | GCTTGGTGCTGGCTGAGTGTATC |
CYP27A1 | ACTGCACCAGTTACAGGTGCTTTACA | CCATGTCGTTCCGTACTGGGTACT |
CYP7B1 | CAGCAGTGCGTGACGAAATTGAC | TGTTCTCTGGTGAGGTGGATGGG |
SREBP2 | CTCACCTTCCTGTGCCTCTC | AGGCATCATCCAGTCAAACC |
HMGCR | TCGCCGACAGTTACTTTCCAAGAAG | TCACAACAAGCTCCCATCACCAAG |
LDLR | AGTTGGCTGCGTTAATGTGACA | TCTCTAGCCATGTTGCAGACTTTG |
ABCA1 | GACATCGTGGCGTTTTTGG | CGAGATATGGTCCGGATTGC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhong, S.; Li, J.; Wei, M.; Deng, Z.; Liu, X. Fresh and Browned Lotus Root Extracts Promote Cholesterol Metabolism in FFA-Induced HepG2 Cells through Different Pathways. Foods 2023, 12, 1781. https://doi.org/10.3390/foods12091781
Zhong S, Li J, Wei M, Deng Z, Liu X. Fresh and Browned Lotus Root Extracts Promote Cholesterol Metabolism in FFA-Induced HepG2 Cells through Different Pathways. Foods. 2023; 12(9):1781. https://doi.org/10.3390/foods12091781
Chicago/Turabian StyleZhong, Shuyuan, Jingfang Li, Meng Wei, Zeyuan Deng, and Xiaoru Liu. 2023. "Fresh and Browned Lotus Root Extracts Promote Cholesterol Metabolism in FFA-Induced HepG2 Cells through Different Pathways" Foods 12, no. 9: 1781. https://doi.org/10.3390/foods12091781
APA StyleZhong, S., Li, J., Wei, M., Deng, Z., & Liu, X. (2023). Fresh and Browned Lotus Root Extracts Promote Cholesterol Metabolism in FFA-Induced HepG2 Cells through Different Pathways. Foods, 12(9), 1781. https://doi.org/10.3390/foods12091781