The Effect and Mechanism of Corilagin from Euryale Ferox Salisb Shell on LPS-Induced Inflammation in Raw264.7 Cells
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials and Chemicals
2.2. Separation and Identification of Corilagin from Euryale ferox Salisb Shell
2.3. Corilagin and Inflammation Target Prediction and Screening Application
2.4. Construction of PPI Network and Acquisition of Crossover Genes
2.5. HUB Genes’ Acquisition and KEGG and GO Enrichment Analysis
2.6. Docking Analysis
2.7. Cell Culture and Model Establishment
2.8. Cell Morphology Observation and CCK-8 Assay to Detect the Proliferation Toxicity of Corilagin on Raw264.7 Cells
2.9. Determination of NO Content by Griess Method
2.10. ELISA Method to Determine the Effect of Corilagin on the Secretion of Inflammatory Factors
2.11. Detection of Intracellular Reactive Oxygen Species by Flow Cytometry
2.12. qRT-PCR Detection of TNF-α, IL-6, COX-2, and iNOS Gene Expression Levels
2.13. Western Blot Analysis of Key Proteins’ Expression in NF-κB, MAPK, and PI3K-AKT Signaling Pathways
2.14. Data Statistics and Analysis
3. Results
3.1. Acquisition of Corilagin and Inflammatory Targets and the “Corilagin-Target-Inflammation” Interaction Network
3.2. Construction of PPI Network and Acquisition of HUB Genes
3.3. GO and KEGG Pathway Analysis
3.4. Validation of Molecular Docking
3.5. The Effect of Corilagin on the Viability of Raw264.7 Cells and Changes in Cellular Morphology
3.6. Effects of Corilagin on LPS-Induced NO Secretion by Raw264.7 Macrophages
3.7. The Effect of Corilagin on the Expression of Inflammatory Factors in LPS-Induced Raw264.7 Macrophages
3.8. The Effect of Corilagin on the Content of Reactive Oxygen Species in Raw264.7 Cells
3.9. Effects of Corilagin on the Gene Expression of TNF-α, IL-6, iNOS, and COX-2 in LPS-Induced Raw264.7 Macrophages
3.10. The Effect of Corilagin on the Expression of Key Proteins in the NF-κB Signaling Pathway in Raw264.7 Cells
3.11. The Effect of Corilagin on the Expression of Key Proteins in the MAPK Signaling Pathway in Raw264.7 Cells
3.12. The Effect of Corilagin on the Expression of Key Proteins in the PI3K-AKT Signaling Pathway in Raw264.7 Cells
4. Discussion
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Raza, A.; Crothers, J.W.; McGill, M.M.; Mawe, G.M.; Teuscher, C.; Krementsov, D.N. Anti-inflammatory roles of p38alpha MAPK in macrophages are context dependent and require IL-10. J. Leukoc. Biol. 2017, 102, 1219–1227. [Google Scholar] [CrossRef]
- Yang, H.; Liu, C.; Wu, Y.; Yuan, M.; Huang, J.; Xia, Y.; Ling, Q.; Hoffmann, P.R.; Huang, Z.; Chen, T. Atherosclerotic plaque-targeted nanotherapeutics ameliorates atherogenesis by blocking macrophage-driven inflammation. Nano Today 2022, 42, 101351. [Google Scholar] [CrossRef]
- Inoue, M.; Sakamoto, K.; Suzuki, A.; Nakai, S.; Ando, A.; Shiraki, Y.; Nakahara, Y.; Omura, M.; Enomoto, A.; Nakase, I.; et al. Size and surface modification of silica nanoparticles affect the severity of lung toxicity by modulating endosomal ROS generation in macrophages. Part. Fibre Toxicol. 2021, 18, 21. [Google Scholar] [CrossRef] [PubMed]
- Ley, K. Inflammation and Atherosclerosis. Cells 2021, 10, 1197. [Google Scholar] [CrossRef] [PubMed]
- Liberale, L.; Badimon, L.; Montecucco, F.; Lüscher, T.F.; Libby, P.; Camici, G.G. Inflammation, Aging, and Cardiovascular Disease: JACC Review Topic of the Week. J. Am. Coll. Cardiol. 2022, 79, 837–847. [Google Scholar] [CrossRef]
- Yuan, H.; Gong, Z.; Meng, S.; He, G. Hypoglycemic and hypolipidemic effects of a triterpenoid-rich extract from Euryale shell on streptozotocin-induced diabetic mice. Die Pharmazie 2013, 68, 227–231. [Google Scholar] [PubMed]
- Zhang, W.; Su, R.-N.; Gong, L.-L.; Yang, W.-W.; Chen, J.; Yang, R.; Wang, Y.; Pan, W.-J.; Lu, Y.-M.; Chen, Y. Structural characterization and in vitro hypoglycemic activity of a glucan from Euryale ferox Salisb. seeds. Carbohydr. Polym. 2019, 209, 363–371. [Google Scholar] [CrossRef]
- Wu, P.; Liu, A.; Li, L. Metabolomics and transcriptome analysis of the biosynthesis mechanism of flavonoids in the seeds of Euryale ferox Salisb at different developmental stages. Mol. Genet. Genom. 2021, 296, 953–970. [Google Scholar] [CrossRef]
- Liu, X.; He, Z.; Yin, Y.; Xu, X.; Wu, W.; Li, L. Transcriptome sequencing and analysis during seed growth and development in Euryale ferox Salisb. BMC Genom. 2018, 19, 343. [Google Scholar] [CrossRef]
- Yang, L.; Yin, P.; Fan, H.; Xue, Q.; Li, K.; Li, X.; Sun, L.; Liu, Y. Response Surface Methodology Optimization of Ultrasonic-Assisted Extraction of Acer Truncatum Leaves for Maximal Phenolic Yield and Antioxidant Activity. Molecules 2017, 22, 232. [Google Scholar] [CrossRef] [PubMed]
- Wu, C.Y.; Chen, R.; Wang, X.S.; Shen, B.; Yue, W.; Wu, Q. Antioxidant and Anti-Fatigue Activities of Phenolic Extract from the Seed Coat of Euryale ferox Salisb. and Identification of Three Phenolic Compounds by LC-ESI-MS/MS. Molecules 2013, 18, 11003–11021. [Google Scholar] [CrossRef]
- Zhao, L.; Zhang, S.-L.; Tao, J.-Y.; Pang, R.; Jin, F.; Guo, Y.-J.; Dong, J.-H.; Ye, P.; Zhao, H.-Y.; Zheng, G.-H. Preliminary exploration on anti-inflammatory mechanism of Corilagin (beta-1-O-galloyl-3,6-(R)-hexahydroxydiphenoyl-D-glucose) in vitro. Int. Immunopharmacol. 2008, 8, 1059–1064. [Google Scholar] [CrossRef]
- Yeo, S.G.; Song, J.H.; Hong, E.-H.; Lee, B.-R.; Kwon, Y.S.; Chang, S.-Y.; Kim, S.H.; Lee, S.W.; Park, J.-H.; Ko, H.-J. Antiviral effects of Phyllanthus urinaria containing corilagin against human enterovirus 71 and Coxsackievirus A16 in vitro. Arch. Pharmacal Res. 2015, 38, 193–202. [Google Scholar] [CrossRef]
- Reddy, B.U.; Mullick, R.; Kumar, A.; Sharma, G.; Bag, P.; Roy, C.L.; Sudha, G.; Tandon, H.; Dave, P.; Shukla, A.; et al. A natural small molecule inhibitor corilagin blocks HCV replication and modulates oxidative stress to reduce liver damage. Antivir. Res. 2018, 150, 47–59. [Google Scholar] [CrossRef] [PubMed]
- Jia, L.; Jin, H.; Zhou, J.; Chen, L.; Lu, Y.; Ming, Y.; Yu, Y. A potential anti-tumor herbal medicine, Corilagin, inhibits ovarian cancer cell growth through blocking the TGF-beta signaling pathways. BMC Complement Altern. Med. 2013, 13, 33. [Google Scholar] [CrossRef] [PubMed]
- Li, H.R.; Liu, J.; Zhang, S.-L.; Luo, T.; Wu, F.; Dong, J.-H.; Guo, Y.-J.; Zhao, L. Corilagin ameliorates the extreme inflammatory status in sepsis through TLR4 signaling pathways. BMC Complement Altern. Med. 2017, 17, 18. [Google Scholar] [CrossRef] [PubMed]
- Tong, F.; Zhang, J.; Liu, L.; Gao, X.; Cai, Q.; Wei, C.; Dong, J.; Hu, Y.; Wu, G.; Dong, X. Corilagin Attenuates Radiation-Induced Brain Injury in Mice. Mol. Neurobiol. 2016, 53, 6982–6996. [Google Scholar] [CrossRef] [PubMed]
- Asiimwe, N.; Yeo, S.G.; Kim, M.-S.; Jung, J.; Jeong, N.Y. Nitric Oxide: Exploring the Contextual Link with Alzheimer’s Disease. Oxidative Med. Cell. Longev. 2016, 2016, 7205747. [Google Scholar] [CrossRef]
- Kong, L.B.; Smith, W.; Hao, D. Overview of Raw264.7 for osteoclastogensis study: Phenotype and stimuli. J. Cell. Mol. Med. 2019, 23, 3077–3087. [Google Scholar] [CrossRef] [PubMed]
- Predonzani, A. Spotlights on immunological effects of reactive nitrogen species: When inflammation says nitric oxide. World J. Exp. Med. 2015, 5, 64–76. [Google Scholar] [CrossRef] [PubMed]
- Murakami, A.; Ohigashi, H. Targeting NOX, INOS and COX-2 in inflammatory cells: Chemoprevention using food phytochemicals. Int. J. Cancer 2007, 121, 2357–2363. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Deng, Y.; Zheng, Z.; Huang, W.; Chen, L.; Tong, Q.; Ming, Y. Corilagin, a promising medicinal herbal agent. Biomed. Pharmacother. 2018, 99, 43–50. [Google Scholar] [CrossRef]
- Paul, A.; Dutta, A.; Kundu, A.; Singh, S.B.; Banerjee, K.; Saha, S. Response surface methodology driven ultrasonic-assisted extraction of ellagitannins from pomegranate rind: Optimization of parameters and in silico molecular interaction with catalase. Biomass Convers. Biorefinery 2022. [Google Scholar] [CrossRef]
- Yang, L.J.; Chen, R.H.; Hamdoun, S.; Coghi, P.; Ng, J.P.; Zhang, D.W.; Guo, X.; Xia, C.; Law, B.Y.; Wong, V.K. Corilagin prevents SARS-CoV-2 infection by targeting RBD-ACE2 binding. Phytomedicine 2021, 87, 153591. [Google Scholar] [CrossRef] [PubMed]
- Puljula, E.; Walton, G.; Woodward, M.J.; Karonen, M. Antimicrobial Activities of Ellagitannins against Clostridiales perfringens, Escherichia coli, Lactobacillus plantarum and Staphylococcus aureus. Molecules 2020, 25, 3714. [Google Scholar] [CrossRef]
- Tao, Y.; Zhang, L.; Yang, R.; Yang, Y.; Jin, H.; Zhang, X.; Hu, Q.; He, B.; Shen, Z.; Chen, P. Corilagin ameliorates atherosclerosis by regulating MMP-1, -2, and -9 expression in vitro and in vivo. Eur. J. Pharmacol. 2021, 906, 174200. [Google Scholar] [CrossRef]
- de Anda-Jauregui, G.; Guo, K.; McGregor, B.A.; Hur, J. Exploration of the Anti-Inflammatory Drug Space Through Network Pharmacology: Applications for Drug Repurposing. Front. Physiol. 2018, 9, 151. [Google Scholar] [CrossRef] [PubMed]
- Peritore, A.F.; Impellizzeri, D.; Gugliandolo, E.; Siracusa, R.; Fusco, R.; D’Amico, R.; Cordaro, M.; Crupi, R.; Cuzzucrea, S.; Di Paola, R. Comicronized PEA and Rutin reduces inflammation and oxidative stress in a mouse model of vascular injury. FASEB J. 2020, 34, 1. [Google Scholar] [CrossRef]
- Vasicek, O.; Lojek, A.; Ciz, M. Serotonin and its metabolites reduce oxidative stress in murine Raw264.7 macrophages and prevent inflammation. J. Physiol. Biochem. 2020, 76, 49–60. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Zong, Z.; Zhang, W.; Chen, Y.; Wang, X.; Shen, J.; Yang, C.; Liu, X.; Deng, H. Nicotinamide Mononucleotide Alleviates LPS-Induced Inflammation and Oxidative Stress via Decreasing COX-2 Expression in Macrophages. Front. Mol. Biosci. 2021, 8, 702107. [Google Scholar] [CrossRef]
- Guan, C.; Xiao, Y.; Li, K.; Wang, T.; Liang, Y.; Liao, G. MMP-12 regulates proliferation of mouse macrophages via the ERK/P38 MAPK pathways during inflammation. Exp. Cell Res. 2019, 378, 182–190. [Google Scholar] [CrossRef] [PubMed]
- Zhong, J.; Wang, F.; Wang, Z.; Shen, C.; Zheng, Y.; Ma, F.; Zhu, T.; Chen, L.; Tang, Q.; Zhu, J. Aloin attenuates cognitive impairment and inflammation induced by d-galactose via down-regulating ERK, p38 and NF-κB signaling pathway. Int. Immunopharmacol. 2019, 72, 48–54. [Google Scholar] [CrossRef] [PubMed]
- Fang, L.; Wang, K.-K.; Huang, Q.; Cheng, F.; Huang, F.; Liu, W.-W. Nucleolin Mediates LPS-induced Expression of Inflammatory Mediators and Activation of Signaling Pathways. Curr. Med. Sci. 2020, 40, 646–653. [Google Scholar] [CrossRef] [PubMed]
- Yuan, Z.; Matias, F.B.; Wu, J.; Liang, Z.; Sun, Z. Koumine Attenuates Lipopolysaccaride-Stimulated Inflammation in Raw264.7 Macrophages, Coincidentally Associated with Inhibition of NF-kappaB, ERK and p38 Pathways. Int. J. Mol. Sci. 2016, 17, 430. [Google Scholar] [CrossRef]














| Gene Name | Forward Primer (5→3) | Reverse Primer (3→5) |
|---|---|---|
| β-actin | CTACCTCATGAAGATCCTGACC | CACAGCTTCTCTTTGATGTCAC |
| TNF-α | ATGTCTCAGCCTCTTCTCATTC | GCTTGTCACTCGAATTTTGAGA |
| IL-6 | CTCCCAACAGACCTGTCTATAC | CCATTGCACAACTCTTTTCTCA |
| COX-2 | ATTCCAAACCAGCAGACTCATA | ATTCCAAACCAGCAGACTCATA |
| iNOS | CGGACGAGACGGATAGGCAGAG | GGAAGGCAGCGGGCACATG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wu, M.; Jiang, Y.; Wang, J.; Luo, T.; Yi, Y.; Wang, H.; Wang, L. The Effect and Mechanism of Corilagin from Euryale Ferox Salisb Shell on LPS-Induced Inflammation in Raw264.7 Cells. Foods 2023, 12, 979. https://doi.org/10.3390/foods12050979
Wu M, Jiang Y, Wang J, Luo T, Yi Y, Wang H, Wang L. The Effect and Mechanism of Corilagin from Euryale Ferox Salisb Shell on LPS-Induced Inflammation in Raw264.7 Cells. Foods. 2023; 12(5):979. https://doi.org/10.3390/foods12050979
Chicago/Turabian StyleWu, Minrui, Yuhan Jiang, Junnan Wang, Ting Luo, Yang Yi, Hongxun Wang, and Limei Wang. 2023. "The Effect and Mechanism of Corilagin from Euryale Ferox Salisb Shell on LPS-Induced Inflammation in Raw264.7 Cells" Foods 12, no. 5: 979. https://doi.org/10.3390/foods12050979
APA StyleWu, M., Jiang, Y., Wang, J., Luo, T., Yi, Y., Wang, H., & Wang, L. (2023). The Effect and Mechanism of Corilagin from Euryale Ferox Salisb Shell on LPS-Induced Inflammation in Raw264.7 Cells. Foods, 12(5), 979. https://doi.org/10.3390/foods12050979

