Cytotoxic and Apoptotic Effect of Rubus chingii Leaf Extract against Non-Small Cell Lung Carcinoma A549 Cells
Abstract
:1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Plant Material
2.3. Preparation of Ethanolic Leaf Extract
2.4. In Vitro Anti-Cancer Efficacy of RcL-EtOH
2.4.1. Cell Lines
2.4.2. Cytotoxicity Assay
2.5. Assessment of Reactive Oxygen Species (ROS)
2.6. Estimation of Mitochondrial Membrane Potential (ΔΨm)
2.7. Cytochrome-c Release Assay
2.8. Apoptosis Assay
2.9. Assessment of Caspase-3, Caspase-9
2.10. Quantitative RT-PCR
2.11. Statistical Evaluation
3. Results
3.1. RcL-EtOH Exerted Cytotoxic Effects against A549 Cells
3.2. RcL-EtOH-Induced Apoptosis in A549 Cells
3.3. RcL-EtOH Exposure Dissipated ΔΨm and Instigate Mitochondrial Cytochrome-c Release
3.4. Activities of Caspase-3 and Caspase-9 Increased after RcL-EtOH Exposure
3.5. RcL-EtOH Instigated Intracellular ROS
3.6. RcL-EtOH Modulated Expression of Apoptotic and Cell Cycle-Related Genes
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- World Health Organization Factsheet on Cancer. Available online: https://www.who.int/news-room/fact-sheets/detail/cancer (accessed on 15 April 2022).
- Global Cancer Observatory Fact Sheet on Lung Cancer. Available online: https://gco.iarc.fr/today/data/factsheets/cancers/15-Lung-fact-sheet.pdf (accessed on 15 April 2022).
- Molina, J.R.; Yang, P.; Cassivi, S.D.; Schild, S.E.; Adjei, A.A. Non-small cell lung cancer: Epidemiology, risk factors, treatment, and survivorship. Mayo Clin. Proc. 2008, 83, 584–594. [Google Scholar] [CrossRef]
- Zappa, C.; Mousa, S.A. Non-small cell lung cancer: Current treatment and future advances. Transl. Lung Cancer Res. 2016, 5, 288–300. [Google Scholar] [CrossRef] [Green Version]
- Zhang, M.; Li, M.; Du, L.; Zeng, J.; Yao, T.; Jin, Y. Paclitaxel-in-liposome-in-bacteria for inhalation treatment of primary lung cancer. Int. J. Pharm. 2020, 578, 119177. [Google Scholar] [CrossRef]
- Lynch, T.J., Jr.; Kass, F.; Kalish, L.A.; Elias, A.D.; Strauss, G.; Shulman, L.N.; Sugarbaker, D.J.; Skarin, A.; Frei, E., 3rd. Cisplatin, 5-fluorouracil, and etoposide for advanced non-small cell lung cancer. Cancer 1993, 71, 2953–2957. [Google Scholar] [CrossRef]
- Li, N.; Mai, Y.; Liu, Q.; Gou, G.; Yang, J. Docetaxel-loaded D-α-tocopheryl polyethylene glycol-1000 succinate liposomes improve lung cancer chemotherapy and reverse multidrug resistance. Drug Deliv. Transl. Res. 2021, 11, 131–141. [Google Scholar] [CrossRef] [PubMed]
- Atanasov, A.G.; Waltenberger, B.; Pferschy-Wenzig, E.-M.; Linder, T.; Wawrosch, C.; Uhrin, P.; Temml, V.; Wang, L.; Schwaiger, S.; Heiss, E.H.; et al. Discovery and resupply of pharmacologically active plant-derived natural products: A review. Biotechnol. Adv. 2015, 33, 1582–1614. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vaou, N.; Stavropoulou, E.; Voidarou, C.; Tsigalou, C.; Bezirtzoglou, E. Towards Advances in Medicinal Plant Antimicrobial Activity: A Review Study on Challenges and Future Perspectives. Microorganisms 2021, 9, 2041. [Google Scholar] [CrossRef]
- Wang, H.; Khor, T.O.; Shu, L.; Su, Z.-Y.; Fuentes, F.; Lee, J.-H.; Kong, A.-N.T. Plants vs. cancer: A review on natural phytochemicals in preventing and treating cancers and their druggability. Anticancer Agents Med. Chem. 2012, 12, 1281–1305. [Google Scholar] [CrossRef]
- Yu, G.; Luo, Z.; Wang, W.; Li, Y.; Zhou, Y.; Shi, Y. Rubus chingii Hu: A Review of the Phytochemistry and Pharmacology. Front. Pharmacol. 2019, 10, 799. [Google Scholar] [CrossRef]
- Ding, H.-Y. Extracts and Constituents of Rubus chingii with 1,1-Diphenyl-2-picrylhydrazyl (DPPH) Free Radical Scavenging Activity. Int. J. Mol. Sci. 2011, 12, 3941–3949. [Google Scholar] [CrossRef]
- Li, K.; Zeng, M.; Li, Q.; Zhou, B. Identification of polyphenolic composition in the fruits of Rubus chingii Hu and its antioxidant and antiproliferative activity on human bladder cancer T24 cells. J. Food Meas. Charact. 2019, 13, 51–60. [Google Scholar] [CrossRef]
- Zhang, T.T.; Lu, C.L.; Jiang, J.G.; Wang, M.; Wang, D.M.; Zhu, W. Bioactivities and extraction optimization of crude polysaccharides from the fruits and leaves of Rubus chingii Hu. Carbohydr. Polym. 2015, 130, 307–315. [Google Scholar] [CrossRef] [PubMed]
- Zhang, T.T.; Yang, L.; Jiang, J.G. Bioactive comparison of main components from unripe fruits of Rubus chingii Hu and identification of the effective component. Food Funct. 2015, 6, 2205–2214. [Google Scholar] [CrossRef]
- Zhang, T.-T.; Liu, Y.-J.; Yang, L.; Jiang, J.-G.; Zhao, J.-W.; Zhu, W. Extraction of antioxidant and antiproliferative ingredients from fruits of Rubus chingii Hu by active tracking guidance. MedChemComm 2017, 8, 1673–1680. [Google Scholar] [CrossRef]
- Al Saqr, A.; Khafagy, E.S.; Aldawsari, M.F.; Almansour, K.; Abu Lila, A.S. Screening of Apoptosis Pathway-Mediated Anti-Proliferative Activity of the Phytochemical Compound Furanodienone against Human Non-Small Lung Cancer A-549 Cells. Life 2022, 12, 114. [Google Scholar] [CrossRef] [PubMed]
- Rastogi, R.P.; Singh, S.P.; Häder, D.P.; Sinha, R.P. Detection of reactive oxygen species (ROS) by the oxidant-sensing probe 2',7'-dichlorodihydrofluorescein diacetate in the cyanobacterium Anabaena variabilis PCC 7937. Biochem. Biophys. Res. Commun. 2010, 397, 603–607. [Google Scholar] [CrossRef] [PubMed]
- Mishra, T.; Arya, R.K.; Meena, S.; Joshi, P.; Pal, M.; Meena, B.; Upreti, D.K.; Rana, T.S.; Datta, D. Isolation, Characterization and Anticancer Potential of Cytotoxic Triterpenes from Betula utilis Bark. PLoS ONE 2016, 11, e0159430. [Google Scholar] [CrossRef] [PubMed]
- Ahmad, A.; Tiwari, R.K.; Almeleebia, T.M.; Al Fayi, M.S.; Alshahrani, M.Y.; Ahmad, I.; Abohassan, M.S.; Saeed, M.; Ansari, I.A. Swertia chirayita suppresses the growth of non-small cell lung cancer A549 cells and concomitantly induces apoptosis via downregulation of JAK1/STAT3 pathway. Saudi J. Biol. Sci. 2021, 28, 6279–6288. [Google Scholar] [CrossRef]
- Liu, K.; Liu, P.C.; Liu, R.; Wu, X. Dual AO/EB staining to detect apoptosis in osteosarcoma cells compared with flow cytometry. Med. Sci. Monit. Basic Res. 2015, 21, 15. [Google Scholar] [CrossRef] [Green Version]
- Zorova, L.D.; Popkov, V.A.; Plotnikov, E.Y.; Silachev, D.N.; Pevzner, I.B.; Jankauskas, S.S.; Babenko, V.A.; Zorov, S.D.; Balakireva, A.V.; Juhaszova, M.; et al. Mitochondrial membrane potential. Anal. Biochem. 2018, 552, 50–59. [Google Scholar] [CrossRef]
- Castera, L.; Hatzfeld-Charbonnier, A.S.; Ballot, C.; Charbonnel, F.; Dhuiege, E.; Velu, T.; Formstecher, P.; Mortier, L.; Marchetti, P. Apoptosis-related mitochondrial dysfunction defines human monocyte-derived dendritic cells with impaired immuno-stimulatory capacities. J. Cell. Mol. Med. 2009, 13, 1321–1335. [Google Scholar] [CrossRef] [PubMed]
- Borutaite, V.; Budriunaite, A.; Morkuniene, R.; Brown, G.C. Release of mitochondrial cytochrome c and activation of cytosolic caspases induced by myocardial ischaemia. Biochim. Et Biophys. Acta (BBA)—Mol. Basis Dis. 2001, 1537, 101–109. [Google Scholar] [CrossRef] [Green Version]
- Elena-Real, C.A.; Díaz-Quintana, A.; González-Arzola, K.; Velázquez-Campoy, A.; Orzáez, M.; López-Rivas, A.; Gil-Caballero, S.; De la Rosa, M.Á.; Díaz-Moreno, I. Cytochrome c speeds up caspase cascade activation by blocking 14-3-3ε-dependent Apaf-1 inhibition. Cell Death Dis. 2018, 9, 365. [Google Scholar] [CrossRef] [PubMed]
- Logue, S.E.; Martin, S.J. Caspase activation cascades in apoptosis. Biochem. Soc. Trans. 2008, 36, 1–9. [Google Scholar] [CrossRef]
- Aggarwal, V.; Tuli, H.S.; Varol, A.; Thakral, F.; Yerer, M.B.; Sak, K.; Varol, M.; Jain, A.; Khan, M.A.; Sethi, G. Role of Reactive Oxygen Species in Cancer Progression: Molecular Mechanisms and Recent Advancements. Biomolecules 2019, 9, 735. [Google Scholar] [CrossRef] [Green Version]
- Pistritto, G.; Trisciuoglio, D.; Ceci, C.; Garufi, A.; D’Orazi, G. Apoptosis as anticancer mechanism: Function and dysfunction of its modulators and targeted therapeutic strategies. Aging (Albany NY) 2016, 8, 603–619. [Google Scholar] [CrossRef] [Green Version]
- Tsukano, H.; Gotoh, T.; Endo, M.; Miyata, K.; Tazume, H.; Kadomatsu, T.; Yano, M.; Iwawaki, T.; Kohno, K.; Araki, K.; et al. The Endoplasmic Reticulum Stress-C/EBP Homologous Protein Pathway-Mediated Apoptosis in Macrophages Contributes to the Instability of Atherosclerotic Plaques. Arterioscler. Thromb. Vasc. Biol. 2010, 30, 1925–1932. [Google Scholar] [CrossRef] [Green Version]
- Hu, H.; Tian, M.; Ding, C.; Yu, S. The C/EBP Homologous Protein (CHOP) Transcription Factor Functions in Endoplasmic Reticulum Stress-Induced Apoptosis and Microbial Infection. Front. Immunol. 2019, 9, 3083. [Google Scholar] [CrossRef] [Green Version]
- Hai, Q.; Smith, J.D. Acyl-Coenzyme A: Cholesterol Acyltransferase (ACAT) in Cholesterol Metabolism: From Its Discovery to Clinical Trials and the Genomics Era. Metabolites 2021, 11, 543. [Google Scholar] [CrossRef]
- Nikoletopoulou, V.; Markaki, M.; Palikaras, K.; Tavernarakis, N. Crosstalk between apoptosis, necrosis and autophagy. Biochim Biophys Acta 2013, 1833, 3448–3459. [Google Scholar] [CrossRef] [Green Version]
- Elmore, S. Apoptosis: A review of programmed cell death. Toxicol. Pathol. 2007, 35, 495–516. [Google Scholar] [CrossRef] [PubMed]
- Gharbaran, R.; Shi, C.; Onwumere, O.; Redenti, S. Plumbagin Induces Cytotoxicity via Loss of Mitochondrial Membrane Potential and Caspase Activation in Metastatic Retinoblastoma. Anticancer Res. 2021, 41, 4725–4732. [Google Scholar] [CrossRef] [PubMed]
- Khan, A.Q.; Rashid, K.; AlAmodi, A.A.; Agha, M.V.; Akhtar, S.; Hakeem, I.; Raza, S.S.; Uddin, S. Reactive oxygen species (ROS) in cancer pathogenesis and therapy: An update on the role of ROS in anticancer action of benzophenanthridine alkaloids. Biomed. Pharmacother. 2021, 143, 112142. [Google Scholar] [CrossRef]
- Marchi, S.; Giorgi, C.; Suski, J.M.; Agnoletto, C.; Bononi, A.; Bonora, M.; De Marchi, E.; Missiroli, S.; Patergnani, S.; Poletti, F.; et al. Mitochondria-Ros Crosstalk in the Control of Cell Death and Aging. J. Signal Transduct. 2012, 2012, 329635. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zorov, D.B.; Juhaszova, M.; Sollott, S.J. Mitochondrial reactive oxygen species (ROS) and ROS-induced ROS release. Physiol. Rev. 2014, 94, 909–950. [Google Scholar] [CrossRef] [Green Version]
- Pedre, B.; Barayeu, U.; Ezeriņa, D.; Dick, T.P. The mechanism of action of N-acetylcysteine (NAC): The emerging role of H2S and sulfane sulfur species. Pharmacol. Ther. 2021, 228, 107916. [Google Scholar] [CrossRef]
- Lin, X.M.; Liu, S.B.; Luo, Y.H.; Xu, W.T.; Zhang, Y.; Zhang, T.; Xue, H.; Zuo, W.B.; Li, Y.N.; Lu, B.X.; et al. 10-HDA Induces ROS-Mediated Apoptosis in A549 Human Lung Cancer Cells by Regulating the MAPK, STAT3, NF-κB, and TGF-β1 Signaling Pathways. Biomed Res. Int. 2020, 2020, 3042636. [Google Scholar] [CrossRef]
- Zhang, G.Y.; Chen, W.Y.; Li, X.B.; Ke, H.; Zhou, X.L. Scutellarin-induced A549 cell apoptosis depends on activation of the transforming growth factor-β1/smad2/ROS/caspase-3 pathway. Open Life Sci. 2021, 16, 961–968. [Google Scholar] [CrossRef]
- Al Saqr, A.; Wani, S.U.D.; Gangadharappa, H.V.; Aldawsari, M.F.; Khafagy, E.-S.; Lila, A.S.A. Enhanced Cytotoxic Activity of Docetaxel-Loaded Silk Fibroin Nanoparticles against Breast Cancer Cells. Polymers 2021, 13, 1416. [Google Scholar] [CrossRef]
- Ding, L.; Cao, J.; Lin, W.; Chen, H.; Xiong, X.; Ao, H.; Yu, M.; Lin, J.; Cui, Q. The Roles of Cyclin-Dependent Kinases in Cell-Cycle Progression and Therapeutic Strategies in Human Breast Cancer. Int. J. Mol. Sci. 2020, 21, 1960. [Google Scholar] [CrossRef] [Green Version]
Gene | Sequence | |
---|---|---|
Forward | Reverse | |
GAPDH | CGACCACTTTGTCAAGCTCA | CCCCTCTTCAAGGGGTCTAC |
Bax | GCTGGACATTGGACTTCCTC | CTCAGCCCATCTTCTTCCAG |
Bad | CCTCAGGCCTATGCAAAAAG | AAACCCAAAACTTCCGATGG |
Bcl-2 | ATTGGGAAGTTTCAAATCAGC | TGCATTCTTGGACGAGGG |
CDK4 | CCTGGCCAGAATCTACAGCTA | ACATCTCGAGGCCAGTCATC |
p21Cip1 | TGTCCGTCAGAACCCATG | GTGGGAAGGTAGAGCTTGG |
CyclinD1 | CTTCCTCTCCAAAATGCCAG | AGAGATGGAAGGGGGAAAGA |
BclXL | CAGAGCTTTGAACAGGTAG | GCTCTCGGGTGCTGTATTG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Khafagy, E.-S.; Al Saqr, A.; Alotaibi, H.F.; Abu Lila, A.S. Cytotoxic and Apoptotic Effect of Rubus chingii Leaf Extract against Non-Small Cell Lung Carcinoma A549 Cells. Processes 2022, 10, 1537. https://doi.org/10.3390/pr10081537
Khafagy E-S, Al Saqr A, Alotaibi HF, Abu Lila AS. Cytotoxic and Apoptotic Effect of Rubus chingii Leaf Extract against Non-Small Cell Lung Carcinoma A549 Cells. Processes. 2022; 10(8):1537. https://doi.org/10.3390/pr10081537
Chicago/Turabian StyleKhafagy, El-Sayed, Ahmed Al Saqr, Hadil Faris Alotaibi, and Amr Selim Abu Lila. 2022. "Cytotoxic and Apoptotic Effect of Rubus chingii Leaf Extract against Non-Small Cell Lung Carcinoma A549 Cells" Processes 10, no. 8: 1537. https://doi.org/10.3390/pr10081537