Optimization of L-Citrulline Operon in Corynebacterium glutamicum for L-Citrulline Production

Abstract

L-citrulline plays important roles in many physiological processes, and its application range is expanding rapidly. Corynebacterium glutamicum strains have the potential to be efficient L-citrulline producers. In this study, we performed optimization of L-citrulline biosynthesis operon in C. glutamicum ATCC13032 for L-citrulline production. Chromosomal integration of the integral argB_Ec gene from Escherichia coli (encoding natively insensitive N-acetylglutamate kinase), the deletion of the argR gene (encoding repressor ArgR), and the deletion of the argG gene (encoding argininosuccinate synthase) were achieved simultaneously by one-step genome modification and by obtaining the L-citrulline-producing strain. Then, plasmid-based overexpression of the optimized L-citrulline operon was carried out and the L-citrulline production was further improved. In fed-batch fermentation, the L-citrulline production and yield from glucose of the final strain reached 26.7 g/L and 0.18 g/g, respectively. These results indicate that optimization of L-citrulline operon in C. glutamicum is effective to construct the L-citrulline over-producing strain.

1. Introduction

L-citrulline plays important roles in many physiological processes, such as the regulation of nitrogen homeostasis, immune-system stimulation, the antioxidant effect, and nitric oxide metabolism. Due to its multiple functions, L-citrulline is widely used in the pharmaceutical, health-care food, and cosmetics industries, and its application range is expanding rapidly [1,2,3].

In recent years, methods for L-citrulline production by enzymatic synthesis and microbial fermentation have been reported. The enzymatic synthesis uses arginine deiminase for the hydrolysis of the arginine guanidinium group [2,3]. In the enzymatic method for L-citrulline production, L-arginine is the substrate or raw material. However, L-arginine is produced by microbial fermentation at present, and the L-arginine production strains are ordinarily derived from Corynebacterium glutamicum and its related species [4,5,6]. In C. glutamicum strains, L-citrulline is an intermediate metabolite in the L-arginine biosynthetic pathway (Figure 1). During L-arginine production by the microbial fermentation process, in the cells of the L-arginine producing strain, L-arginine is synthesized from L-citrulline by introducing the imino group in the carbamoyl of L-citrulline [4]. However, in an enzymatic method for L-citrulline production, the introduced imino group in L-arginine is hydrolyzed. Therefore, in consideration of the acquisition of the L-arginine substrate, the enzymatic method for L-citrulline production is uneconomical. In comparison, the one-step production of L-citrulline by microbial fermentation is more economical.

C. glutamicum and its related species have been employed for the industrial production of amino acids for several decades, and it is especially known for its ability to synthesis and secrete glutamate [7,8,9,10]. On this basis, C. glutamicum is considered an excellent host for the production of glutamate-derived amino acids, such as L-ornithine and L-arginine [9,10]. The genome of C. glutamicum reveals a rich repertoire of pathways, suggesting attractive properties for industrial production purposes; moreover, a wide range of genetic engineering tools for C. glutamicum engineering are established, and the omics data of C. glutamicum are constantly expanding. Therefore, metabolic engineering on C. glutamicum is likely to obtain a promising cell factory [7,9,10]. As mentioned above, in C. glutamicum strains, L-citrulline is an intermediate metabolite in the L-arginine biosynthetic pathway (Figure 1). In C. glutamicum, the genes involved in L-arginine biosynthesis are organized as the gene cluster argCJBDFRGH and are divided into argCJBDFR and argGH operons [5,11,12]. Additionally, the argCJBDFR operon encodes all of the enzymes required to convert L-glutamate to L-citrulline (Figure 1). The argR gene encodes repressor ArgR of the argCJBDFR and argGH operons. The argG gene encodes argininosuccinate synthase, which catalyzes the conversion of L-citrulline to argininosuccinate (Figure 1). The argB gene encodes N-acetylglutamate kinase (NAGK), which is feedback-inhibited by L-arginine, and the intracellular activity of NAGK is the limitation for L-arginine and L-citrulline synthesis by C. glutamicum [4,13,14]. However, in Escherichia coli, the NAGK_Ec encoded by argB_Ec is natively insensitive to L-arginine. In C. glutamicum, the replacement of the chromosomal argB by argB_Ec could effectively improve L-arginine and L-citrulline production [13]. In C. glutamicum, introducing mutant NAGK that was less sensitive to L-arginine was also beneficial for L-ornithine production [8,15].

In C. glutamicum strains, L-citrulline is an intermediate metabolite between L-ornithine and L-arginine in the L-arginine biosynthetic pathway (Figure 1). Metabolically engineered C. glutamicum could produce 51.5 g/L of L-ornithine with the productivity of 1.29 g/L/h in fed-batch fermentation [15]. Systems metabolic engineering in combination with random mutagenesis on C. glutamicum could result in the efficient production of L-arginine to 92.5 g/L in fed-batch fermentation [5]. Therefore, C. glutamicum strains have the potential to be efficient L-citrulline producers. The inactivation of argininosuccinate synthase (encoded by argG) and repressor ArgR combined with the overexpression of argJ encoding ornithine acetyltransferase in C. glutamicum ATCC13032 resulted in the L-citrulline production of 8.51 g/L [16]. The deletion of argR and argG genes combined with the overexpression of argB^fbr (encoding feedback resistant NAGK) and argF (encoding ornithine carbamoylphosphate transferase) in C. glutamicum MB001 resulted in the accumulation of 7.7 g/L of L-citrulline in minimal medium [17].

In this study, we performed the optimization of L-citrulline biosynthesis operon in C. glutamicum for L-citrulline production. Firstly, we inserted the argB_Ec gene at an appropriate site in gene cluster argCJBDFRGH to achieve the expression of feedback-resistant NAGK_Ec and the deletion of argR and argG genes. Then, the plasmid-based overexpression of the optimized L-citrulline operon argCJBDFB_Ec was carried out to further improve L-citrulline biosynthesis.

2. Materials and Methods

2.1. Microorganism and Cultivation Conditions

All strains plasmids [18,19] used in this study are listed in

Table 1. Strains and plasmids used in this study.

Strain or Plasmid	Description	Reference or Source
Strains
E. coli JM109	General cloning host	TaKaRa
C. glutamicum ATCC13032	Wild-type strain	ATCC
CRB	C. glutamicum ATCC13032 derivative with insertion of argBEc into argR gene	This work
CRBG	C. glutamicum ATCC13032 derivative with insertion of argBEc between argR and argG genes	This work
CRBGC	CRBG derivative harboring pDXW-10-argCJBDF	This work
CRBGCo	CRBG derivative harboring pDXW-10-argCJBDFBEc
plasmids
pK18mobsacB	Kanr; vector for in-frame deletions	Lab stock [18]
pK18RB	Derived from pK18mobsacB, harboring argRF-argBEc-argRR fragment	This work
pK18RBG	Derived from pK18mobsacB, harboring argRF’-argBEc-argGR’ fragment	This work
pDXW-10	Kanr; shuttle vector between E. coli and C. glutamicum	Lab stock [19]
pDXW-10-argCJBDF	Derived from pDXW-10, for constitutive expression of argCJBDF gene cluster	This work
pDXW-10-argCJBDFBEc	Derived from pDXW-10, for constitutive expression of the optimized L-citrulline operon argCJBDFBEc	This work

. E. coli strain JM109 was used as the host for plasmid construction and was cultured in Luria–Bertani (LB) medium at 37 °C. The precultivations of C. glutamicum strains were carried out in LBG medium (LB medium supplemented with 5 g/L glucose) at 30 °C. For L-arginine auxotroph strain precultivation, 0.5 g/L L-arginine was added to the LBG medium. Where appropriate, kanamycin (25 mg/L for C. glutamicum strains, 50 mg/L for E. coli strains) was added to the cultures.

For L-citrulline fermentation in shake flasks, the C. glutamicum strains from agar slants were inoculated in 20 mL seed medium (LBG medium), and 0.5 g/L L-arginine was added for the L-arginine auxotroph strain. Seed cultivation was carried out at 30 °C for 18 h in 250-mL shake flasks with a rotational speed of 220 r/min. The seed culture (1 mL) was transferred into 250-mL shake flasks containing 20 mL fermentation medium. The fermentation medium contained glucose 80 g/L, yeast extract 8 g/L, (NH₄)₂SO₄ 40 g/L, KH₂PO₄ 1.5 g/L, MgSO₄·7H₂O 0.5 g/L, FeSO₄·7H₂O 0.02 g/L, MnSO₄ 0.02 g/L, and CaCO₃ 20 g/L; 0.5 g/L L-arginine was added for the L-arginine auxotroph strain, and the fermentation was carried out at 30 °C with a rotational speed of 220 r/min.

For L-citrulline fed-batch fermentation in the bioreactor, the C. glutamicum strain from agar slants was inoculated in a 50 mL seed medium (LBG medium supplemented with 0.5 g/L L-arginine) and cultured at 30 °C for 18 h in 500-mL shake flasks with a rotational speed of 220 r/min. The seed culture (100 mL) was transferred into 5-L stirred fermenter (BIOTECH-5BG, Baoxing Co., Shanghai, China) containing 1.5 L fermentation medium. The fermentation medium contained glucose 60 g/L, yeast extract 8 g/L, (NH₄)₂SO₄ 20 g/L, KH₂PO₄ 1.5 g/L, MgSO₄·7H₂O 0.5 g/L, FeSO₄·7H₂O 0.02 g/L, MnSO₄ 0.02 g/L, and L-arginine 0.5 g/L. The feed medium contained glucose 700 g/L, yeast extract 8 g/L, KH₂PO₄ 1.5 g/L, and MgSO₄·7H₂O 0.5 g/L and was fed into the fermenter when the residual glucose concentration was below 10 g/L. The temperature was maintained at 30 °C, and the pH was maintained at 7.0 by addition of 30% NH₄OH solution. The air flow rate was maintained at 2 L/min, and the agitation speed was 600 r/min.

2.2. Analytical Methods

Cell growth was monitored by measuring the OD₆₀₀ using a spectrophotometer (UNICO™-UV2000, UNICO (Shanghai) Instrument Co., Ltd., Shanghai, China). For monitoring the cell growth during L-citrulline fermentation in shake flasks, the culture fluid was diluted by 0.2 mol/L HCl to dissolve CaCO₃. The glucose was measured using a bioanalyzer (SBA-40C, Biology Institute of Shandong Academy of Sciences, Jinan, China). The amino acids were measured by high-pressure liquid chromatography [20].

2.3. Transcriptional Analysis

The total RNA of C. glutamicum was extracted at the exponential phase using the RNAiso Plus reagent (Takara, Dalian, China), and the synthesis of cDNA was performed using the PrimeScript RT reagent kit (Takara, Dalian, China). Real-time PCR (RT-PCR) was carried out as described previously [21]. The primers used for the RT-PCR analysis of genes in the argCJBDF cluster were referred to the published study [22], and the primers EcBF (5′-GCCGTAGGTTTGTTTCTCGG-3′) and EcBR (5′-CGTTCATCAGTTGCCCTTC-3′) were used for the RT-PCR analysis of the argB_Ec gene. The 16S rRNA relative abundance was used as an internal standard to standardize the results.

2.4. Construction of Plasmids and Strains

All of the plasmids used in this study are listed in Table 1, and the primers are listed in

Table 2. Primers used in this study.

Names	Sequences (5′→3′)	Restriction Sites
RB-RF1	CCGGAATTCTAACGCTAACAAGCTCTCATTTTGCAGATT	EcoRI
RB-RR1	TTACATTTAGCGGCGCAGCTTCTCCGACGGAC
RB-RF2	TAGCTTAAGTTTTGTTGGCCGGAGGCGCAGTGATGAACTGCTGGTTTCTACAGATC
RB-RR2	CGCGGATCCGCGCCCGCTGAGTAATTCACCTA	BamHI
RB-BF	AGCTGCGCCGCTAAATGTAACGAAGACAACTTACTGAAAG
RB-BR	GGCCAACAAAACTTAAGCTA
RBG-RF	CCGGAATTCGCACGCCAAGCTCTCATTTTGCAGATTTTG	EcoRI
RBG-RR	GGTGCGCAGCATCGCGATGTTGCCGG
RBG-GF	GGCGCAGCTTTCCGGCATTGAATTTCGCTACAAGCGCGGCGTTGACGCACG
RBG-GR	CGCGGATCCCTAAATACTTGAAGTTCTAGTCTGG	BamHI
RBG-BF	CCGGCAACATCGCGATGCTGCGCACCCCAATATTCGTTTCGGCTATGCGGAAAC
RBG-BR	GAAATTCAATGCCGGAAAGCTGCGCC
CF	AAGGAAAAAAGCGGCCGCAAATTCATGCTTTTACCCACTTGCAG	NotI
CR	GGAAGATCTGCAAAATGAGAGCTTGGCGTGCAGTGCG	BglII
CoR	AAGGAAAAAAGCGGCCGCGAAATTCAATGCCGGAAAGCTGCGCC	NotI

. The insertion of argB_Ec into the C. glutamicum genome was performed via two-step homologous recombination using vector pK18mobsacB [18]. The plasmid pK18RB was used for the insertion of argB_Ec into the argR gene. To obtain the argRF-argB_Ec-argRR fragment, the upstream and downstream regions of the argR gene (argRF and argRR) were amplified using the primer combinations RB-RF1/RB-RR1 and RB-RF2/RB-RR2, respectively, from genomic DNA of C. glutamicum ATCC13032; the integral argB_Ec gene was amplified using the primers RB-BF and RB-BR from the genomic DNA of E. coli BL21; then, the argRF fragment and the argB_Ec gene were fused in an overlap-extension PCR using the primers RB-RF1 and RB-BR, and the argRF-argB_Ec fragment was obtained; and finally, the argRF-argB_Ec and argRR fragments were fused using the primers RB-RF1 and RB-RR2, and the argRF-argB_Ec-argRR fragment was obtained. This argRF-argB_Ec-argRR fragment was cloned into pK18mobsacB, resulting in plasmid pK18RB. This plasmid was electro-transformed into C. glutamicum ATCC13032, and the modified strain CRB was screened as described previously [11].

The plasmid pK18RBG was used for the insertion of argB_Ec between the argR and argG genes. The primers RBG-RF and RBG-RR were used for the amplification of the upstream region of the argR gene (argRF’), the primers RBG-GF and RBG-GR were used for the amplification of downstream region of the argG gene (argGR’), and the primers RBG-BF and RBG-BR were used for amplification of the integral argB_Ec gene. Overlap-extension PCR was used for obtaining the argRF’-argB_Ec-argGR’ fragment as described above. This argRF’-argB_Ec-argGR’ fragment was cloned into pK18mobsacB, resulting in plasmid pK18RBG. Additionally, plasmid pK18RBG was used for CRBG strain construction as described above.

Plasmid pDXW-10 [19] was used for the constitutive expression of the argCJBDF and argCJBDFB_Ec gene cluster. The argCJBDF gene cluster was amplified using the primers CF and CR from the genomic DNA of C. glutamicum ATCC13032. The resulting DNA fragment was cloned into pDXW-10, resulting in plasmid pDXW-10-argCJBDF. This plasmid was used to transform the CRBG strain using electroporation and to obtain the CRBGC strain. The argCJBDFB_Ec gene cluster was amplified using the primers CF and CoR from the genomic DNA of the CRBG strain. The resulting DNA fragment was cloned into pDXW-10, and the restriction enzyme NheI was used to validate the direction of gene ligation. The correct ligating plasmid was named pDXW-10-argCJBDFB_Ec. This plasmid was used to transform the CRBG strain using electroporation and to obtain the CRBGCo strain.

3. Results and Discussion

3.1. Effects of argR/argG Deletion and argB_Ec Expression on L-Citrulline Biosynthesis of C. glutamicum

In the CRB strain, the heterologous argB_Ec gene encoding feedback-resistant NAGK_Ec from E. coli was inserted into the argR gene in the genome (Figure 1). Therefore, the argR gene encoding the repressor ArgR of the argCJBDFR and argGH operons was disrupted. The expression of the genes in the argCJBDF and argGH operons was strengthened in the CRB strain at the transcriptional level (Figure 2). This result indicated that the expression of the argCJBDF and argGH operons in the CRB strain was derepressed by the inactivation of the ArgR repressor. Meanwhile, the transcriptional analysis revealed that the argB_Ec gene was expressed along with the operons in the CRB strain (Figure 2).

As reported [13,17], C. glutamicum ATCC13032 could not accumulate L-citrulline and L-arginine (Figure 3a). Batch fermentation in the shake flasks revealed that the CRB strain could produce 3.6 g/L of L-citrulline and 1.1 g/L of L-arginine (Figure 3b). Previous research has shown that individually alleviating the feedback inhibition of NAGK by L-arginine or individually alleviating the transcriptional repression of the argCJBDF and argGH operons by the ArgR repressor could not make C. glutamicum ATCC13032 produce L-arginine [13]. Only simultaneously alleviating the feedback inhibition and transcriptional repression could give rise to excessive synthesis and the accumulation of L-arginine by C. glutamicum ATCC13032 [13]. The strain CRB could produce L-arginine; therefore, the insertion of argB_Ec into the argR gene led to the expression of heterologous, feedback-resistant NAGK_Ec and the inactivation of the ArgR repressor simultaneously in the CRB strain. In other words, the inactivation of the ArgR repressor and the expression of feedback-resistant NAGK_Ec were achieved in one-step genome modification.

In the CRBG strain, the argB_Ec gene was inserted into the genome between the argR and argG genes; meanwhile, the downstream region of the argR gene and the upstream region of the argG gene were deleted (Figure 1). Therefore, the ArgR repressor and argininosuccinate synthase were inactivated simultaneously. The expression of genes in the argCJBDF operon was strengthened in the CRBG strain at the transcriptional level (Figure 2). Meanwhile, the transcriptional analysis also revealed that the argB_Ec gene was expressed along with the argCJBDF operon, in the CRBG strain (Figure 2).

Batch fermentation in shake flasks showed that the strain CRBG could produce 5.7 g/L of L-citrulline with a yield of 0.13 g/g glucose, and there was no accumulation of L-arginine in fermentation broth (Figure 3c). The results indicated that the conversion of L-citrulline to L-arginine was blocked in the CRBG strain by deleting the argG gene. Therefore, the inactivation of the ArgR repressor, the expression of feedback-resistant NAGK_Ec, and the blocking of L-citrulline conversion were achieved simultaneously in the CRBG strain by one-step genome modification.

3.2. Further Enhancing of L-Citrulline Biosynthesis by Plasmid-Based Overexpression of the Optimized L-Citrulline Operon

In C. glutamicum, the argCJBDF operon encodes all of the enzymes for L-citrulline synthesis from L-glutamate. After the elimination of the transcriptional repression of argCJBDF operon by ArgR, the plasmid-based expression of L-citrulline operon can further increase the expression level. Thus, the plasmid-based overexpression of the L-citrulline operon strain CRBGC and CRBGCo was constructed. The batch fermentation of the CRBGC (Figure 4a) and CRBGCo (Figure 4b) strain in shake flasks resulted in 8.2 g/L and 9.1 g/L of L-citrulline, respectively, with a yield of 0.16 g/g glucose and 0.18 g/g glucose, respectively, which were obviously higher than those of the CRBG strain (Figure 3c). In addition, the CRBGCo strain obtained higher L-citrulline production than the CRBGC strain. The results indicated that the L-citrulline biosynthesis in the CRBGC and CRBGCo strains was further strengthened by the plasmid-based overexpression of the L-citrulline operon, and the plasmid-based overexpression of the optimized L-citrulline operon was more beneficial to the L-citrulline biosynthesis.

In L-ornithine-producing C. glutamicum, the plasmid-based overexpression of the argCJBD genes (Figure 1) could significantly increase the L-ornithine production [15]. Similarly, in L-arginine producing C. crenatum, the plasmid-based overexpression of the argCJBDFRGH cluster (Figure 1) could also strengthen the L-arginine synthesis [23]. In this study, the L-citrulline biosynthesis was also strengthened by the plasmid-based overexpression of the L-citrulline operon. Therefore, the intensification of the whole biosynthetic pathway is effective to increase the biosynthesis efficiency of the target product.

3.3. Fed-Batch Fermentation for L-Citrulline Production

The production performance of the CRBGCo strain was investigated in a fed-batch process, and the fermentation process is shown in Figure 5. The fed-batch fermentation of the CRBGCo strain resulted in 26.7 g/L of L-citrulline with a yield of 0.18 g/g glucose. The results indicate that the optimization of the L-citrulline operon in C. glutamicum is effective to construct the L-citrulline over-producing strain. In fed-batch fermentation, the L-citrulline yield from the glucose of the CRBGCo strain was the same as the batch fermentation in shake flasks, but the productivity (0.42 g/L/h) was higher than that of the batch fermentation (0.25 g/L/h). In the next work, the production of L-citrulline by the CRBGCo strain can be improved through the optimization of the fermentation conditions.

4. Discussion

In this study, we performed preliminary metabolic engineering on C. glutamicum for L-citrulline production, and the work was focused on the optimization of the L-citrulline operon. The resulting CRBGCo strain could produce 26.7 g/L of L-citrulline in fed-batch fermentation. Therefore, as reported previously [16,17], the results in this study also prove that C. glutamicum can be used for L-citrulline fermentation production. Compared to the CIT0(pVWEx1-argFB^fbr) strain derived from C. glutamicum MB001 [17], the L-citrulline productivity and yield from the glucose of the CRBGCo strain in batch fermentation were relatively low, but the L-citrulline production of the CRBGCo strain was relatively high. Compared to the CIT strain derived from C. glutamicum ATCC13032 [16], the CRBGCo strain had higher L-citrulline production, productivity, and yield from glucose in the batch fermentation. Therefore, the metabolic engineering strategies used in this study are effective for constructing L-citrulline-producing C. glutamicum. The feedback-insensitive NAGK is critical for L-citrulline synthesis in C. glutamicum [8,17]. Therefore, the L-citrulline synthesis pathway can be further fine-tuned by regulating the expression level of the argB_Ec gene through the integration of different promoters [5,15]. C. glutamicum MB001, derived from C. glutamicum ATCC13032, a prophage-free C. glutamicum strain with a genome reduced by 6%, is more efficient for plasmid-based gene overexpression [17,24]. Therefore, the C. glutamicum MB001 is perhaps more suitable for the tuning of natural or synthetic metabolic pathways required for small-molecule production [24]. In the next work, the metabolic engineering strategies used in this study can be performed in C. glutamicum MB001, and more efficient L-citrulline production is possible to realize.

Similar to the previous study [17], in batch fermentation, the biomass of the L-citrulline-producing strains was decreased when L-citrulline production was increased (Figure 3 and Figure 4). This is because more carbon flux and energy were used for L-citrulline production when the L-citrulline synthesis pathway was strengthened, and the cell growth was negatively affected. In batch fermentation, the initial concentration of glucose was set at a high level (80 g/L) to avoid the depletion of glucose, and the residual glucose concentration was around 30 g/L. Meanwhile, the productivity of L-citrulline in the fed-batch fermentation was obviously enhanced compared with that in the batch fermentation. Therefore, the L-citrulline production potential of the CRBGCo strain can be further unleashed through the optimization of the fermentation medium and conditions.

Similar to L-arginine, the biosynthesis of L-citrulline in C. glutamicum requires ATP, NADPH, and carbamoyl phosphate (Figure 1) [5,11,12,25]. Systems metabolic engineering, including the overexpression of biosynthetic genes, the removal of metabolism regulation [5], the increase in the supply of the L-glutamate precursor [12], cofactors [5,15], energy [11], the building block (carbamoyl phosphate) [5], and the improvement of the ammonia assimilation [25,26], can be carried out to optimize the metabolic network and obtain a more efficient L-citrulline-producing strain. C. glutamicum can use a variety of carbon sources for cell growth and product synthesis; more importantly, C. glutamicum can simultaneously utilize different carbon sources present in mixtures such as lignocellulosic hydrolysates [17]. In the next work, the investigation of using lignocellulosic hydrolysates as a carbon source for L-citrulline production can be performed.

5. Conclusions

In this study, the optimization of the L-citrulline operon in C. glutamicum, including the chromosomal integration of the heterologous argB_Ec gene, the chromosomal deletion of the argR and argG genes, and the plasmid-based overexpression of the optimized L-citrulline operon, was performed for L-citrulline production. In C. glutamicum ATCC13032, the chromosomal integration of the integral argB_Ec gene could introduce the natively insensitive NAGK, the deletion of the argR gene could relieve the repression of the L-citrulline operon by the ArgR repressor, and the deletion of the argG gene could block the conversion of L-citrulline to L-arginine. These three strain-engineering strategies were simultaneously achieved by one-step genome modification, and the L-citrulline-producing strain was obtained. Further enhancing the expression level of the optimized L-citrulline operon by plasmid-based overexpression could further improve the L-citrulline production. In the next work, systems metabolic engineering and fermentation-process optimization can be performed to increase the L-citrulline production, and using a non-food-derived carbon source such as lignocellulosic hydrolysates for L-citrulline production can also be investigated.