Potential Mechanisms Underlying Hypoxia-Induced Diabetes in a Rodent Model: Implications for COVID-19
Abstract
1. Introduction
2. Materials and Methods
2.1. Isolation of Islets and Subcellular Protein Fractionation
2.2. In Vitro IH Treatment of Isolated Islets
2.3. siRNA Mediated KCC2 Gene Knockdown and KCC2 Protein Inhibition
2.4. ELISA
2.5. Colorimetric Assay for Chloride Quantification
2.6. Preparation of Animals
2.7. RNA Extraction and Quantitative Real-Time RT-PCR
2.8. Western Blot Assays
2.9. Ethical Approval
2.10. Euthanasia and Tissue Procurement
2.11. Statistics
3. Results
3.1. IH Exposure to Primary Islets Elevates KCC2 Transporters Participating in the Regulation of Insulin Secretion
3.2. KCC2 Inhibitor Elevates Insulin Secretion and Chloride Levels
3.3. IH-Exposure for 1 h to Rat Pups at Postnatal Day 1 Decreases NKCC1, Increases KCC2 Levels, and Reduces Chloride Levels in Pancreatic Islets 3 Weeks Post-Exposure
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Pae, E.K.; Ahuja, B.; Kim, M.; Kim, G. Impaired glucose homeostasis after a transient intermittent hypoxic exposure in neonatal rats. Biochem. Biophys. Res. Commun. 2013, 441, 637–642. [Google Scholar] [CrossRef]
- Montefusco, L.; Ben Nasr, M.; D’Addio, F.; Loretelli, C.; Rossi, A.; Pastore, I.; Daniele, G.; Abdelsalam, A.; Maestroni, A.; Dell'Acqua, M.; et al. Acute and long-term disruption of glycometabolic control after SARS-CoV-2 infection. Nat. Metab. 2021, 3, 774–785. [Google Scholar] [CrossRef]
- Riley, F. Exploring Research: Can Coronavirus Cause Diabetes, or Make It Worse? Diabetes UK. Available online: www.diabetes.org.uk/about_us/news/new-worse-cases-coronavirus (accessed on 30 October 2021).
- Yang, J.K.; Lin, S.S.; Ji, X.J.; Guo, L.M. Binding of SARS coronavirus to its receptor damages islets and causes acute diabetes. Acta Diabetol. 2010, 47, 193–199. [Google Scholar] [CrossRef]
- Unsworth, R.; Wallace, S.; Oliver, N.S.; Yeung, S.; Kshirsagar, A.; Naidu, H.; Kwong, R.M.W.; Kumar, P.; Logan, K.M. New-Onset Type 1 Diabetes in Children During COVID-19, Multicenter Regional Findings in the U.K. Diabetes Care 2020, 43, e170–e171. [Google Scholar] [CrossRef]
- Sinha, P.; Matthay, M.A.; Calfee, C.S. Is a “Cytokine Storm” Relevant to COVID-19? JAMA Intern. Med. 2020, 180, 1152–1154. [Google Scholar] [CrossRef]
- Shahbaz, S.; Xu, L.; Osman, M.; Sligl, W.; Shields, J.; Joyce, M.; Tyrrell, D.L.; Oyegbami, O.; Elahi, S. Erythroid precursors and progenitors suppress adaptive immunity and get invaded by SARS-CoV-2. Stem Cell Rep. 2021, 16, 1165–1181. [Google Scholar] [CrossRef]
- Pourfridoni, M.; Abbasnia, S.M.; Shafaei, F.; Razaviyan, J.; Heidari-Soureshjani, R. Fluid and Electrolyte Disturbances in COVID-19 and Their Complications. BioMed Res. Int. 2021, 2021, 6667047. [Google Scholar] [CrossRef]
- De Carvalho, H.; Richard, M.C.; Chouihed, T.; Goffinet, N.; Le Bastard, Q.; Freund, Y.; Kratz, A.; Dubroux, M.; Masson, D.; Figueres, L.; et al. Electrolyte imbalance in COVID-19 patients admitted to the Emergency Department: A case-control study. Intern. Emerg. Med. 2021, 16, 1945–1950. [Google Scholar] [CrossRef]
- Fu, C.; Jiang, L.; Zhu, F.; Liu, Z.; Li, W.; Jiang, H.; Ye, H.; Kushida, C.A.; Li, S. Chronic intermittent hypoxia leads to insulin resistance and impaired glucose tolerance through dysregulation of adipokines in non-obese rats. Sleep Breath. 2015, 19, 1467–1473. [Google Scholar] [CrossRef]
- Sherwani, S.I.; Aldana, C.; Usmani, S.; Adin, C.; Kotha, S.; Khan, M.; Eubank, T.; Scherer, P.E.; Parinandi, N.; Magalang, U.J. Intermittent hypoxia exacerbates pancreatic β-cell dysfunction in a mouse model of diabetes mellitus. Sleep 2013, 36, 1849–1858. [Google Scholar] [CrossRef]
- Sacramento, J.F.; Ribeiro, M.J.; Rodrigues, T.; Guarino, M.P.; Diogo, L.N.; Seiça, R.; Monteiro, E.C.; Matafome, P.; Conde, S.V. Insulin resistance is associated with tissue-specific regulation of HIF-1α and HIF-2α during mild chronic intermittent hypoxia. Respir. Physiol. Neurobiol. 2016, 228, 30–38. [Google Scholar] [CrossRef]
- Di Fulvio, M.; Aguilar-Bryan, L. Chloride transporters and channels in β-cell physiology: Revisiting a 40-year-old model. Biochem. Soc. Trans. 2019, 47, 1843–1855. [Google Scholar] [CrossRef]
- Kursan, S.; McMillen, T.S.; Beesetty, P.; Dias-Junior, E.; Almutairi, M.M.; Sajib, A.A.; Kozak, J.A.; Aguilar-Bryan, L.; Di Fulvio, M. The neuronal K+Cl− co-transporter 2 (Slc12a5) modulates insulin secretion. Sci. Rep. 2017, 7, 1732. [Google Scholar] [CrossRef]
- Sehlin, J. Interrelationship between chloride fluxes in pancreatic islets and insulin release. Am. J. Physiol. 1978, 235, E501–E508. [Google Scholar] [CrossRef]
- Best, L. Glucose-induced electrical activity in rat pancreatic beta-cells: Dependence on intracellular chloride concentration. J. Physiol. 2005, 568 Pt 1, 137–144. [Google Scholar] [CrossRef]
- Delpire, E. Cation-chloride cotransporters in neuronal communication. News Physiol. Sci. 2000, 15, 309–312. [Google Scholar] [CrossRef]
- Antrobus, S.P.; Lytle, C.; Payne, J.A. K+-Cl− cotransporter-2 KCC2 in chicken cardiomyocytes. Am. J. Physiol. Cell Physiol. 2012, 303, C1180–C1191. [Google Scholar] [CrossRef][Green Version]
- Agez, M.; Schultz, P.; Medina, I.; Baker, D.J.; Burnham, M.P.; Cardarelli, R.A.; Conway, L.C.; Garnier, K.; Geschwindner, S.; Gunnarsson, A.; et al. Molecular architecture of potassium chloride co-transporter KCC2. Sci. Rep. 2017, 7, 16452. [Google Scholar] [CrossRef]
- Pae, E.K.; Kim, G. Insulin production hampered by intermittent hypoxia via impaired zinc homeostasis. PLoS ONE 2014, 9, e90192. [Google Scholar] [CrossRef]
- Deisz, R.A.; Wierschke, S.; Schneider, U.C.; Dehnicke, C. Effects of VU0240551, a novel KCC2 antagonist, and DIDS on chloride homeostasis of neocortical neurons from rats and humans. Neuroscience 2014, 277, 831–841. [Google Scholar] [CrossRef]
- Yokoi, K. Colorimetric determination of chloride in biological samples by using mercuric nitrate and diphenylcarbazone. Biol. Trace Elem. Res. 2002, 85, 87–94. [Google Scholar] [CrossRef]
- Skelly, J.R.; Bradford, A.; O’Halloran, K.D. Intermittent hypoxia impairs pharyngeal dilator muscle function in male but not female rats. Adv. Exp. Med. Biol. 2010, 669, 285–287. [Google Scholar] [CrossRef]
- Hollstein, T.; Schulte, D.M.; Schulz, J.; Glück, A.; Ziegler, A.G.; Bonifacio, E.; Wendorff, M.; Franke, A.; Schreiber, S.; Bornstein, S.R.; et al. Autoantibody-negative insulin-dependent diabetes mellitus after SARS-CoV-2 infection: A case report. Nat. Metab. 2020, 2, 1021. [Google Scholar] [CrossRef]
- Wu, C.T.; Lidsky, P.V.; Xiao, Y.; Lee, I.T.; Cheng, R.; Nakayama, T.; Jiang, S.; Demeter, J.; Bevacqua, R.J.; Chang, C.A.; et al. SARS-CoV-2 infects human pancreatic beta cells and elicits beta cell impairment. Cell Metab. 2021, 33, 1565–1576.e5. [Google Scholar] [CrossRef]
- Lima-Martínez, M.M.; Carrera Boada, C.; Madera-Silva, M.D.; Marín, W.; Contreras, M. COVID-19 and diabetes: A bidirectional relationship. Clin. Investig. Arterioscler. 2021, 33, 151–157. [Google Scholar] [CrossRef]
- Starling, S. How COVID-19 disrupts glycometabolic control. Nat. Rev. Endocrinol. 2021, 17, 448. [Google Scholar] [CrossRef]
- Tang, X.; Uhl, S.; Zhang, T.; Xue, D.; Li, B.; Vandana, J.J.; Acklin, J.A.; Bonnycastle, L.L.; Narisu, N.; Erdos, M.R.; et al. SARS-CoV-2 infection induces beta cell transdifferentiation. Cell Metab. 2021, 33, 1577–1591.e7. [Google Scholar] [CrossRef]
- Malieckal, D.A.; Uppal, N.N.; Ng, J.H.; Jhaveri, K.D.; Hirsch, J.S. Northwell Nephrology COVID-19 Research Consortium. Electrolyte abnormalities in patients hospitalized with COVID-19. Clin. Kidney J. 2021, 14, 1704–1707. [Google Scholar] [CrossRef]
- Rewers, M.; Ludvigsson, J. Environmental risk factors for type 1 diabetes. Lancet 2016, 387, 2340–2348. [Google Scholar] [CrossRef]
- Rozzo, A.; Meneghel-Rozzo, T.; Delakorda, S.L.; Yang, S.B.; Rupnik, M. Exocytosis of insulin: In vivo maturation of mouse endocrine pancreas. Ann. N. Y. Acad. Sci. 2009, 1152, 53–62. [Google Scholar] [CrossRef]
Gene | Sequence (5′→3′) | ||
---|---|---|---|
SUR1 | NM_013039 | F: TGCCTATGTCTTGGCTGTTC | R: CTCTCAGGTTGATCCCAGTTTC |
Kir6.2 | NM_031358 | F: AGCCCAAGTTTAGCATCTCTC | R: GCACTCTACATACCGTACTTCAC |
KCC2 | NM_134363 | F: TCCACCCAATTTCCCGATTT | R: CGTGTGGTCACTGTCTCATT |
Ins1 | NM_019129 | F: ATCTTCAGACCTTGGCACTG | R: GGCTTTATTCATTGCAGAGGG |
β-actin | NM_031144 | F: ACAGGATGCAGAAGGAGATTAC | R: ACAGTGAGGCCAGGATAGA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pae, E.-K.; Harper, R.M. Potential Mechanisms Underlying Hypoxia-Induced Diabetes in a Rodent Model: Implications for COVID-19. Children 2021, 8, 1178. https://doi.org/10.3390/children8121178
Pae E-K, Harper RM. Potential Mechanisms Underlying Hypoxia-Induced Diabetes in a Rodent Model: Implications for COVID-19. Children. 2021; 8(12):1178. https://doi.org/10.3390/children8121178
Chicago/Turabian StylePae, Eung-Kwon, and Ronald M. Harper. 2021. "Potential Mechanisms Underlying Hypoxia-Induced Diabetes in a Rodent Model: Implications for COVID-19" Children 8, no. 12: 1178. https://doi.org/10.3390/children8121178
APA StylePae, E.-K., & Harper, R. M. (2021). Potential Mechanisms Underlying Hypoxia-Induced Diabetes in a Rodent Model: Implications for COVID-19. Children, 8(12), 1178. https://doi.org/10.3390/children8121178