1. Introduction
Ovarian cancer is one of the five leading causes of cancer-related death in females [
1]. Because of minor symptoms at the beginning and limited screening methods for early diagnosis of epithelial ovarian cancer (EOC), the relative 5-year survival rate is less than 45% [
2]. Among clinically used prognostic markers, such as the disease stage at diagnosis (FIGO), grading, ascites volume, and patients’ age, the volume of residual disease after surgery is the most relevant [
3,
4,
5]. However, widely accepted non-invasive prognostic biomarkers are rare.
In 15–20% of EOC patients, there is a mutation in the tumor suppressor genes breast cancer 1/2 (BRCA1/2), leading to a familial accumulation of ovarian and breast cancer [
6,
7]. BRCA genes encode essential caretaker proteins for DNA surveillance and damage repair [
8]. When those genes are mutated, damaged DNA may not be repaired correctly via homologous recombination and transcriptional regulation, probably leading to cancer [
7,
9]. Consequently, BRCA1 mutation carriers have a 40–60% risk of developing ovarian cancer in their lifetime, while BRCA2 mutation carriers’ cumulative risk is up to 25% [
10]. Therefore, a genetic examination of BRCA mutation status is indicated in case of positive family history, and close medical care as well as prevention strategies are required.
Platelet-activating factor (PAF) plays a crucial role in inflammation, oncogenic transformation, and metastasis of various tumor entities [
11,
12,
13]. PAF is a lipid second messenger secreted into the tumor microenvironment by circulating cells and cancer cells mediating its effect through a specific G-protein-coupled receptor (PTAFR) [
11,
14]. Several studies report that PAF and its receptor enhance cancer progression and invasiveness of EOC [
15,
16,
17,
18]. Consequently, inhibition of PTAFR leads to sensitization to cisplatin chemotherapy and a reduction in tumor growth [
19]. On the basis of this evidence, we hypothesize that an increased degradation of PAF may have protective effects. Therefore, we investigated the role of platelet-activating factor acetylhydrolase (PAF-AH), the degradation enzyme of PAF, in ovarian cancer. PAF-AH is a lipoprotein-bound, calcium-independent phospholipase that is involved in various physiological and pathological processes that influence cell signaling and metabolism [
20]. Apart from this, two other PAF-AH types are known in mammals, namely, intracellular type I and II. Even though the PAF-AH isoforms show a low sequence homology, they share a function in PAF catabolism [
21]. While intracellular PAF-AH I shows antiapoptotic effects and has often been described as a critical driver in cancer pathogenesis [
22,
23,
24,
25], for plasma type PAF-AH, both pro- and anti-tumorigenic effects have been reported. On the one hand, high PLA2G7/PAF-AH expression was associated with aggressive disease and poor prognosis in prostate cancer and in triple-negative breast cancer [
26,
27]. On the other hand, mouse models of Kaposi’s sarcoma and melanoma with PAF-AH overexpression showed reduced tumor growth and more prolonged survival. In situ, the inactivation of PAF by PAF-AH impaired metastasis through inhibition of neoangiogenesis and tumor cell motility [
28].
The canonical Wnt/β-catenin signaling is one of the major pathways involved in tumorigenesis, cancer progression, and the development of therapy resistance to platinum-based chemotherapies or even poly ADP ribose polymerase inhibitors [
29,
30,
31]. The cascade regulates many cellular processes, including development, stemness, cell fate decisions, and cell proliferation [
32]. Aberrant activation promotes a wide range of human malignancies, including EOC [
33,
34,
35]. Although mutations in Wnt-related genes are relatively rare in EOC, except for the endometrioid subtype, expression profiling data prove constitutive activation of Wnt signaling in ovarian cancer, most likely by alterations in the subcellular localization of β-catenin [
36,
37,
38]. β-catenin plays a central role in Wnt signaling through its nuclear translocation and activation of β-catenin-responsive genes. It is tightly regulated by its degradation and nuclear translocation [
8]. In this context, glycogen synthase kinase-3β (GSK3β) represents an important molecular hub. In its active form (phosphorylated at Y216), GSK3β phosphorylates β-catenin, leading to its ubiquitination and proteasomal degradation [
8,
39]. Conversely, in the presence of canonical Wnt ligands, GSK3β kinase activity is inhibited by phosphorylation at S9 and nuclear β-catenin levels increase initiating epithelial–mesenchymal transition (EMT) programs [
40].
Taken together, the biological consequences of signaling events mediated by PLA2G7/PAF-AH seem to be tissue- and context-dependent and need to be specified in EOC [
41]. Beyond the cellular function, we aimed to assess a possible influence of PAF-AH on the Wnt signaling pathway for a better understanding of ovarian cancer pathophysiology, taking into account differences between BRCA1 mutation carriers and BRCA wildtype (WT) patients.
2. Materials and Methods
2.1. Ethical Approval
The tissue samples used in this study were initially obtained for pathological diagnosis, completed prior to the current study. Patients’ data were fully anonymized and encoded for observers during the analysis procedure. The study was approved by the Ethics Committee of Ludwig Maximilians University, Munich, Germany (approval numbers 227-09, 17-471, 17-527, and 19-972). All experiments were carried out with respect to the standards of the Declaration of Helsinki (1975).
2.2. Patients and Specimens
In this study, 156 tissue samples from patients who underwent EOC surgery at the Department of Obstetrics and Gynecology, Ludwig-Maximilian University of Munich, from 1990 to 2002 were analyzed. Patients with benign or borderline tumors were excluded, and no patient had been treated with neoadjuvant chemotherapy. The follow-up data were obtained from the Munich Cancer Registry (Munich Tumor Center, Munich, Germany). The tissue specimens were fixed in 4% buffered formalin and embedded in paraffin for immunohistochemical analysis. Staging and grading of EOC were assessed by gynecological pathologists. Detailed information about the clinical characteristics of patients enrolled in this study, including tumor grading, histology, and staging, was available. The staging was performed according to the WHO and FIGO classification (2014).
Unfortunately, the BRCA mutation status of this EOC collective is not available. Therefore, the BRCA mutation status was defined as unknown, with a BRCA mutation probability of 10–20% [
6,
7]. To investigate PAF-AH expression levels in BRCA1 mutation carriers, we stained additional tumor tissue of 107 patients with a genetically confirmed BRCA1 mutation (
Table 1): 15 patients with a single BRCA1 mutation, and 92 patients with a combined BRCA1/2 mutation.
All mutation carriers showed a proven pathogenic variant and no variant of uncertain significance according to the classification recommended by the IARC Unclassified Genetic Variants Working Group (IARC) and endorsed by the Evidence-based Network for the Interpretation of Germline Mutant Alleles (ENIGMA) Consortium. The specific mutations were identified and evaluated by next-generation sequencing in our genetic laboratory.
Furthermore, blood samples of EOC patients with pathogenic BRCA1 mutation or BRCA WT were used in this study. BRCA mutations were identified by next-generation sequencing in our genetic laboratory. The characteristics of the patients included in blood analysis are shown in
Table 2.
2.3. Immunohistochemistry and Immunocytochemistry
As previously described, tissue microarrays of formalin-fixed, paraffin-embedded tissue specimens (three spots/patient) were prepared [
42]. For immunohistochemistry (IHC) staining, the tissue slides were dewaxed in xylol, washed in 100% ethanol, incubated in methanol with 3% H
2O
2 for 20 min, and rehydrated in a descending ethanol gradient. The samples were demasked in a pressure cooker using sodium citrate buffer (pH = 6.0) containing 0.1 M citric acid and 0.1 M sodium citrate in distilled water. After cooking for 5 min, the slides were cooled down and washed in phosphate-buffered saline (PBS). All slides were incubated with a blocking solution for 30 min to prevent the non-specific binding of the primary antibody (Reagent 1; Zytochem-Plus HRP-Polymer-Kit (mouse/rabbit); Zytomed, Berlin, Germany). Primary antibodies against PAF-AH, pGSK3β, and β-catenin (
Table S1) were applied for 16 h at 4 °C. The slides were washed with PBS and incubated with a complex of the secondary antibody and an HRP polymer (Reagent 3; Zytochem-Plus HRP Polymer-kit (mouse/rabbit); Zytomed, Berlin, Germany). In order to visualize the immunostaining, we applied the substrate and chromogen-3,3′-diaminobenzidine (DAB; Dako, Hamburg, Germany) for 10 min. The slides were counterstained with Mayer’s hemalum and dehydrated in an ascending series of alcohol. Healthy colon tissue or metastatic colon carcinoma tissue served as positive and negative controls (
Figure S1) for the IHC staining to test antibody function and choose the adequate dilution of the antibody.
For immunocytochemistry (ICC), 5 × 103 UWB1.289 cells/cm
2 were seeded on chamber slides (Merck, Darmstadt, Germany). PLA2G7 silencing of UWB1.289 cells was performed after 48 h incubation. Untreated cells served as reference (basal expression). After treatment, slides were washed with PBS 0.1 M, fixed in 100% ethanol and methanol (1:1) for 15 min at room temperature (RT), and air dried. To reduce non-specific background staining, we treated slides with a protein block solution (Dako, Glostrup, Denmark) for 20 min at RT. The slides were incubated with primary antibodies against PAF-AH and β-catenin (
Table S1) for 16 h at 4 °C. After washing with PBS, the slides were incubated with a biotinylated secondary anti-mouse or anti-rabbit antibody (Vector Laboratories, Burlingame, CA, USA) for 30 min at RT. Again, the slides were washed in PBS and incubated with an avidin–biotin peroxidase complex (Vectastain-Elite; Vector Laboratories, Burlingame, CA, USA) for 30 min at RT. The antigen–antibody complex was visualized with the chromogen 3-amino-9-ethylcarbazole (AEC; Dako, Hamburg, Germany) and counterstained with Mayer’s hemalum. Finally, the slides were washed with water and cover slipped using Kaiser’s glycerin gelatin (Merck, Darmstadt, Germany).
2.4. Staining Evaluation and Statistical Analysis
For evaluation of PAF-AH, pGSK3β, and β-catenin staining, the semi-quantitative immunoreactive score (IRScore) was used [
43], which is calculated by multiplying the optical staining intensity (0 = no, 1 = weak, 2 = moderate, and 3 = strong staining) by the percentage of positive stained cells (0 = no staining, 1 ≤ 10%, 2 = 11–50%, 3 = 51–80% and 4 ≥ 81% stained cells). All slides were analyzed by two independent observers in a double-blind process using a photomicroscope (Leitz, Wetzlar, Germany). The median of IRScores resulting from the three spots of one patient was calculated and used for further analyses.
Data processing and statistical analysis of patient data, IHC results, and blood analysis were performed with SPSS 25.0 (v26; IBM, Armonk, NY, USA). The Mann–Whitney
U test was applied to compare IRScores or serum concentrations of PAF-AH between two independent subgroups (no/unknown mutation vs. BRCA1) [
44]. Spearman’s analysis was used to calculate bivariate correlations between PAF-AH and the Wnt signaling proteins pGSK3β and β-catenin [
45]. Survival times were compared using log-rank testing and visualized in Kaplan–Meier plots [
46]. To identify appropriate cut-off values ROC analysis, we performed a widely accepted method for cut-off point selection. The Youdan index, defined as the maximum (sensitivity + specificity
−1) [
47], is determined to ensure the optimal cut-off, which maximizes the sum of sensitivity and specificity [
48,
49]. A Cox regression model was established for multivariate analysis [
50].
p-values ≤ 0.05 were considered significant. Ct values of the investigated genes were obtained by qPCR and the relative expression was calculated applying the 2-ΔΔCt formula [
51]. For data visualization and statistical analysis of in vitro-generated data, Graph Pad Prism 7.03 (v7; San Diego, CA, USA) was used.
2.5. PAF-AH ELISA
To determine the PAF-AH concentration in serum samples, we conducted an enzyme-linked immunosorbent assay (ELISA; R&D Systems, Minneapolis, MN, USA) according to the instructions of the manufacturer. The standard curve was created using a four-parameter logistic curve fit. The assay range was 0.8–50 ng/mL with a sensitivity of 0.284 ng/mL.
2.6. Cell Lines
The human ovarian cancer cell lines ES-2 (clear cell; ATCC, Rockville, MD, USA), SKOV3 (serous, BRCA WT; ATCC, Rockville, MD, USA), TOV112D (endometrioid; ATCC, Rockville, MD, USA), and UWB1.289 (serous, BRCA1-negative; ATCC, Rockville, MD, USA) were maintained in culture with RPMI 1640 GlutaMAX medium (Gibco, Gibco, Paisley, UK) supplemented with 10% fetal bovine serum (FBS; Gibco, Paisley, UK) in a humified incubator at 37 °C under 5% CO2. The benign ovarian cell line HOSEpiC (served as the reference; ATCC, Rockville, MD, USA) was maintained in culture in Ovarian Epithelial Cell Medium (OEpiCM) (ScienCell, Carlsbad, CA, USA,) in a humidified incubator at 37 °C under 5% CO2. The benign breast cell line MCF10A (served as the reference; ATCC, Rockville, MD, USA) was maintained in a special growth and assay medium in a humidified incubator at 37 °C under 5% CO2.
2.7. qPCR
Isolation of mRNA was performed according to the manufacturer’s protocol using the RNeasy Mini Kit (Qiagen, Venlo, The Netherlands). A total of 1 µg RNA was converted into cDNA with the MMLV Reverse Transcriptase 1st-Strand cDNA Synthesis Kit (Epicentre, Madison, WI, USA). qPCR was performed using FastStart Essential DNA Probes Master and gene-specific primers (Roche, Basel, Switzerland). Relative expression was calculated by the 2−ΔΔCt method using β-actin and GAPDH as housekeeping genes (primer sequences are available in the
Table S2) [
51].
2.8. siRNA Knockdown
Lipofectamine RNAiMAX reagent (Invitrogen, Carlsbad, CA, USA) was used to transfect small interfering RNA (siRNA; 4 different sequences for PLA2G7: siRNA 1 (SI00072198): CACCCTTTGGATCCCAAATAA, siRNA 2 (SI00072191): TCAGGACACTTTATTCTGCTA, siRNA 3 (SI00072184): TCCGTTGGTTGTACAGACTTA, siRNA 4 (SI00072177): AAGGACTCTATTGATAGGGAA; Qiagen Sciences, Germantown, MD, USA) into UWB1.289 cells. A scrambled negative control siRNA (Qiagen, Hilden, Germany) was used as a reference. UWB1.289 cells were seeded into 6-well plates, and the transfection was performed when cell density reached 60–70%. The cells were treated with Opti-MEM Reduced Serum Medium (Thermo Fisher Scientific, Waltham, MA, USA) containing siRNA-PLA2G7 and Lipofectamine RNAiMAX. After 36 h, cells were harvested and used for further experiments.
2.9. Western Blot
The Western blot analysis was performed as previously reported [
52]. In short, adherent cells were lysed for 15 min at 4 °C with 200 µL RIPA buffer (Sigma-Aldrich Co., St. Louis, MO, USA), containing a protease inhibitor (1:100 dilution; Sigma-Aldrich Co., St. Louis, MO, USA). The protein concentration of the lysates was determined with Bradford protein assay. Protein extracts (65 µg) were separated according to their molecular weight using 12% sodium dodecyl sulfate–polyacrylamide gel and transferred onto a polyvinylidene fluoride membrane (EMD Millipore, Billerica, MA, USA). The membrane was blocked for 1 h with casein (Vector Laboratories, Burlingame, CA, USA) to prevent nonspecific binding of the antibodies. After casein saturation, the membrane was incubated with diluted primary antibodies gently shaken overnight at 4 °C. As primary antibodies, a rabbit polyclonal antibody against PAF-AH (1:200 dilution; Cayman, Ann Arbor, MI, USA), a mouse monoclonal antibody against GAPDH (1:1000 dilution; GeneTex Co., Eching, Germany), and a mouse monoclonal antibody against β-actin (1:1000 dilution; Sigma, St. Louis, MO, USA) were used. GAPDH/β-actin Western blots served as controls. Afterwards, membranes were washed with 1:10 casein three times and subjected to biotinylated anti-mouse/anti-rabbit IgG secondary antibodies and ABC-AmP reagent (VECTASTAIN ABC-AmP Kit for rabbit IgG; Vector Laboratories, Burlingame, CA, USA). The antibody complexes were visualized with 5-bromo-4-chloro-3-indolylphosphate/nitroblue tetrazolium chromogenic substrate (Vectastain ABC-AmP Kit; Vector Laboratories, Burlingame, CA, USA). Western blotting detection and analysis was performed with Bio-Rad Universal Hood II and the corresponding software Quantity One (Bio-Rad Laboratories Inc., Hercules, CA, USA). Each Western blot experiment was validated nine times (
n = 9, three times in three lanes).
2.10. Cell Viability Assay and Proliferation Assay
3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) colorimetric assay was performed to measure the cell viability, while 5-bromo-2-deoxyuridine (BrdU) incorporation assay (Roche, Basel, Switzerland) was used to determine cell proliferation. For both assays, 5 × 103 UWB1.289 cells/100 µL were seeded on 96-well plates. The cells were incubated in RPMI 1640 GlutaMAX medium with 10% FBS for 48 h before transfection (PLA2G7 gene knockdown) was performed, as described above. After PLA2G7 36 h gene knockdown, MTT and BrdU assay were conducted according to manufacturer’s protocol. The optical density (OD) was measured with an Elx800 universal Microplate Reader (BioTek, Winooski, VT, USA) at 595 nm (MTT) and 450 nm (BrdU). Each experiment was validated three times (n = 3).
2.11. Wound Healing Assay
UWB1.289/HCC1937 cells were seeded on a 24-well plate (2 × 105 cells/mL). After 24 h, a vertical line was scratched into the middle of the monolayer with a 100 µL pipet tip to create an artificial wound. Subsequently, the transfection was performed, and digital images of the scratch assays were taken exactly 0 h and 36 h after PLA2G7 gene knockdown. The cell migration was monitored using an inverse phase contrast microscope (Leica Dmi1; Leica, Wetzlar, Germany) with a camera (LEICA MC120 HD; Leica, Wetzlar, Germany). Microphotographs of wounded areas and areas covered with cells were analyzed by ImageJ. Available online:
https://imagej.nih.gov/ij/ (accessed on 12 April 2020). The cell migration area is defined as the difference of the area covered with cells at 36 h and 0 h.
4. Discussion
In this study, PLA2G7/PAF-AH’s role in ovarian cancer and its influence on the Wnt signaling pathway has been evaluated. Besides cytoplasmatic pGSK3β (Y216) and membranous β-catenin (both part of the inactive state of the Wnt signaling pathway), high tumoral PAF-AH expression was associated with prolonged OS of EOC patients in univariate analysis (
Figure 1). A multivariate Cox regression model proved the independence of PAF-AH as a favorable prognostic factor (
Table 5). In vitro experiments confirmed protective functional effects of PAF-AH. Silencing of its gene PLA2G7 caused activation of viability, proliferation, and migration of BRCA1 mutant ovarian cancer cells (
Figure 5). Since the relevant gene and protein expression of PLA2G7/PAF-AH were detected exclusively in the BRCA1 mutant cell line UWB1.289 (
Figure 4), PAF-AH can be considered a new biomarker for BRCA1 mutant ovarian cancer, indicating good prognosis. Significantly higher PAF-AH levels were detected in tumor biopsies (
Figure 2) and in the serum of BRCA1 mutation carriers compared to BRCA WT patients (
Figure 3). An advantage of PAF-AH as a potential biomarker is the possibility of its non-invasive determination in blood samples before surgery. Since the blood analysis conducted in this study is somewhat preliminary, we suggest further investigation of PAF-AH as a biomarker with prediction ability in BRCA mutant ovarian cancer in a large-scale prospective clinical trial.
We further show that PAF-AH expression positively correlated with cytoplasmatic pGSK3β (Y216) and membranous β-catenin expression, which suggests an interaction with the Wnt/β-catenin signaling pathway. A changed distribution pattern of β-catenin within the cellular departments in BRCA mutant ovarian cancer cells caused by PLA2G7 gene knockdown confirmed this assumption. Membrane expression of β-catenin was reduced, while nuclear expression was upregulated (
Figure 6). Thus, increased activation of the Wnt signaling could be responsible for tumor progression under PLA2G7 knockdown. We assume that PAF/PTAFR and PLA2G7/PAF-AH might have a negative regulatory influence on the Wnt signaling pathway, especially in BRCA1 mutant EOC (
Figure 7) [
53].
Similarly, studies of Furihata et al. [
55] and Boccellino and Camussi et al. [
56] indicate a functional link between PAF/PTAFR and β-catenin. A PTAFR antagonist reduced inflammation-induced colon carcinogenesis in rats, and β-catenin was localized in the cell membrane in healthy tissue, while it was overexpressed in the nucleus in precursor lesions and colon cancer [
55]. Immunofluorescence analysis of Kaposi’s sarcoma cells also showed a change in β-catenin distribution from the membrane to a diffuse pattern as a reaction to PAF treatment [
56].
On the basis of our findings and evidence from literature, we can consider two explanatory approaches for the protective effects of PAF-AH: (1) Influence of PAF-AH on the Wnt signaling pathway by regulating PAF levels in the tumor microenvironment. (2) PAF independent regulatory effect of PAF-AH on Wnt downstream genes. Indeed, the anti-inflammatory properties of PAF-AH further contribute to its protective character [
57].
PAF induces various signaling pathways via its G-protein-coupled receptor PTAFR through the activation of phosphorylation cascades [
15,
58]. These phospholipid-mediated protein phosphorylation cascades often represent early responses to mitogenic induction [
59]. While PAF exposure activates, e.g., Src/FAK, FAK/STAT, and AKT, leading to enhanced proliferation, invasion, and migration, respectively (
Figure 8) [
15,
53,
60,
61], GSK3β is inactivated by phosphorylation at S9 [
53,
60]. β-Catenin is thereby stabilized and activates Wnt-responsive genes (
Figure 7).
Zhang et al. reported an elevated expression of PTAFR in BRCA1 mutant cell lines and tissue of BRCA1 mutation carriers. Additionally, they showed PAF/PTAFR-mediated malignant transition of BRCA1-mutated non-malignant ovarian epithelial cells by FAK/STAT phosphorylation, thereby inducing proliferation and anti-apoptosis [
61]. As we also found higher PAF-AH levels in BRCA1 mutation carriers and BRCA1 mutant ovarian cancer cells, we conclude that PAF-AH upregulation might be relevant to counteract PAF and Wnt signaling, respectively. By increased PAF degradation, GSK3β remains active, and β-catenin is marked for degradation, resulting in an inactive Wnt pathway (
Figure 7) [
39]. The same effect was observed for PTAFR antagonism [
61].
Direct modulation of the Wnt signaling pathway by the catalytic subunits of intracellular PAF-AH isoform IB was discovered by Livnat et al. in restricted areas of the cerebral cortex [
62]. In addition to PAF degradation, it is conceivable that the PAF-AH isoforms show other parallels on a regulatory level. In line with our results, Livnat et al. showed enhanced proliferation and tangential migration of GABAergic interneurons in PAF-AH knockout mice. Overexpression of each of the catalytic subunits provoked a shift of β-catenin from the nucleus to the cytoplasm and repressed Wnt gene expression [
62]. However, the molecular interaction between PAF-AH and β-catenin remains unclear and needs to be defined in future studies.
For breast cancer, an interplay between BRCA1 and the Wnt signaling pathway has been previously described. Wu et al. found an inverse correlative association between Wnt signaling and BRCA1 expression in basal-like breast cancer due to epigenetic repression of BRCA1 by the Wnt effector Slug [
40]. Li et al. reported that the nuclear form of β-catenin was lower or absent in most BRCA1 familial breast cancer tissues compared to sporadic breast cancer or healthy tissue [
8]. For BRCA1 WT, but not mutated BRCA1, direct interaction with β-catenin on the same binding site as the ubiquitinylating enzyme was described. Consequently, the half-life of β-catenin is prolonged, and the Wnt signaling pathway is active in the presence of BRCA1 WT [
8]. In BRCA mutant ovarian cancer, Wnt signaling might be repressed by PAF-AH. Nevertheless, we cannot exclude participations or crosstalk with other signaling pathways and regulatory factors resulting in the observed phenotypes.