Reproducible In Vitro Tissue Culture Model to Study Basic Mechanisms of Calcific Aortic Valve Disease: Comparative Analysis to Valvular Interstitials Cells
Abstract
1. Introduction
2. Material and Methods
2.1. Preparation of AV Leaflets and Application of In Vitro CAVD Model
2.2. Isolation and Culture of Primary Ovine VICs
2.3. In Vitro Degeneration
2.4. Optical Density Measurement
2.5. Alizarin Red S Calcium Staining of 2D VIC Cultures
2.6. Determination of Lactate Dehydrogenase, Alkaline Phosphatase, and Phosphate Levels in Supernatants
2.7. RNA Isolation and Semiquantitative Real-Time Polymerase Chain Reaction (qRT-PCR)
2.8. SDS-PAGE and Western Blot Analysis
2.9. Histological Staining
2.10. Immunohistochemistry
2.11. Statistical Analysis
3. Results
3.1. Degeneration of AV Leaflets Progresses over Time
3.2. Progressing Degeneration Leads to ECM Disruption
3.3. The Endothelial Cell Layer of AV Leaflets Is Disrupted under PD Conditions
3.4. Protein Expression
3.5. Gene Expression Is Altered in AV Leaflets Compared to VIC Cultures under PD Conditions
3.6. Inorganic-Phosphate-Induced, AP-Independent Degeneration
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Adams, H.S.L.; Ashokkumar, S.; Newcomb, A.; MacIsaac, A.I.; Whitbourn, R.J.; Palmer, S. Contemporary review of severe aortic stenosis. Intern. Med. J. 2019, 49, 297–305. [Google Scholar] [CrossRef] [Scilit]
- Lindman, B.R.; Clavel, M.A.; Mathieu, P.; Iung, B.; Lancellotti, P.; Otto, C.M.; Pibarot, P. Calcific aortic stenosis. Nat. Rev. Dis. Primers 2016, 2, 16006. [Google Scholar] [CrossRef] [Scilit]
- Perera, S.; Wijesinghe, N.; Ly, E.; Devlin, G.; Pasupati, S. Outcomes of patients with untreated severe aortic stenosis in real-world practice. N. Z. Med. J. 2011, 124, 40–48. [Google Scholar] [PubMed]
- Everett, R.J.; Clavel, M.A.; Pibarot, P.; Dweck, M.R. Timing of intervention in aortic stenosis: A review of current and future strategies. Heart 2018, 104, 2067–2076. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Marquis-Gravel, G.; Redfors, B.; Leon, M.B.; Genereux, P. Medical treatment of aortic stenosis. Circulation 2016, 134, 1766–1784. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dweck, M.R.; Boon, N.A.; Newby, D.E. Calcific aortic stenosis: A disease of the valve and the myocardium. J. Am. Coll. Cardiol. 2012, 60, 1854–1863. [Google Scholar] [CrossRef] [Scilit]
- Freeman, R.V.; Otto, C.M. Spectrum of calcific aortic valve disease: Pathogenesis, disease progression, and treatment strategies. Circulation 2005, 111, 3316–3326. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hulin, A.; Hego, A.; Lancellotti, P.; Oury, C. Advances in pathophysiology of calcific aortic valve disease propose novel molecular therapeutic targets. Front. Cardiovasc. Med. 2018, 5, 21. [Google Scholar] [CrossRef] [Scilit]
- Rajamannan, N.M.; Evans, F.J.; Aikawa, E.; Grande-Allen, K.J.; Demer, L.L.; Heistad, D.D.; Simmons, C.A.; Masters, K.S.; Mathieu, P.; O’Brien, K.D.; et al. Calcific aortic valve disease: Not simply a degenerative process: A review and agenda for research from the National Heart and Lung and Blood Institute Aortic Stenosis Working Group. Executive summary: Calcific aortic valve disease-2011 update. Circulation 2011, 124, 1783–1791. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yutzey, K.E.; Demer, L.L.; Body, S.C.; Huggins, G.S.; Towler, D.A.; Giachelli, C.M.; Hofmann-Bowman, M.A.; Mortlock, D.P.; Rogers, M.B.; Sadeghi, M.M.; et al. Calcific aortic valve disease: A consensus summary from the Alliance of Investigators on Calcific Aortic Valve Disease. Arterioscler. Thromb. Vasc. Biol. 2014, 34, 2387–2393. [Google Scholar] [CrossRef] [Scilit]
- Fondard, O.; Detaint, D.; Iung, B.; Choqueux, C.; Adle-Biassette, H.; Jarraya, M.; Hvass, U.; Couetil, J.P.; Henin, D.; Michel, J.B.; et al. Extracellular matrix remodelling in human aortic valve disease: The role of matrix metalloproteinases and their tissue inhibitors. Eur. Heart. J. 2005, 26, 1333–1341. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hutson, H.N.; Marohl, T.; Anderson, M.; Eliceiri, K.; Campagnola, P.; Masters, K.S. Calcific aortic valve disease is associated with layer-specific alterations in collagen architecture. PLoS ONE 2016, 11, e0163858. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hinton, R.B.; Yutzey, K.E. Heart valve structure and function in development and disease. Annu. Rev. Physiol. 2011, 73, 29–46. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, A.C.; Joag, V.R.; Gotlieb, A.I. The emerging role of valve interstitial cell phenotypes in regulating heart valve pathobiology. Am. J. Pathol. 2007, 171, 1407–1418. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rutkovskiy, A.; Malashicheva, A.; Sullivan, G.; Bogdanova, M.; Kostareva, A.; Stenslokken, K.O.; Fiane, A.; Vaage, J. Valve interstitial cells: The key to understanding the pathophysiology of heart valve calcification. J. Am. Heart Assoc. 2017, 6. [Google Scholar] [CrossRef] [Scilit]
- Rodriguez, K.J.; Piechura, L.M.; Masters, K.S. Regulation of valvular interstitial cell phenotype and function by hyaluronic acid in 2-D and 3-D culture environments. Matrix Biol. 2011, 30, 70–82. [Google Scholar] [CrossRef] [Scilit]
- Armstrong, E.J.; Bischoff, J. Heart valve development: Endothelial cell signaling and differentiation. Circ. Res. 2004, 95, 459–470. [Google Scholar] [CrossRef] [Scilit]
- Bosse, K.; Hans, C.P.; Zhao, N.; Koenig, S.N.; Huang, N.; Guggilam, A.; LaHaye, S.; Tao, G.; Lucchesi, P.A.; Lincoln, J.; et al. Endothelial nitric oxide signaling regulates Notch1 in aortic valve disease. J. Mol. Cell Cardiol. 2013, 60, 27–35. [Google Scholar] [CrossRef] [Scilit]
- Skowasch, D.; Schrempf, S.; Wernert, N.; Steinmetz, M.; Jabs, A.; Tuleta, I.; Welsch, U.; Preusse, C.J.; Likungu, J.A.; Welz, A.; et al. Cells of primarily extra-valvular origin in degenerative aortic valves and bioprostheses. Eur. Heart J. 2005, 26, 2576–2580. [Google Scholar] [CrossRef] [Scilit]
- Yu, W.; Liu, Z.; An, S.; Zhao, J.; Xiao, L.; Gou, Y.; Lin, Y.; Wang, J. The endothelial-mesenchymal transition (EndMT) and tissue regeneration. Curr. Stem Cell Res. Ther. 2014, 9, 196–204. [Google Scholar] [CrossRef] [Scilit]
- Farrar, E.J.; Butcher, J.T. Heterogeneous susceptibility of valve endothelial cells to mesenchymal transformation in response to TNFalpha. Ann. Biomed. Eng. 2014, 42, 149–161. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hjortnaes, J.; Shapero, K.; Goettsch, C.; Hutcheson, J.D.; Keegan, J.; Kluin, J.; Mayer, J.E.; Bischoff, J.; Aikawa, E. Valvular interstitial cells suppress calcification of valvular endothelial cells. Atherosclerosis 2015, 242, 251–260. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bowler, M.A.; Merryman, W.D. In vitro models of aortic valve calcification: Solidifying a system. Cardiovasc. Pathol. 2015, 24, 1–10. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cirka, H.A.; Uribe, J.; Liang, V.; Schoen, F.J.; Billiar, K.L. Reproducible in vitro model for dystrophic calcification of cardiac valvular interstitial cells: Insights into the mechanisms of calcific aortic valvular disease. Lab Chip 2017, 17, 814–829. [Google Scholar] [CrossRef] [Scilit]
- Kessel, S.; Cribbes, S.; Bonasu, S.; Rice, W.; Qiu, J.; Chan, L.L. Real-time viability and apoptosis kinetic detection method of 3D multicellular tumor spheroids using the Celigo Image Cytometer. Cytom. A 2017, 91, 883–892. [Google Scholar] [CrossRef] [Scilit]
- Duval, K.; Grover, H.; Han, L.H.; Mou, Y.; Pegoraro, A.F.; Fredberg, J.; Chen, Z. Modeling physiological events in 2D vs. 3D cell culture. Physiology 2017, 32, 266–277. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nehrenheim, L.; Raschke, S.; Stefanski, A.; Barth, M.; Isabel Selig, J.; Barbian, A.; Fernandez-Colino, A.; Stuhler, K.; Mela, P.; Albert, A.; et al. Native aortic valve derived extracellular matrix hydrogel for three dimensional culture analyses with improved biomimetic properties. Biomed. Mater. 2019, 14, 035014. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bogdanowicz, D.R.; Lu, H.H. Studying cell-cell communication in co-culture. Biotechnol. J. 2013, 8, 395–396. [Google Scholar] [CrossRef] [Scilit]
- Vadana, M.; Cecoltan, S.; Ciortan, L.; Macarie, R.D.; Tucureanu, M.M.; Mihaila, A.C.; Droc, I.; Butoi, E.; Manduteanu, I. Molecular mechanisms involved in high glucose-induced valve calcification in a 3D valve model with human valvular cells. J. Cell Mol. Med. 2020, 24, 6350–6361. [Google Scholar] [CrossRef] [Scilit]
- Ciortan, L.; Macarie, R.D.; Cecoltan, S.; Vadana, M.; Tucureanu, M.M.; Mihaila, A.C.; Droc, I.; Butoi, E.; Manduteanu, I. Chronic high glucose concentration induces inflammatory and remodeling changes in valvular endothelial cells and valvular interstitial cells in a gelatin methacrylate 3d model of the human aortic valve. Polymers 2020, 12, 2786. [Google Scholar] [CrossRef] [Scilit]
- Sider, K.L.; Blaser, M.C.; Simmons, C.A. Animal models of calcific aortic valve disease. Int. J. Inflamm. 2011, 2011, 364310. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Miller, J.D.; Weiss, R.M.; Heistad, D.D. Calcific aortic valve stenosis: Methods, models, and mechanisms. Circ. Res. 2011, 108, 1392–1412. [Google Scholar] [CrossRef] [Scilit]
- Weber, A.; Barth, M.; Selig, J.I.; Raschke, S.; Dakaras, K.; Hof, A.; Hesse, J.; Schrader, J.; Lichtenberg, A.; Akhyari, P. Enzymes of the purinergic signaling system exhibit diverse effects on the degeneration of valvular interstitial cells in a 3-D microenvironment. FASEB J. 2018, 32, 4356–4369. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Van der Ven, C.F.; Wu, P.J.; Tibbitt, M.W.; van Mil, A.; Sluijter, J.P.; Langer, R.; Aikawa, E. In vitro 3D model and miRNA drug delivery to target calcific aortic valve disease. Clin. Sci. 2017, 131, 181–195. [Google Scholar] [CrossRef] [Scilit]
- Sider, K.L.; Zhu, C.; Kwong, A.V.; Mirzaei, Z.; de Lange, C.F.; Simmons, C.A. Evaluation of a porcine model of early aortic valve sclerosis. Cardiovasc. Pathol. 2014, 23, 289–297. [Google Scholar] [CrossRef] [Scilit]
- Chen, J.H.; Simmons, C.A. Cell-matrix interactions in the pathobiology of calcific aortic valve disease: Critical roles for matricellular, matricrine, and matrix mechanics cues. Circ. Res. 2011, 108, 1510–1524. [Google Scholar] [CrossRef] [Scilit]
- Hinton, R.B., Jr.; Lincoln, J.; Deutsch, G.H.; Osinska, H.; Manning, P.B.; Benson, D.W.; Yutzey, K.E. Extracellular matrix remodeling and organization in developing and diseased aortic valves. Circ. Res. 2006, 98, 1431–1438. [Google Scholar] [CrossRef] [Scilit]
- Frantz, C.; Stewart, K.M.; Weaver, V.M. The extracellular matrix at a glance. J. Cell Sci. 2010, 123, 4195–4200. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gomez-Stallons, M.V.; Tretter, J.T.; Hassel, K.; Gonzalez-Ramos, O.; Amofa, D.; Ollberding, N.J.; Mazur, W.; Choo, J.K.; Smith, J.M.; Kereiakes, D.J.; et al. Calcification and extracellular matrix dysregulation in human postmortem and surgical aortic valves. Heart 2019, 105, 1616–1621. [Google Scholar] [CrossRef] [Scilit]
- Porras, A.M.; van Engeland, N.C.; Marchbanks, E.; McCormack, A.; Bouten, C.V.; Yacoub, M.H.; Latif, N.; Masters, K.S. Robust generation of quiescent porcine valvular interstitial cell cultures. J. Am. Heart Assoc. 2017, 6, e005041. [Google Scholar] [CrossRef] [Scilit]
- Kapalczynska, M.; Kolenda, T.; Przybyla, W.; Zajaczkowska, M.; Teresiak, A.; Filas, V.; Ibbs, M.; Blizniak, R.; Luczewski, L.; Lamperska, K. 2D and 3D cell cultures—A comparison of different types of cancer cell cultures. Arch. Med. Sci 2018, 14, 910–919. [Google Scholar]
- Fontoura, J.C.; Viezzer, C.; Dos Santos, F.G.; Ligabue, R.A.; Weinlich, R.; Puga, R.D.; Antonow, D.; Severino, P.; Bonorino, C. Comparison of 2D and 3D cell culture models for cell growth, gene expression and drug resistance. Mater. Sci. Eng. C Mater. Biol. Appl. 2020, 107, 110264. [Google Scholar] [CrossRef] [Scilit]
- Goto, S.; Rogers, M.A.; Blaser, M.C.; Higashi, H.; Lee, L.H.; Schlotter, F.; Body, S.C.; Aikawa, M.; Singh, S.A.; Aikawa, E. Standardization of human calcific aortic valve disease in vitro modeling reveals passage-dependent calcification. Front. Cardiovasc. Med. 2019, 6, 49. [Google Scholar] [CrossRef] [Scilit]
- Bogdanova, M.; Kostina, A.; Zihlavnikova Enayati, K.; Zabirnyk, A.; Malashicheva, A.; Stenslokken, K.O.; Sullivan, G.J.; Kaljusto, M.L.; Kvitting, J.P.; Kostareva, A.; et al. Inflammation and mechanical stress stimulate osteogenic differentiation of human aortic valve interstitial cells. Front. Physiol. 2018, 9, 1635. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schoppet, M.; Shanahan, C.M. Role for alkaline phosphatase as an inducer of vascular calcification in renal failure? Kidney Int. 2008, 73, 989–991. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, J.H.; Yip, C.Y.; Sone, E.D.; Simmons, C.A. Identification and characterization of aortic valve mesenchymal progenitor cells with robust osteogenic calcification potential. Am. J. Pathol. 2009, 174, 1109–1119. [Google Scholar] [CrossRef] [Scilit]
- Schlotter, F.; Halu, A.; Goto, S.; Blaser, M.C.; Body, S.C.; Lee, L.H.; Higashi, H.; DeLaughter, D.M.; Hutcheson, J.D.; Vyas, P.; et al. Spatiotemporal multi-omics mapping generates a molecular atlas of the aortic valve and reveals networks driving disease. Circulation 2018, 138, 377–393. [Google Scholar] [CrossRef] [Scilit]
- Bouchareb, R.; Mahmut, A.; Nsaibia, M.J.; Boulanger, M.C.; Dahou, A.; Lepine, J.L.; Laflamme, M.H.; Hadji, F.; Couture, C.; Trahan, S.; et al. Autotaxin derived from lipoprotein(a) and valve interstitial cells promotes inflammation and mineralization of the aortic valve. Circulation 2015, 132, 677–690. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rogers, M.A.; Maldonado, N.; Hutcheson, J.D.; Goettsch, C.; Goto, S.; Yamada, I.; Faits, T.; Sesaki, H.; Aikawa, M.; Aikawa, E. Dynamin-related protein 1 inhibition attenuates cardiovascular calcification in the presence of oxidative stress. Circ. Res. 2017, 121, 220–233. [Google Scholar] [CrossRef] [Scilit]
- Langhans, S.A. Three-dimensional in vitro cell culture models in drug discovery and drug repositioning. Front. Pharmacol. 2018, 9, 6. [Google Scholar] [CrossRef] [Scilit]
- Menon, V.; Lincoln, J. The genetic regulation of aortic valve development and calcific disease. Front. Cardiovasc. Med. 2018, 5, 162. [Google Scholar] [CrossRef] [Scilit]
- Mazzone, A.; Epistolato, M.C.; De Caterina, R.; Storti, S.; Vittorini, S.; Sbrana, S.; Gianetti, J.; Bevilacqua, S.; Glauber, M.; Biagini, A.; et al. Neoangiogenesis, T-lymphocyte infiltration, and heat shock protein-60 are biological hallmarks of an immunomediated inflammatory process in end-stage calcified aortic valve stenosis. J. Am. Coll. Cardiol. 2004, 43, 1670–1676. [Google Scholar] [CrossRef] [Scilit]
- Kook, Y.M.; Jeong, Y.; Lee, K.; Koh, W.G. Design of biomimetic cellular scaffolds for co-culture system and their application. J. Tissue Eng. 2017, 8, 2041731417724640. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Butcher, J.T.; Nerem, R.M. Valvular endothelial cells regulate the phenotype of interstitial cells in co-culture: Effects of steady shear stress. Tissue Eng. 2006, 12, 905–915. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hortells, L.; Sur, S.; St Hilaire, C. Cell phenotype transitions in cardiovascular calcification. Front. Cardiovasc. Med. 2018, 5, 27. [Google Scholar] [CrossRef] [Scilit]
- Dahal, S.; Huang, P.; Murray, B.T.; Mahler, G.J. Endothelial to mesenchymal transformation is induced by altered extracellular matrix in aortic valve endothelial cells. J. Biomed. Mater. Res. A 2017, 105, 2729–2741. [Google Scholar] [CrossRef] [Scilit]
- Lin, F.; Wang, N.; Zhang, T.C. The role of endothelial-mesenchymal transition in development and pathological process. IUBMB Life 2012, 64, 717–723. [Google Scholar] [CrossRef] [Scilit] [PubMed]






| Gene | Forward Sequences (5′–3′) | Reverse Sequences (5′–3′) |
|---|---|---|
| RPL-29A | CCAAGTCCAAGAACCACACC | TATCGTTGTGATCGGGGTTT |
| ACTA2 | TAGAACACGGCATCATCACC | TGAGAAGGGTTGGATGCTCT |
| COL1A1 | AAGACATCCCACCAGTCACC | TAAGTTCGTCGCAGATCACG |
| COL3A1 | GACATAGAGGCTTTGATGGACGA | CACTTCCTCGAGCTCCATCG |
| COL5A1 | CGAGAACCCGGATGAGAACC | GGCCTCCGATCCCTTCATAGA |
| VIM | GACCTGGAGCGTAAAGTGGA | CTCTTGAATCTGGGCCTGAA |
| TGF-β | GAGCCAGAGGCGGACTACTA | TCGGACGTGTTGAAGAACAT |
| OPN | GATGGCCGAGGTGATAGTGT | TCGTCTTCTTAGGTGCGTCA |
| OPG | GCGTGTGTGAATGTGAGGAG | CGAGAAGAACCCATCTGGAC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Weber, A.; Pfaff, M.; Schöttler, F.; Schmidt, V.; Lichtenberg, A.; Akhyari, P. Reproducible In Vitro Tissue Culture Model to Study Basic Mechanisms of Calcific Aortic Valve Disease: Comparative Analysis to Valvular Interstitials Cells. Biomedicines 2021, 9, 474. https://doi.org/10.3390/biomedicines9050474
Weber A, Pfaff M, Schöttler F, Schmidt V, Lichtenberg A, Akhyari P. Reproducible In Vitro Tissue Culture Model to Study Basic Mechanisms of Calcific Aortic Valve Disease: Comparative Analysis to Valvular Interstitials Cells. Biomedicines. 2021; 9(5):474. https://doi.org/10.3390/biomedicines9050474
Chicago/Turabian StyleWeber, Andreas, Melissa Pfaff, Friederike Schöttler, Vera Schmidt, Artur Lichtenberg, and Payam Akhyari. 2021. "Reproducible In Vitro Tissue Culture Model to Study Basic Mechanisms of Calcific Aortic Valve Disease: Comparative Analysis to Valvular Interstitials Cells" Biomedicines 9, no. 5: 474. https://doi.org/10.3390/biomedicines9050474
APA StyleWeber, A., Pfaff, M., Schöttler, F., Schmidt, V., Lichtenberg, A., & Akhyari, P. (2021). Reproducible In Vitro Tissue Culture Model to Study Basic Mechanisms of Calcific Aortic Valve Disease: Comparative Analysis to Valvular Interstitials Cells. Biomedicines, 9(5), 474. https://doi.org/10.3390/biomedicines9050474

