8-Hydroxydaidzein Downregulates JAK/STAT, MMP, Oxidative Phosphorylation, and PI3K/AKT Pathways in K562 Cells
Abstract
1. Introduction
2. Experimental Section
2.1. Preparation of 8-OHD (8-Hydroxydaidzein, 7,8,4′-Trihydoxyisoflavone, NSC-678112)
2.2. Cell Culture
2.3. Microarray Analysis
2.4. Pathway Enrichment Analysis
2.5. Western Blot Analysis
2.6. RNA Extraction and Reverse Transcription-Quantitative Polymerase Chain Reaction (RT-qPCR)
2.7. Gelatin Zymography
2.8. Transwell Cell Invasion Assay
2.9. Statistical Analysis
3. Results and Discussion
3.1. Analysis of Microarray Data and Determination of DEGs
3.2. Enrichment of Downregulated Signaling Pathways Using MetaCore
3.3. 8-OHD Repressed MMPs Expression and Activities
3.4. 8-OHD Repressed OXPHOS
3.5. PI3K/AKT Pathway Is Resposible for K562 Cell Cycle Arrest
3.6. AKT and MYC Are Hub Proteins Downregulated by 8-OHD
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Rowley, J.D. Letter: A new consistent chromosomal abnormality in chronic myelogenous leukaemia identified by quinacrine fluorescence and Giemsa staining. Nature 1973, 243, 290–293. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jabbour, E.; Cortes, J.E.; Giles, F.J.; O’Brien, S.; Kantarjian, H.M. Current and emerging treatment options in chronic myeloid leukemia. Cancer 2007, 109, 2171–2181. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ali, M.A. Chronic Myeloid Leukemia in the Era of Tyrosine Kinase Inhibitors: An Evolving Paradigm of Molecularly Targeted Therapy. Mol. Diagn. Ther. 2016, 20, 315–333. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Massimino, M.; Stella, S.; Tirro, E.; Romano, C.; Pennisi, M.S.; Puma, A.; Manzella, L.; Zanghi, A.; Stagno, F.; Di Raimondo, F.; et al. Non ABL-directed inhibitors as alternative treatment strategies for chronic myeloid leukemia. Mol. Cancer 2018, 17, 56. [Google Scholar] [CrossRef] [Scilit]
- Cortes, J.; Lang, F. Third-line therapy for chronic myeloid leukemia: Current status and future directions. J. Hematol. Oncol. 2021, 14, 44. [Google Scholar] [CrossRef] [Scilit]
- Wingelhofer, B.; Neubauer, H.A.; Valent, P.; Han, X.; Constantinescu, S.N.; Gunning, P.T.; Muller, M.; Moriggl, R. Implications of STAT3 and STAT5 signaling on gene regulation and chromatin remodeling in hematopoietic cancer. Leukemia 2018, 32, 1713–1726. [Google Scholar] [CrossRef] [Scilit]
- Samanta, A.; Perazzona, B.; Chakraborty, S.; Sun, X.; Modi, H.; Bhatia, R.; Priebe, W.; Arlinghaus, R. Janus kinase 2 regulates Bcr-Abl signaling in chronic myeloid leukemia. Leukemia 2011, 25, 463–472. [Google Scholar] [CrossRef] [Scilit]
- Dorritie, K.A.; McCubrey, J.A.; Johnson, D.E. STAT transcription factors in hematopoiesis and leukemogenesis: Opportunities for therapeutic intervention. Leukemia 2014, 28, 248–257. [Google Scholar] [CrossRef] [Scilit]
- Zou, S.; Tong, Q.; Liu, B.; Huang, W.; Tian, Y.; Fu, X. Targeting STAT3 in Cancer Immunotherapy. Mol. Cancer 2020, 19, 145. [Google Scholar] [CrossRef] [Scilit]
- Sweet, K.; Hazlehurst, L.; Sahakian, E.; Powers, J.; Nodzon, L.; Kayali, F.; Hyland, K.; Nelson, A.; Pinilla-Ibarz, J. A phase I clinical trial of ruxolitinib in combination with nilotinib in chronic myeloid leukemia patients with molecular evidence of disease. Leuk. Res. 2018, 74, 89–96. [Google Scholar] [CrossRef] [Scilit]
- Gialeli, C.; Theocharis, A.D.; Karamanos, N.K. Roles of matrix metalloproteinases in cancer progression and their pharmacological targeting. FEBS J. 2011, 278, 16–27. [Google Scholar] [CrossRef] [Scilit]
- Fields, G.B. The Rebirth of Matrix Metalloproteinase Inhibitors: Moving Beyond the Dogma. Cells 2019, 8, 984. [Google Scholar] [CrossRef] [Scilit]
- Warburg, O. On the origin of cancer cells. Science 1956, 123, 309–314. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ashton, T.M.; McKenna, W.G.; Kunz-Schughart, L.A.; Higgins, G.S. Oxidative Phosphorylation as an Emerging Target in Cancer Therapy. Clin. Cancer Res. 2018, 24, 2482–2490. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Song, B.H.; Son, S.Y.; Kim, H.K.; Ha, T.W.; Im, J.S.; Ryu, A.; Jeon, H.; Chung, H.Y.; Oh, J.S.; Lee, C.H.; et al. Profiling of Metabolic Differences between Hematopoietic Stem Cells and Acute/Chronic Myeloid Leukemia. Metabolites 2020, 10, 427. [Google Scholar] [CrossRef] [Scilit]
- De Beauchamp, L.; Himonas, E.; Helgason, G.V. Mitochondrial metabolism as a potential therapeutic target in myeloid leukaemia. Leukemia 2021. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, C.; Youle, R.J. The role of mitochondria in apoptosis *. Ann. Rev. Genet. 2009, 43, 95–118. [Google Scholar] [CrossRef] [Scilit]
- Maiti, A.; Franquiz, M.J.; Ravandi, F.; Cortes, J.E.; Jabbour, E.J.; Sasaki, K.; Marx, K.; Daver, N.G.; Kadia, T.M.; Konopleva, M.Y.; et al. Venetoclax and BCR-ABL Tyrosine Kinase Inhibitor Combinations: Outcome in Patients with Philadelphia Chromosome-Positive Advanced Myeloid Leukemias. Acta Haematol. 2020, 143, 567–573. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pollyea, D.A.; Amaya, M.; Strati, P.; Konopleva, M.Y. Venetoclax for AML: Changing the treatment paradigm. Blood Adv. 2019, 3, 4326–4335. [Google Scholar] [CrossRef] [Scilit]
- Martelli, A.M.; Evangelisti, C.; Chappell, W.; Abrams, S.L.; Basecke, J.; Stivala, F.; Donia, M.; Fagone, P.; Nicoletti, F.; Libra, M.; et al. Targeting the translational apparatus to improve leukemia therapy: Roles of the PI3K/PTEN/Akt/mTOR pathway. Leukemia 2011, 25, 1064–1079. [Google Scholar] [CrossRef] [Scilit]
- Bibi, S.; Arslanhan, M.D.; Langenfeld, F.; Jeanningros, S.; Cerny-Reiterer, S.; Hadzijusufovic, E.; Tchertanov, L.; Moriggl, R.; Valent, P.; Arock, M. Co-operating STAT5 and AKT signaling pathways in chronic myeloid leukemia and mastocytosis: Possible new targets of therapy. Haematologica 2014, 99, 417–429. [Google Scholar] [CrossRef] [Scilit]
- Xin, P.; Li, C.; Zheng, Y.; Peng, Q.; Xiao, H.; Huang, Y.; Zhu, X. Efficacy of the dual PI3K and mTOR inhibitor NVP-BEZ235 in combination with imatinib mesylate against chronic myelogenous leukemia cell lines. Drug Des. Dev. Ther. 2017, 11, 1115–1126. [Google Scholar] [CrossRef] [Scilit]
- Sanchez-Arevalo Lobo, V.J.; Doni, M.; Verrecchia, A.; Sanulli, S.; Faga, G.; Piontini, A.; Bianchi, M.; Conacci-Sorrell, M.; Mazzarol, G.; Peg, V.; et al. Dual regulation of Myc by Abl. Oncogene 2013, 32, 5261–5271. [Google Scholar] [CrossRef] [Scilit]
- Reavie, L.; Buckley, S.M.; Loizou, E.; Takeishi, S.; Aranda-Orgilles, B.; Ndiaye-Lobry, D.; Abdel-Wahab, O.; Ibrahim, S.; Nakayama, K.I.; Aifantis, I. Regulation of c-Myc ubiquitination controls chronic myelogenous leukemia initiation and progression. Cancer Cell 2013, 23, 362–375. [Google Scholar] [CrossRef] [Scilit]
- Ahmadi, S.E.; Rahimi, S.; Zarandi, B.; Chegeni, R.; Safa, M. MYC: A multipurpose oncogene with prognostic and therapeutic implications in blood malignancies. J. Hematol. Oncol. 2021, 14, 121. [Google Scholar] [CrossRef] [Scilit]
- Albajar, M.; Gomez-Casares, M.T.; Llorca, J.; Mauleon, I.; Vaque, J.P.; Acosta, J.C.; Bermudez, A.; Donato, N.; Delgado, M.D.; Leon, J. MYC in chronic myeloid leukemia: Induction of aberrant DNA synthesis and association with poor response to imatinib. Mol. Cancer Res. 2011, 9, 564–576. [Google Scholar] [CrossRef] [Scilit]
- Tsao, R. Chemistry and biochemistry of dietary polyphenols. Nutrients 2010, 2, 1231–1246. [Google Scholar] [CrossRef] [Scilit]
- Wang, Q.; Ge, X.; Tian, X.; Zhang, Y.; Zhang, J.; Zhang, P. Soy isoflavone: The multipurpose phytochemical (Review). Biomed. Rep. 2013, 1, 697–701. [Google Scholar] [CrossRef] [Scilit]
- Mann, G.E.; Bonacasa, B.; Ishii, T.; Siow, R.C. Targeting the redox sensitive Nrf2-Keap1 defense pathway in cardiovascular disease: Protection afforded by dietary isoflavones. Curr. Opin. Pharmacol. 2009, 9, 139–145. [Google Scholar] [CrossRef] [Scilit]
- Vitale, D.C.; Piazza, C.; Melilli, B.; Drago, F.; Salomone, S. Isoflavones: Estrogenic activity, biological effect and bioavailability. Eur. J. Drug Metab. Pharmacokinet. 2013, 38, 15–25. [Google Scholar] [CrossRef] [Scilit]
- Yamagata, K.; Yamori, Y. Potential Effects of Soy Isoflavones on the Prevention of Metabolic Syndrome. Molecules 2021, 26, 5863. [Google Scholar] [CrossRef] [Scilit]
- Chang, T.S. Isolation, bioactivity, and production of ortho-hydroxydaidzein and ortho-hydroxygenistein. Int. J. Mol. Sci. 2014, 15, 5699–5716. [Google Scholar] [CrossRef] [Scilit]
- Esaki, H.; Onozaki, H.; Morimitsu, Y.; Kawakishi, S.; Osawa, T. Potent Antioxidative Isoflavones Isolated from Soybeans Fermented with Aspergillus saitoi. Biosci. Biotechnol. Biochem. 1998, 62, 740–746. [Google Scholar] [CrossRef] [Scilit]
- Fujita, T.; Funako, T.; Hayashi, H. 8-Hydroxydaidzein, an aldose reductase inhibitor from okara fermented with Aspergillus sp. HK-388. Biosci. Biotechnol. Biochem. 2004, 68, 1588–1590. [Google Scholar] [CrossRef] [Scilit]
- Park, J.S.; Park, H.Y.; Kim, D.H.; Kim, D.H.; Kim, H.K. ortho-dihydroxyisoflavone derivatives from aged Doenjang (Korean fermented soypaste) and its radical scavenging activity. Bioorg. Med. Chem. Lett. 2008, 18, 5006–5009. [Google Scholar] [CrossRef] [Scilit]
- Park, J.S.; Kim, D.H.; Lee, J.K.; Lee, J.Y.; Kim, D.H.; Kim, H.K.; Lee, H.J.; Kim, H.C. Natural ortho-dihydroxyisoflavone derivatives from aged Korean fermented soybean paste as potent tyrosinase and melanin formation inhibitors. Bioorg. Med. Chem. Lett. 2010, 20, 1162–1164. [Google Scholar] [CrossRef] [Scilit]
- Wu, P.S.; Ding, H.Y.; Yen, J.H.; Chen, S.F.; Lee, K.H.; Wu, M.J. Anti-inflammatory Activity of 8-Hydroxydaidzein in LPS-Stimulated BV2 Microglial Cells via Activation of Nrf2-Antioxidant and Attenuation of Akt/NF-kappaB-Inflammatory Signaling Pathways, as Well As Inhibition of COX-2 Activity. J. Agric. Food Chem. 2018, 66, 5790–5801. [Google Scholar] [CrossRef] [Scilit]
- Hirota, A.; Taki, S.; Kawaii, S.; Yano, M.; Abe, N. 1,1-Diphenyl-2-picrylhydrazyl radical-scavenging compounds from soybean miso and antiproliferative activity of isoflavones from soybean miso toward the cancer cell lines. Biosci. Biotechnol. Biochem. 2000, 64, 1038–1040. [Google Scholar] [CrossRef] [Scilit]
- Wu, P.-S.; Yen, J.-H.; Wang, C.-Y.; Chen, P.-Y.; Hung, J.-H.; Wu, M.-J. 8-Hydroxydaidzein, an Isoflavone from Fermented Soybean, Induces Autophagy, Apoptosis, Differentiation, and Degradation of Oncoprotein BCR-ABL in K562 Cells. Biomedicines 2020, 8, 506. [Google Scholar] [CrossRef] [Scilit]
- Calabrese, E.J.; Mattson, M.P. How does hormesis impact biology, toxicology, and medicine? NPJ Aging Mech. Dis. 2017, 3, 13. [Google Scholar] [CrossRef] [Scilit]
- Thorat, M.A.; Balasubramanian, R. Breast cancer prevention in high-risk women. Best Pract. Res. Clin. Obstet. Gynaecol. 2020, 65, 18–31. [Google Scholar] [CrossRef] [Scilit]
- Lin, C.Y.; Lee, C.H.; Chuang, Y.H.; Lee, J.Y.; Chiu, Y.Y.; Wu Lee, Y.H.; Jong, Y.J.; Hwang, J.K.; Huang, S.H.; Chen, L.C.; et al. Membrane protein-regulated networks across human cancers. Nat. Commun. 2019, 10, 3131. [Google Scholar] [CrossRef] [Scilit]
- Tsai, H.T.; Huang, C.S.; Tu, C.C.; Liu, C.Y.; Huang, C.J.; Ho, Y.S.; Tu, S.H.; Tseng, L.M.; Huang, C.C. Multi-gene signature of microcalcification and risk prediction among Taiwanese breast cancer. Sci. Rep. 2020, 10, 18276. [Google Scholar] [CrossRef] [Scilit]
- Nguyen, H.D.; Liao, Y.C.; Ho, Y.S.; Chen, L.C.; Chang, H.W.; Cheng, T.C.; Liu, D.; Lee, W.R.; Shen, S.C.; Wu, C.H.; et al. The α9 Nicotinic Acetylcholine Receptor Mediates Nicotine-Induced PD-L1 Expression and Regulates Melanoma Cell Proliferation and Migration. Cancers 2019, 11, 1991. [Google Scholar] [CrossRef] [Scilit]
- Lee, K.L.; Kuo, Y.C.; Ho, Y.S.; Huang, Y.H. Triple-Negative Breast Cancer: Current Understanding and Future Therapeutic Breakthrough Targeting Cancer Stemness. Cancers 2019, 11, 1334. [Google Scholar] [CrossRef] [Scilit]
- Lozzio, C.B.; Lozzio, B.B. Human chronic myelogenous leukemia cell-line with positive Philadelphia chromosome. Blood 1975, 45, 321–334. [Google Scholar] [CrossRef] [Scilit]
- The Gene Ontology Consortium. The Gene Ontology Resource: 20 years and still GOing strong. Nucleic Acids Res. 2019, 47, D330–D338. [Google Scholar] [CrossRef] [Scilit]
- Nishimura, D. BioCarta. Biotech Softw. Internet Rep. 2001, 2, 117–120. [Google Scholar] [CrossRef] [Scilit]
- Kanehisa, M.; Goto, S. KEGG: Kyoto encyclopedia of genes and genomes. Nucleic Acids Res. 2000, 28, 27–30. [Google Scholar] [CrossRef] [Scilit]
- Chen, P.Y.; Chen, Y.T.; Gao, W.Y.; Wu, M.J.; Yen, J.H. Nobiletin Down-Regulates c-KIT Gene Expression and Exerts Antileukemic Effects on Human Acute Myeloid Leukemia Cells. J. Agric. Food Chem. 2018, 66, 13423–13434. [Google Scholar] [CrossRef] [Scilit]
- Wang, C.-C.; Lin, Y.-C.; Cheng, Y.-H.; Tung, C.-W. Profiling transcriptomes of human SH-SY5Y neuroblastoma cells exposed to maleic acid. PeerJ 2017, 5, e3175. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Barrett, T.; Wilhite, S.E.; Ledoux, P.; Evangelista, C.; Kim, I.F.; Tomashevsky, M.; Marshall, K.A.; Phillippy, K.H.; Sherman, P.M.; Holko, M.; et al. NCBI GEO: Archive for functional genomics data sets—Update. Nucleic Acids Res 2013, 41, D991–D995. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lin, J.C.; Liu, T.P.; Yang, P.M. CDKN2A-Inactivated Pancreatic Ductal Adenocarcinoma Exhibits Therapeutic Sensitivity to Paclitaxel: A Bioinformatics Study. J. Clin. Med. 2020, 9, 4019. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lin, T.Y.; Wang, P.W.; Huang, C.H.; Yang, P.M.; Pan, T.L. Characterizing the Relapse Potential in Different Luminal Subtypes of Breast Cancers with Functional Proteomics. Int. J. Mol. Sci. 2020, 21, 6077. [Google Scholar] [CrossRef] [Scilit]
- Liu, L.W.; Hsieh, Y.Y.; Yang, P.M. Bioinformatics Data Mining Repurposes the JAK2 (Janus Kinase 2) Inhibitor Fedratinib for Treating Pancreatic Ductal Adenocarcinoma by Reversing the KRAS (Kirsten Rat Sarcoma 2 Viral Oncogene Homolog)-Driven Gene Signature. J. Pers. Med. 2020, 10, 130. [Google Scholar] [CrossRef] [Scilit]
- Yang, P.M.; Hsieh, Y.Y.; Du, J.L.; Yen, S.C.; Hung, C.F. Sequential Interferon β-Cisplatin Treatment Enhances the Surface Exposure of Calreticulin in Cancer Cells via an Interferon Regulatory Factor 1-Dependent Manner. Biomolecules 2020, 10, 643. [Google Scholar] [CrossRef] [Scilit]
- Yang, P.M.; Lin, L.S.; Liu, T.P. Sorafenib Inhibits Ribonucleotide Reductase Regulatory Subunit M2 (RRM2) in Hepatocellular Carcinoma Cells. Biomolecules 2020, 10, 117. [Google Scholar] [CrossRef] [Scilit]
- Huang, D.W.; Sherman, B.T.; Lempicki, R.A. Bioinformatics enrichment tools: Paths toward the comprehensive functional analysis of large gene lists. Nucleic Acids Res. 2009, 37, 1–13. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kao, T.J.; Wu, C.C.; Phan, N.N.; Liu, Y.H.; Ta, H.D.K.; Anuraga, G.; Wu, Y.F.; Lee, K.H.; Chuang, J.Y.; Wang, C.Y. Prognoses and genomic analyses of proteasome 26S subunit, ATPase (PSMC) family genes in clinical breast cancer. Aging 2021, 13, 17970. [Google Scholar] [CrossRef] [Scilit]
- Anuraga, G.; Tang, W.C.; Phan, N.N.; Ta, H.D.K.; Liu, Y.H.; Wu, Y.F.; Lee, K.H.; Wang, C.Y. Comprehensive Analysis of Prognostic and Genetic Signatures for General Transcription Factor III (GTF3) in Clinical Colorectal Cancer Patients Using Bioinformatics Approaches. Curr. Issues Mol. Biol. 2021, 43. [Google Scholar] [CrossRef] [Scilit]
- Khoa Ta, H.D.; Tang, W.C.; Phan, N.N.; Anuraga, G.; Hou, S.Y.; Chiao, C.C.; Liu, Y.H.; Wu, Y.F.; Lee, K.H.; Wang, C.Y. Analysis of LAGEs Family Gene Signature and Prognostic Relevance in Breast Cancer. Diagnostics 2021, 11, 726. [Google Scholar] [CrossRef] [Scilit]
- Pinero, J.; Ramirez-Anguita, J.M.; Sauch-Pitarch, J.; Ronzano, F.; Centeno, E.; Sanz, F.; Furlong, L.I. The DisGeNET knowledge platform for disease genomics: 2019 update. Nucleic Acids Res. 2020, 48, D845–D855. [Google Scholar] [CrossRef] [Scilit]
- Szklarczyk, D.; Gable, A.L.; Lyon, D.; Junge, A.; Wyder, S.; Huerta-Cepas, J.; Simonovic, M.; Doncheva, N.T.; Morris, J.H.; Bork, P.; et al. STRING v11: Protein-protein association networks with increased coverage, supporting functional discovery in genome-wide experimental datasets. Nucleic Acids Res. 2019, 47, D607–D613. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Enright, A.J.; Van Dongen, S.; Ouzounis, C.A. An efficient algorithm for large-scale detection of protein families. Nucleic Acids Res. 2002, 30, 1575–1584. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ovcharenko, A.; Granot, G.; Rokah, O.H.; Park, J.; Shpilberg, O.; Raanani, P. Enhanced adhesion/migration and induction of Pyk2 expression in K562 cells following imatinib exposure. Leuk. Res. 2013, 37, 1729–1736. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, J.; Lu, H.; Huang, R.; Lin, D.; Wu, X.; Lin, Q.; Wu, X.; Zheng, J.; Pan, X.; Peng, J.; et al. Peroxisome proliferator activated receptor-gamma ligands induced cell growth inhibition and its influence on matrix metalloproteinase activity in human myeloid leukemia cells. Cancer Chemother. Pharmacol. 2005, 56, 400–408. [Google Scholar] [CrossRef] [Scilit]
- Lever, J.; Krzywinski, M.; Altman, N. Principal component analysis. Nat. Methods 2017, 14, 641–642. [Google Scholar] [CrossRef] [Scilit]
- Luo, N.; Balko, J.M. Role of JAK-STAT Pathway in Cancer Signaling. In Predictive Biomarkers in Oncology: Applications in Precision Medicine; Badve, S., Kumar, G.L., Eds.; Springer International Publishing: Cham, Switzerland, 2019; pp. 311–319. [Google Scholar] [CrossRef] [Scilit]
- Brachet-Botineau, M.; Polomski, M.; Neubauer, H.A.; Juen, L.; Hedou, D.; Viaud-Massuard, M.C.; Prie, G.; Gouilleux, F. Pharmacological Inhibition of Oncogenic STAT3 and STAT5 Signaling in Hematopoietic Cancers. Cancers 2020, 12, 240. [Google Scholar] [CrossRef] [Scilit]
- Chong, P.S.Y.; Chng, W.-J.; de Mel, S. STAT3: A Promising Therapeutic Target in Multiple Myeloma. Cancers 2019, 11, 731. [Google Scholar] [CrossRef] [Scilit]
- Humphreys, D.; ElGhazaly, M.; Frisan, T. Senescence and Host–Pathogen Interactions. Cells 2020, 9, 1747. [Google Scholar] [CrossRef] [Scilit]
- Caruso, A.; Barbarossa, A.; Carocci, A.; Salzano, G.; Sinicropi, M.S.; Saturnino, C. Carbazole Derivatives as STAT Inhibitors: An Overview. Appl. Sci. 2021, 11, 6192. [Google Scholar] [CrossRef] [Scilit]
- Rajabi, S.; Shojaee, M.; Malmir, A.; Rezaei Tavirani, M.; Noori, S. Anti-Breast Cancer Activities of 8-Hydroxydaidzein by Targeting Breast Cancer Stem-Like Cells. J. Pharm. Pharm. Sci. 2020, 23, 47–57. [Google Scholar] [CrossRef] [Scilit]
- Bewry, N.N.; Nair, R.R.; Emmons, M.F.; Boulware, D.; Pinilla-Ibarz, J.; Hazlehurst, L.A. Stat3 contributes to resistance toward BCR-ABL inhibitors in a bone marrow microenvironment model of drug resistance. Mol. Cancer Ther. 2008, 7, 3169–3175. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Patel, S.B.; Nemkov, T.; Stefanoni, D.; Benavides, G.A.; Bassal, M.A.; Crown, B.L.; Matkins, V.R.; Camacho, V.; Kuznetsova, V.; Hoang, A.T.; et al. Metabolic alterations mediated by STAT3 promotes drug persistence in CML. Leukemia 2021, 35, 3371–3382. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Janowska-Wieczorek, A.; Majka, M.; Marquez-Curtis, L.; Wertheim, J.A.; Turner, A.R.; Ratajczak, M.Z. Bcr-abl-positive cells secrete angiogenic factors including matrix metalloproteinases and stimulate angiogenesis in vivo in Matrigel implants. Leukemia 2002, 16, 1160–1166. [Google Scholar] [CrossRef] [Scilit]
- Turunen, S.P.; Tatti-Bugaeva, O.; Lehti, K. Membrane-type matrix metalloproteases as diverse effectors of cancer progression. Biochim. Biophys. Acta Mol. Cell Res. 2017, 1864, 1974–1988. [Google Scholar] [CrossRef] [Scilit]
- Sun, X.; Li, Y.; Yu, W.; Wang, B.; Tao, Y.; Dai, Z. MT1-MMP as a downstream target of BCR-ABL/ABL interactor 1 signaling: Polarized distribution and involvement in BCR-ABL-stimulated leukemic cell migration. Leukemia 2008, 22, 1053–1056. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, Y.; Pan, S.; Leng, J.; Xie, T.; Jamal, M.; Yin, Q.; Li, J.; He, C.; Dong, X.; Shao, L.; et al. The prognostic value of matrix metalloproteinase-7 and matrix metalloproteinase-15 in acute myeloid leukemia. J. Cell. Biochem. 2019, 120, 10613–10624. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lakkireddy, S.; Aula, S.; Kapley, A.; Swamy, A.V.; Digumarti, R.R.; Kutala, V.K.; Jamil, K. Association of Vascular Endothelial Growth Factor A (VEGFA) and its Receptor (VEGFR2) Gene Polymorphisms with Risk of Chronic Myeloid Leukemia and Influence on Clinical Outcome. Mol. Diagn. Ther. 2016, 20, 33–44. [Google Scholar] [CrossRef] [Scilit]
- Ebos, J.M.; Tran, J.; Master, Z.; Dumont, D.; Melo, J.V.; Buchdunger, E.; Kerbel, R.S. Imatinib mesylate (STI-571) reduces Bcr-Abl-mediated vascular endothelial growth factor secretion in chronic myelogenous leukemia. Mol. Cancer Res. 2002, 1, 89–95. [Google Scholar]
- Legros, L.; Bourcier, C.; Jacquel, A.; Mahon, F.X.; Cassuto, J.P.; Auberger, P.; Pages, G. Imatinib mesylate (STI571) decreases the vascular endothelial growth factor plasma concentration in patients with chronic myeloid leukemia. Blood 2004, 104, 495–501. [Google Scholar] [CrossRef] [Scilit]
- Downward, J. Targeting RAS signalling pathways in cancer therapy. Nat. Rev. Cancer 2003, 3, 11–22. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gerboth, S.; Frittoli, E.; Palamidessi, A.; Baltanas, F.C.; Salek, M.; Rappsilber, J.; Giuliani, C.; Troglio, F.; Rolland, Y.; Pruneri, G.; et al. Phosphorylation of SOS1 on tyrosine 1196 promotes its RAC GEF activity and contributes to BCR-ABL leukemogenesis. Leukemia 2018, 32, 820–827. [Google Scholar] [CrossRef] [Scilit]
- Wang, T.; Birsoy, K.; Hughes, N.W.; Krupczak, K.M.; Post, Y.; Wei, J.J.; Lander, E.S.; Sabatini, D.M. Identification and characterization of essential genes in the human genome. Science 2015, 350, 1096–1101. [Google Scholar] [CrossRef] [Scilit]
- Hillig, R.C.; Sautier, B.; Schroeder, J.; Moosmayer, D.; Hilpmann, A.; Stegmann, C.M.; Werbeck, N.D.; Briem, H.; Boemer, U.; Weiske, J.; et al. Discovery of potent SOS1 inhibitors that block RAS activation via disruption of the RAS-SOS1 interaction. Proc. Natl. Acad. Sci. USA 2019, 116, 2551–2560. [Google Scholar] [CrossRef] [Scilit]
- Quintero-Fabian, S.; Arreola, R.; Becerril-Villanueva, E.; Torres-Romero, J.C.; Arana-Argaez, V.; Lara-Riegos, J.; Ramirez-Camacho, M.A.; Alvarez-Sanchez, M.E. Role of Matrix Metalloproteinases in Angiogenesis and Cancer. Front. Oncol. 2019, 9, 1370. [Google Scholar] [CrossRef] [Scilit]
- Ries, C.; Loher, F.; Zang, C.; Ismair, M.G.; Petrides, P.E. Matrix metalloproteinase production by bone marrow mononuclear cells from normal individuals and patients with acute and chronic myeloid leukemia or myelodysplastic syndromes. Clin. Cancer Res. 1999, 5, 1115–1124. [Google Scholar] [PubMed]
- Chaudhary, A.K.; Chaudhary, S.; Ghosh, K.; Shanmukaiah, C.; Nadkarni, A.H. Secretion and Expression of Matrix Metalloproteinase-2 and 9 from Bone Marrow Mononuclear Cells in Myelodysplastic Syndrome and Acute Myeloid Leukemia. Asian Pac. J. Cancer Prev. 2016, 17, 1519–1529. [Google Scholar] [CrossRef] [Scilit]
- Paupert, J.; Mansat-De Mas, V.; Demur, C.; Salles, B.; Muller, C. Cell-surface MMP-9 regulates the invasive capacity of leukemia blast cells with monocytic features. Cell Cycle 2008, 7, 1047–1053. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Martinou, J.C.; Youle, R.J. Mitochondria in apoptosis: Bcl-2 family members and mitochondrial dynamics. Dev. Cell 2011, 21, 92–101. [Google Scholar] [CrossRef] [Scilit]
- Flis, K.; Irvine, D.; Copland, M.; Bhatia, R.; Skorski, T. Chronic myeloid leukemia stem cells display alterations in expression of genes involved in oxidative phosphorylation. Leuk. Lymphoma 2012, 53, 2474–2478. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kuntz, E.M.; Baquero, P.; Michie, A.M.; Dunn, K.; Tardito, S.; Holyoake, T.L.; Helgason, G.V.; Gottlieb, E. Targeting mitochondrial oxidative phosphorylation eradicates therapy-resistant chronic myeloid leukemia stem cells. Nat. Med. 2017, 23, 1234–1240. [Google Scholar] [CrossRef] [Scilit] [PubMed]















| Antibody | Company | Catalog No. |
|---|---|---|
| α-Tubulin | Sigma-Aldrich | T6199 |
| JAK2 | Cell Signaling | 3230 |
| STAT3 | Cell Signaling | 9132 |
| p-STAT3 | Cell Signaling | 9134 |
| AKT | Cell Signaling | 9272 |
| p-AKT | Cell Signaling | 9271 |
| c-Myc | Cell Signaling | 5605 |
| Lamin A/C | Genetex | GTX101127 |
| Gene | Primer Sequence | Amplicon (bp) | |
|---|---|---|---|
| GADPH | F | CATGAGAAGTATGACAACAGCCT | 113 |
| R | AGTCCTTCCACGATACCAAAGT | ||
| MMP11 | F | CCGCAACCGACAGAAGAGG | 145 |
| R | ATCGCTCCATACCTTTAGGGC | ||
| MMP14 | F | GGCTACAGCAATATGGCTACC | 83 |
| R | GATGGCCGCTGAGAGTGAC | ||
| MMP15 | F | AGGTCCATGCCGAGAACTG | 157 |
| R | GTCTCTTCGTCGAGCACACC | ||
| VEGFA | F | AGGGCAGAATCATCACGAAGT | 75 |
| R | AGGGTCTCGATTGGATGGCA | ||
| SOS1 | F | GAGTGAATCTGCATGTCGGTT | 177 |
| R | CTCTCATGTTTGGCTCCTACAC | ||
| ATP5D | F | TCCCACGCAGGTGTTCTTC | 178 |
| R | GGAACCGCTGCTCACAAAGT | ||
| CYC1 | F | CCAGGGAAGCTGTTCGACTAT | 80 |
| R | GGCAATGCTCCGTTGTTGG | ||
| NDUFB8 | F | CCGCCAAGAAGTATAATATGCGT | 204 |
| R | TATCCACACGGTTCCTGTTGT | ||
| NDUFS7 | F | CTTCGCAAGGTCTACGACCAG | 90 |
| R | GGAATAGTGGTAGTAGCCTCCTC | ||
| NDUFV1 | F | AGGCCCAAGTATCTGGTGGT | 85 |
| R | TGTGAGGATCATGGCGTAAGA | ||
| COX5A | F | ATCCAGTCAGTTCGCTGCTAT | 102 |
| R | CCAGGCATCTATATCTGGCTTG | ||
| NDUFB10 | F | AAAGCGTTCGACCTCATCGT | 178 |
| R | TCTTCCACTGCATTTCGGCT | ||
| SDHB | F | GTGGCCCCATGGTATTGGAT | 142 |
| R | CGGGTGCAAGCTAGAGTGTT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wu, P.-S.; Wang, C.-Y.; Chen, P.-S.; Hung, J.-H.; Yen, J.-H.; Wu, M.-J. 8-Hydroxydaidzein Downregulates JAK/STAT, MMP, Oxidative Phosphorylation, and PI3K/AKT Pathways in K562 Cells. Biomedicines 2021, 9, 1907. https://doi.org/10.3390/biomedicines9121907
Wu P-S, Wang C-Y, Chen P-S, Hung J-H, Yen J-H, Wu M-J. 8-Hydroxydaidzein Downregulates JAK/STAT, MMP, Oxidative Phosphorylation, and PI3K/AKT Pathways in K562 Cells. Biomedicines. 2021; 9(12):1907. https://doi.org/10.3390/biomedicines9121907
Chicago/Turabian StyleWu, Pei-Shan, Chih-Yang Wang, Pin-Shern Chen, Jui-Hsiang Hung, Jui-Hung Yen, and Ming-Jiuan Wu. 2021. "8-Hydroxydaidzein Downregulates JAK/STAT, MMP, Oxidative Phosphorylation, and PI3K/AKT Pathways in K562 Cells" Biomedicines 9, no. 12: 1907. https://doi.org/10.3390/biomedicines9121907
APA StyleWu, P.-S., Wang, C.-Y., Chen, P.-S., Hung, J.-H., Yen, J.-H., & Wu, M.-J. (2021). 8-Hydroxydaidzein Downregulates JAK/STAT, MMP, Oxidative Phosphorylation, and PI3K/AKT Pathways in K562 Cells. Biomedicines, 9(12), 1907. https://doi.org/10.3390/biomedicines9121907

