Anti-Inflammatory Mesenchymal Stromal Cell-Derived Extracellular Vesicles Improve Pathology in Niemann–Pick Type C Disease
Abstract
:1. Introduction
2. Results
2.1. MSC-EV Treatment Strategy of NPC1+/+ and NPC1−/− Mice
2.2. MSC41.5-EV but Not MSC16.3-EV Treatment Protects against NPC1−/−-Associated Weight Loss and Spleen Enlargement
2.3. MSC41.5-EV but Not MSC16.3-EV Treatment Reduces Peripheral Inflammation in NPC1−/− Mice
2.4. MSC41.5-EV Treatment Reduces Inflammation in Different Brain Regions in NPC1−/− Mice
2.5. MSC-EV Treatment Mitigates Microgliosis and Astrogliosis in NPC1−/− Mice
3. Discussion
4. Materials and Methods
4.1. Mice
4.2. Preparation of EVs
4.3. Treatment
4.4. Tissue Isolation
4.5. RNA Isolation and Real-Time qPCR
4.6. Immunohistochemistry
5. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Vanier, M.T. Complex lipid trafficking in Niemann-Pick disease type C. J. Inherit. Metab. Dis. 2015, 38, 187–199. [Google Scholar] [CrossRef] [PubMed]
- Lamri, A.; Pigeyre, M.; Garver, W.S.; Meyre, D. The Extending Spectrum of NPC1-Related Human Disorders: From Niemann-Pick C1 Disease to Obesity. Endocr. Rev. 2018, 39, 192–220. [Google Scholar] [CrossRef] [PubMed]
- Mengel, E.; Klunemann, H.H.; Lourenco, C.M.; Hendriksz, C.J.; Sedel, F.; Walterfang, M.; Kolb, S.A. Niemann-Pick disease type C symptomatology: An expert-based clinical description. Orphanet J. Rare Dis. 2013, 8, 166. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rodriguez-Gil, J.L.; Watkins-Chow, D.E.; Baxter, L.L.; Yokoyama, T.; Zerfas, P.M.; Starost, M.F.; Gahl, W.A.; Malicdan, M.C.V.; Porter, F.D.; Platt, F.M.; et al. NPC1 Deficiency in Mice is Associated with Fetal Growth Restriction, Neonatal Lethality and Abnormal Lung Pathology. J. Clin. Med. 2019, 9, 12. [Google Scholar] [CrossRef] [Green Version]
- Walterfang, M.; Di Biase, M.A.; Cropley, V.L.; Scott, A.M.; O’Keefe, G.; Velakoulis, D.; Pathmaraj, K.; Ackermann, U.; Pantelis, C. Imaging of neuroinflammation in adult Niemann-Pick type C disease: A cross-sectional study. Neurology 2020, 94, e1716–e1725. [Google Scholar] [CrossRef] [PubMed]
- Platt, N.; Speak, A.O.; Colaco, A.; Gray, J.; Smith, D.A.; Williams, I.M.; Wallom, K.L.; Platt, F.M. Immune dysfunction in Niemann-Pick disease type C. J. Neurochem. 2016, 136 (Suppl. S1), 74–80. [Google Scholar] [CrossRef]
- Vanier, M.T. Niemann-Pick disease type C. Orphanet J. Rare Dis. 2010, 5, 16. [Google Scholar] [CrossRef] [Green Version]
- Lee, R.H.; Pulin, A.A.; Seo, M.J.; Kota, D.J.; Ylostalo, J.; Larson, B.L.; Semprun-Prieto, L.; Delafontaine, P.; Prockop, D.J. Intravenous hMSCs improve myocardial infarction in mice because cells embolized in lung are activated to secrete the anti-inflammatory protein TSG-6. Cell Stem Cell 2009, 5, 54–63. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bartholomew, A.; Sturgeon, C.; Siatskas, M.; Ferrer, K.; McIntosh, K.; Patil, S.; Hardy, W.; Devine, S.; Ucker, D.; Deans, R.; et al. Mesenchymal stem cells suppress lymphocyte proliferation in vitro and prolong skin graft survival in vivo. Exp. Hematol. 2002, 30, 42–48. [Google Scholar] [CrossRef]
- Di Nicola, M.; Carlo-Stella, C.; Magni, M.; Milanesi, M.; Longoni, P.D.; Matteucci, P.; Grisanti, S.; Gianni, A.M. Human bone marrow stromal cells suppress T-lymphocyte proliferation induced by cellular or nonspecific mitogenic stimuli. Blood 2002, 99, 3838–3843. [Google Scholar] [CrossRef] [PubMed]
- Le Blanc, K.; Rasmusson, I.; Sundberg, B.; Gotherstrom, C.; Hassan, M.; Uzunel, M.; Ringden, O. Treatment of severe acute graft-versus-host disease with third party haploidentical mesenchymal stem cells. Lancet 2004, 363, 1439–1441. [Google Scholar] [CrossRef]
- Galipeau, J. The mesenchymal stromal cells dilemma—Does a negative phase III trial of random donor mesenchymal stromal cells in steroid-resistant graft-versus-host disease represent a death knell or a bump in the road? Cytotherapy 2013, 15, 2–8. [Google Scholar] [CrossRef]
- Kebriaei, P.; Hayes, J.; Daly, A.; Uberti, J.; Marks, D.I.; Soiffer, R.; Waller, E.K.; Burke, E.; Skerrett, D.; Shpall, E.; et al. A Phase 3 Randomized Study of Remestemcel-L versus Placebo Added to Second-Line Therapy in Patients with Steroid-Refractory Acute Graft-versus-Host Disease. Biol. Blood Marrow Transpl. 2020, 26, 835–844. [Google Scholar] [CrossRef] [PubMed]
- Kurtzberg, J.; Abdel-Azim, H.; Carpenter, P.; Chaudhury, S.; Horn, B.; Mahadeo, K.; Nemecek, E.; Neudorf, S.; Prasad, V.; Prockop, S.; et al. A Phase 3, Single-Arm, Prospective Study of Remestemcel-L, Ex Vivo Culture-Expanded Adult Human Mesenchymal Stromal Cells for the Treatment of Pediatric Patients who Failed to Respond to Steroid Treatment for Acute Graft-versus-Host Disease. Biol. Blood Marrow Transpl. 2020, 26, 845–854. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kurtzberg, J.; Prockop, S.; Chaudhury, S.; Horn, B.; Nemecek, E.; Prasad, V.; Satwani, P.; Teira, P.; Hayes, J.; Burke, E.; et al. Study 275: Updated Expanded Access Program for Remestemcel-L in Steroid-Refractory Acute Graft-versus-Host Disease in Children. Biol. Blood Marrow Transpl. 2020, 26, 855–864. [Google Scholar] [CrossRef] [Green Version]
- Gnecchi, M.; He, H.; Liang, O.D.; Melo, L.G.; Morello, F.; Mu, H.; Noiseux, N.; Zhang, L.; Pratt, R.E.; Ingwall, J.S.; et al. Paracrine action accounts for marked protection of ischemic heart by Akt-modified mesenchymal stem cells. Nat. Med. 2005, 11, 367–368. [Google Scholar] [CrossRef] [PubMed]
- Gnecchi, M.; He, H.; Noiseux, N.; Liang, O.D.; Zhang, L.; Morello, F.; Mu, H.; Melo, L.G.; Pratt, R.E.; Ingwall, J.S.; et al. Evidence supporting paracrine hypothesis for Akt-modified mesenchymal stem cell-mediated cardiac protection and functional improvement. FASEB J. 2006, 20, 661–669. [Google Scholar] [CrossRef] [PubMed]
- Lai, R.C.; Arslan, F.; Lee, M.M.; Sze, N.S.; Choo, A.; Chen, T.S.; Salto-Tellez, M.; Timmers, L.; Lee, C.N.; El Oakley, R.M.; et al. Exosome secreted by MSC reduces myocardial ischemia/reperfusion injury. Stem Cell Res. 2010, 4, 214–222. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zanotti, L.; Sarukhan, A.; Dander, E.; Castor, M.; Cibella, J.; Soldani, C.; Trovato, A.E.; Ploia, C.; Luca, G.; Calvitti, M.; et al. Encapsulated mesenchymal stem cells for in vivo immunomodulation. Leukemia 2013, 27, 500–503. [Google Scholar] [CrossRef]
- Timmers, L.; Lim, S.K.; Arslan, F.; Armstrong, J.S.; Hoefer, I.E.; Doevendans, P.A.; Piek, J.J.; El Oakley, R.M.; Choo, A.; Lee, C.N.; et al. Reduction of myocardial infarct size by human mesenchymal stem cell conditioned medium. Stem Cell Res. 2007, 1, 129–137. [Google Scholar] [CrossRef] [Green Version]
- Borger, V.; Bremer, M.; Ferrer-Tur, R.; Gockeln, L.; Stambouli, O.; Becic, A.; Giebel, B. Mesenchymal Stem/Stromal Cell-Derived Extracellular Vesicles and Their Potential as Novel Immunomodulatory Therapeutic Agents. Int. J. Mol. Sci. 2017, 18, 1450. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Giebel, B.; Kordelas, L.; Borger, V. Clinical potential of mesenchymal stem/stromal cell-derived extracellular vesicles. Stem Cell Investig. 2017, 4, 84. [Google Scholar] [CrossRef] [Green Version]
- Lener, T.; Gimona, M.; Aigner, L.; Borger, V.; Buzas, E.; Camussi, G.; Chaput, N.; Chatterjee, D.; Court, F.A.; Del Portillo, H.A.; et al. Applying extracellular vesicles based therapeutics in clinical trials—An ISEV position paper. J. Extracell. Vesicles 2015, 4, 30087. [Google Scholar] [CrossRef] [PubMed]
- Luo, T.; von der Ohe, J.; Hass, R. MSC-Derived Extracellular Vesicles in Tumors and Therapy. Cancers 2021, 13, 5212. [Google Scholar] [CrossRef] [PubMed]
- Slomka, A.; Urban, S.K.; Lukacs-Kornek, V.; Zekanowska, E.; Kornek, M. Large Extracellular Vesicles: Have We Found the Holy Grail of Inflammation? Front. Immunol. 2018, 9, 2723. [Google Scholar] [CrossRef] [PubMed]
- Kordelas, L.; Rebmann, V.; Ludwig, A.K.; Radtke, S.; Ruesing, J.; Doeppner, T.R.; Epple, M.; Horn, P.A.; Beelen, D.W.; Giebel, B. MSC-derived exosomes: A novel tool to treat therapy-refractory graft-versus-host disease. Leukemia 2014, 28, 970–973. [Google Scholar] [CrossRef] [PubMed]
- Colombo, A.; Dinkel, L.; Muller, S.A.; Sebastian Monasor, L.; Schifferer, M.; Cantuti-Castelvetri, L.; Konig, J.; Vidatic, L.; Bremova-Ertl, T.; Lieberman, A.P.; et al. Loss of NPC1 enhances phagocytic uptake and impairs lipid trafficking in microglia. Nat. Commun. 2021, 12, 1158. [Google Scholar] [CrossRef] [PubMed]
- Loftus, S.K.; Morris, J.A.; Carstea, E.D.; Gu, J.Z.; Cummings, C.; Brown, A.; Ellison, J.; Ohno, K.; Rosenfeld, M.A.; Tagle, D.A.; et al. Murine model of Niemann-Pick C disease: Mutation in a cholesterol homeostasis gene. Science 1997, 277, 232–235. [Google Scholar] [CrossRef] [PubMed]
- Pentchev, P.G.; Gal, A.E.; Booth, A.D.; Omodeo-Sale, F.; Fouks, J.; Neumeyer, B.A.; Quirk, J.M.; Dawson, G.; Brady, R.O. A lysosomal storage disorder in mice characterized by a dual deficiency of sphingomyelinase and glucocerebrosidase. Biochim. Biophys. Acta 1980, 619, 669–679. [Google Scholar] [CrossRef]
- Borger, V.; Staubach, S.; Dittrich, R.; Stambouli, O.; Giebel, B. Scaled Isolation of Mesenchymal Stem/Stromal Cell-Derived Extracellular Vesicles. Curr. Protoc. Stem Cell Biol. 2020, 55, e128. [Google Scholar] [CrossRef] [PubMed]
- Ludwig, A.K.; De Miroschedji, K.; Doeppner, T.R.; Borger, V.; Ruesing, J.; Rebmann, V.; Durst, S.; Jansen, S.; Bremer, M.; Behrmann, E.; et al. Precipitation with polyethylene glycol followed by washing and pelleting by ultracentrifugation enriches extracellular vesicles from tissue culture supernatants in small and large scales. J. Extracell. Vesicles 2018, 7, 1528109. [Google Scholar] [CrossRef] [PubMed]
- Madel, R.J.; Borger, V.; Dittrich, R.; Bremer, M.; Tertel, T.; Ngo Thi Phuong, N.; Babo, H.A.; Kordelas, L.; Buer, J.; Horn, P.A.; et al. Independent human mesenchymal stromal cell-derived extracellular vesicle preparations differentially affect symptoms in an advanced murine Graft-versus-Host-Disease model. bioRxiv 2020. [Google Scholar] [CrossRef]
- Wang, C.; Borger, V.; Sardari, M.; Murke, F.; Skuljec, J.; Pul, R.; Hagemann, N.; Dzyubenko, E.; Dittrich, R.; Gregorius, J.; et al. Mesenchymal Stromal Cell-Derived Small Extracellular Vesicles Induce Ischemic Neuroprotection by Modulating Leukocytes and Specifically Neutrophils. Stroke 2020, 51, 1825–1834. [Google Scholar] [CrossRef] [PubMed]
- Bataller, R.; Brenner, D.A. Liver fibrosis. J. Clin. Investig. 2005, 115, 209–218. [Google Scholar] [CrossRef]
- Bilzer, M.; Roggel, F.; Gerbes, A.L. Role of Kupffer cells in host defense and liver disease. Liver Int. 2006, 26, 1175–1186. [Google Scholar] [CrossRef]
- Bradham, C.A.; Plumpe, J.; Manns, M.P.; Brenner, D.A.; Trautwein, C. Mechanisms of hepatic toxicity. I. TNF-induced liver injury. Am. J. Physiol. 1998, 275, G387–G392. [Google Scholar]
- Copaci, I.; Micu, L.; Voiculescu, M. The role of cytokines in non-alcoholic steatohepatitis. A review. J. Gastrointest. Liver Dis. 2006, 15, 363–373. [Google Scholar]
- Fausto, N.; Laird, A.D.; Webber, E.M. Liver regeneration. 2. Role of growth factors and cytokines in hepatic regeneration. FASEB J. 1995, 9, 1527–1536. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kolios, G.; Valatas, V.; Kouroumalis, E. Role of Kupffer cells in the pathogenesis of liver disease. World J. Gastroenterol. 2006, 12, 7413–7420. [Google Scholar] [CrossRef]
- Rimkunas, V.M.; Graham, M.J.; Crooke, R.M.; Liscum, L. In vivo antisense oligonucleotide reduction of NPC1 expression as a novel mouse model for Niemann Pick type C- associated liver disease. Hepatology 2008, 47, 1504–1512. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wu, Y.P.; Mizukami, H.; Matsuda, J.; Saito, Y.; Proia, R.L.; Suzuki, K. Apoptosis accompanied by up-regulation of TNF-alpha death pathway genes in the brain of Niemann-Pick type C disease. Mol. Genet. Metab. 2005, 84, 9–17. [Google Scholar] [CrossRef] [PubMed]
- Maxfield, F.R.; Tabas, I. Role of cholesterol and lipid organization in disease. Nature 2005, 438, 612–621. [Google Scholar] [CrossRef]
- Cologna, S.M.; Cluzeau, C.V.; Yanjanin, N.M.; Blank, P.S.; Dail, M.K.; Siebel, S.; Toth, C.L.; Wassif, C.A.; Lieberman, A.P.; Porter, F.D. Human and mouse neuroinflammation markers in Niemann-Pick disease, type C1. J. Inherit. Metab. Dis. 2014, 37, 83–92. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Baudry, M.; Yao, Y.; Simmons, D.; Liu, J.; Bi, X. Postnatal development of inflammation in a murine model of Niemann-Pick type C disease: Immunohistochemical observations of microglia and astroglia. Exp. Neurol. 2003, 184, 887–903. [Google Scholar] [CrossRef]
- Giebel, B.; Hermann, D.M. Identification of the right cell sources for the production of therapeutically active extracellular vesicles in ischemic stroke. Ann. Transl. Med. 2019, 7, 188. [Google Scholar] [CrossRef]
- Lai, P.; Weng, J.; Guo, L.; Chen, X.; Du, X. Novel insights into MSC-EVs therapy for immune diseases. Biomark. Res. 2019, 7, 6. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lv, L.L.; Wu, W.J.; Feng, Y.; Li, Z.L.; Tang, T.T.; Liu, B.C. Therapeutic application of extracellular vesicles in kidney disease: Promises and challenges. J. Cell. Mol. Med. 2018, 22, 728–737. [Google Scholar] [CrossRef] [PubMed]
- Beltroy, E.P.; Richardson, J.A.; Horton, J.D.; Turley, S.D.; Dietschy, J.M. Cholesterol accumulation and liver cell death in mice with Niemann-Pick type C disease. Hepatology 2005, 42, 886–893. [Google Scholar] [CrossRef] [PubMed]
- Radtke, S.; Gorgens, A.; Liu, B.; Horn, P.A.; Giebel, B. Human mesenchymal and murine stromal cells support human lympho-myeloid progenitor expansion but not maintenance of multipotent haematopoietic stem and progenitor cells. Cell Cycle 2016, 15, 540–545. [Google Scholar] [CrossRef] [Green Version]
- Thery, C.; Witwer, K.W.; Aikawa, E.; Alcaraz, M.J.; Anderson, J.D.; Andriantsitohaina, R.; Antoniou, A.; Arab, T.; Archer, F.; Atkin-Smith, G.K.; et al. Minimal information for studies of extracellular vesicles 2018 (MISEV2018): A position statement of the International Society for Extracellular Vesicles and update of the MISEV2014 guidelines. J. Extracell. Vesicles 2018, 7, 1535750. [Google Scholar] [CrossRef] [PubMed] [Green Version]
EV Type | Protein Concentration (µg/µL) | Size (nm) |
---|---|---|
MSC41.5-EVs | 4.80 | 125.6 |
MSC16.3-EVs | 4.89 | 114.5 |
PL EV | 7.52 | 125.2 |
Gene | Forward | Reverse |
---|---|---|
Gapdh | TGAAGCAGGCATCTGAGGG | CGAAGGTGGAAGAGTGGGAG |
Hprt | AGTGTTGGATACAGGCCAGAC | CGTGATTCAAATCCCTGAAGT |
Rpl | CCTGCTGCTCTCAAGGTT | TGGTTGTCACTGCCTCGTACTT |
Ubc | AGGTCAAACAGGAAGACAGACGTA | TCACACCCAAGAACAAGCACA |
Ccl3 | TTCTCTGTACCATGACACTCTGC | CGTGGAATCTTCCGGCTGTAG |
Ccl5 | GCTGCTTTGCCTACCTCTCC | TCGAGTGACAAACACGACTGC |
Cxcl10 | CCAAGTGCTGCCGTCATTTTC | GGCTCGCAGGGATGATTTCAA |
Tnf | ACCCTGGTATGAGCCCATATAC | ACACCCATTCCCTTCACAGAG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Van Hoecke, L.; Van Cauwenberghe, C.; Börger, V.; Bruggeman, A.; Castelein, J.; Van Imschoot, G.; Van Wonterghem, E.; Dittrich, R.; Claeys, W.; Xie, J.; et al. Anti-Inflammatory Mesenchymal Stromal Cell-Derived Extracellular Vesicles Improve Pathology in Niemann–Pick Type C Disease. Biomedicines 2021, 9, 1864. https://doi.org/10.3390/biomedicines9121864
Van Hoecke L, Van Cauwenberghe C, Börger V, Bruggeman A, Castelein J, Van Imschoot G, Van Wonterghem E, Dittrich R, Claeys W, Xie J, et al. Anti-Inflammatory Mesenchymal Stromal Cell-Derived Extracellular Vesicles Improve Pathology in Niemann–Pick Type C Disease. Biomedicines. 2021; 9(12):1864. https://doi.org/10.3390/biomedicines9121864
Chicago/Turabian StyleVan Hoecke, Lien, Caroline Van Cauwenberghe, Verena Börger, Arnout Bruggeman, Jonas Castelein, Griet Van Imschoot, Elien Van Wonterghem, Robin Dittrich, Wouter Claeys, Junhua Xie, and et al. 2021. "Anti-Inflammatory Mesenchymal Stromal Cell-Derived Extracellular Vesicles Improve Pathology in Niemann–Pick Type C Disease" Biomedicines 9, no. 12: 1864. https://doi.org/10.3390/biomedicines9121864