1. Introduction
Acute myeloid leukemia (AML) is a heterogeneous group of genetically complex hematopoietic stem cell malignancies and is caused by oncogenic events including gene mutations and cytogenetic abnormalities conferring maturation arrest with clonal expansion of abnormal hematopoietic progenitors leading to bone marrow failure [
1,
2]. Outcome generally remains poor with overall survival ranging from 20–50% for different subgroups, depending on the age and feasibility of intensive treatment strategies [
3]. Cytogenetic and genetic alterations classify AML into different risk categories [
4,
5]. Patients with normal karyotype belong to the intermediate risk category and their prognosis is determined by specific genetic alterations, including the Nucleophosmin 1 mutation (
NPM1c) and FMS-like tyrosine kinase-3 (
FLT3) internal tandem duplication (ITD), whereas isolated
NPM1c confers generally rather good prognosis [
4,
6].
The
NPM1 gene (
NPMwt) encodes a nucleolar shuttling protein, which regulates stabilization of the p14Arf tumor suppressor protein, P53 activation, ribosome biogenesis, and control of centrosome duplication [
7]. About 30% of AML patients express a heterozygous
NPM1c of which more than 80% are type A mutants [
8]. NPM1c is delocalized to the cytoplasm compared to NPM1wt which is localized in the nucleus [
9]. Nuclear localization of NPM1 is due to a nucleolar localization signal of which at least one is lost in
NPM1c cells leading to its export in the cytosol and in consequence to the loss of its tumor suppressive function and subsequent expression of
HOX genes [
10,
11]. The importance of
HOX genes for
NPM1c AML maintenance was demonstrated as specific loss of NPM1c from the cytoplasm leading to the downregulation of HOX genes and differentiation in
NPM1c AML [
11]. It was recently demonstrated that the activation of HOXBLINC, a
HOXB locus-associated long non-coding RNA, is a critical downstream mediator of
NPM1c-associated leukemic transcription program and leukemogenesis [
12].
Standard treatment of AML patients with normal karyotype and
NPM1c consists in the use of intensive chemotherapy (IC) leading to 5-year overall survival up to 60% without HSCT [
3]. Nevertheless, relapse is frequent and there persists an unmet clinical need for novel treatment options for patients ineligible for IC and/or HSCT. Novel therapeutic approaches for
NPM1c AML were reported recently. Among those, it was shown that differentiation-based therapy by all trans retinoic acid (ATRA) and arsenic trioxide (ATO) induced proteasomal degradation of NPM1c leading to exclusive nuclear localization of NPM1wt, differentiation, growth arrest, and P53-dependent apoptosis in
NPM1c cells [
13,
14]. Furthermore, ATO + ATRA exposure significantly reduced bone marrow blasts in relapsed/refractory AML patients bearing
NPM1c [
13].
The bromodomain (BRD) and extraterminal (BET) inhibitors (BETi) I-BET151, JQ1, and OTX015 (MK-8628) were shown to provide antileukemic effects in
NPM1c leukemic cells [
15,
16]. The impaired control of epigenetic readers of BRD, including BRD2, BRD3, and BRD4 is crucial for oncogenic processes in hematologic malignancies [
17,
18,
19]. NPM1wt interacts with BRD4 in the nucleus and HEXIM1 represses BRD4-mediated transcriptional elongation via conformational changes of P-TEFb [
16,
20,
21]. If
NPM1 is mutated, BRD4 and NPM1 are dissociated activating aberrant transcriptional elongation, resulting in increased expression of a BET specific core transcriptional program containing critical regulators of leukemogenesis like
BCL2,
C-MYC, and
IRF8 which are
HOX gene independent [
16]. Treatment of
NPM1c AML cells with BETi I-BET151 resulted in downregulation of this specific core transcriptional program and subsequent cell cycle arrest, induction of apoptosis, decreased proliferation, and I-BET151 prolonged survival in a
NPM1c mouse model [
16]. OTX015 (MK-8628) was the first in class inhibitor to be tested in a phase I dose-escalating multicenter trial in hematologic diseases (NCT01713582). Response rates in acute leukemias were modest including 5 responses among 36 patients (13.9%) enrolled with 1 responder having AML with
NPM1c [
22,
23]. It was recently demonstrated that BETi-resistant cells yield a leukemic stem cell (LSC)- like signature including upregulation of the Wnt/Beta-catenin pathway [
24,
25].
Based on those data, we investigated BETi compared to ATO + ATRA in NPM1c cell lines and patient samples to investigate their potential for further clinical development. BETi induced apoptosis, differentiation, and proteasome-dependent degradation of the NPM1c protein while the NPM1c cell line IMS-M2 appeared resistant to BETi possibly due to intrinsic upregulation of LSC pathways including the JAK/STAT, MAPK, and Wnt/Beta-catenin pathways. Furthermore, disappearance of aberrant NPM1c in the cytosol is generally induced by BETi in NPM1c cells and patient-derived blast cells. While ATO + ATRA downregulated a NPM1c specific HOX gene signature anti-leukemic effects of BETi appeared HOX gene independent. Thus, BETi have significant biologic effects in NPM1c cells and patient samples and clinical testing of these novel agents in NPM1c AML patients should be considered.
2. Materials and Methods
2.1. Cell Lines and Selection of Primary Patient Cells
OCI-AML3 (
NPM1c type A and other mutations see
Table 1) and K562 (
BCR-ABL+) cell lines were purchased from Deutsche Sammlung von Mikroorganismen und Zellkulturen (DSMZ, Braunschweig, Germany). IMS-M2 cell line (ETV6-NTRK3 fusion,
NPM1c type A, and other mutations see
Table 1) was a kind gift from Pr Hugues de Thé. Cells were cultured in RPMI 1640 (Life Technologies, Courtaboeuf, France) supplemented with 10% heat-inactivated fetal bovine serum, 2 mM
l-glutamine, 100 IU/mL penicillin, 100 μg/mL streptomycin and HEPES, at 37 °C with 5% CO
2 as described elsewhere [
15].
Mononuclear cells from the bone marrow (BM) of selected
NPM1c-mutated AML patients were isolated by separation medium for lymphocytes (Eurobio, Courtaboeuf, France) as previously described [
15]. Primary cells were maintained in IMDM (Life Technologies, Courtaboeuf, France) supplemented with 10% heat-inactivated fetal bovine serum, 2 mM
l-glutamine, 100 IU/mL penicillin, and 100 μg/mL streptomycin without growth factors, at 37 °C with 5% CO
2 as reported formerly [
15]. Patients provided informed consent prior to BM aspiration at diagnosis, according to the Declaration of Helsinki. Approval for this study was obtained from the local institutional review board of the CHU Saint Louis, Paris (France). One patient with relapsed
NPM1c AML was treated in a phase I dose escalating multicenter trial in hematologic diseases (NCT01713582) and patient BM cells were obtained at day 1 and 22 during the first treatment cycle. The patient provided informed consent prior to BM aspiration at diagnosis, according to the Declaration of Helsinki and the study was approved by the local institutional review boards of CHU Lille (France), CHU Saint Louis, Paris (France), CHU Lyon Sud (France), Institut Paoli Calmettes, Marseille (France), CHU Toulouse (France), Princess Margaret Cancer Center, Toronto (Canada) and Royal Marsden Hospital, London (UK) for all patients included in the trial NCT01713582, approved date: 24 October 2012 [
22].
OTX015 (MK-8628) was purchased from CliniSciences (Nanterre, France) and JQ1 were purchased from tebu-bio (Le Perray en Yvelines, France). ATRA (all-trans retinoic acid) and ATO (Arsenic trioxide) diarsenic trioxide were purchased from Sigma (Saint Quentin Fallavier, France). Bortezomib (PS-341) were purchased from Euromedex (Souffelweyersheim, France). All compounds were dissolved in dimethyl sulfoxide (DMSO) purchased from Euromedex (Souffelweyersheim, France) and stored at −20 °C, except ATO that was dissolved in water and stored at 4 °C. Aliquots were thawed and used immediately for serial dilution in culture media. Control cells were incubated with 0.1% DMSO.
2.2. ApoTox-GloTM and Apoptosis Assessment
For the ApoTox-GloTM Triplex Assay from Promega (Charbonnières Les Bains, France), cells were seeded in 48-well plates at 0.2 × 106/mL and treated with a range of ATO-ATRA concentrations from 0.009 µM to 5 µM, for OTX015 (MK-8628) and JQ1 from 0.00038 µM to 100 µM for 72 h. Cells were transferred to 96-well plates and incubated with viability/cytotoxicity reagent containing both GF-AFC substrate and bis-AAF-R110 in the dark at 37 °C for 30 min. The fluorescence was measured at 400Ex/505Em for the viability and 485Ex/520Em for the cytotoxicity. The cells were incubated with Caspase-Glo® 3/7 reagent for 30 min at room temperature and the luminescence was measured. Three independent experiments were run for each cell line and untreated cells were used as negative controls. The half maximal inhibitory concentration (IC50) values were calculated with Prism® v6 software (GraphPad Software LLC, La Jolla, CA, USA). For apoptosis analysis, 1 × 106 cells derived from patients or cell lines were resuspended in 1 mL culture medium and treated for 48 h and 72 h with either 500 nM OTX015 (MK-8628), 500 nM JQ1, 1 µM ATRA + 1 µM ATO or 0.1% DMSO. Apoptotic cells were detected using a CytoFLEX flow cytometer (Beckman Coulter, Villepinte, France). Cells were stained with 5 µg/mL PI and Annexin-V-FITC (Becton Dickinson, Le Pont de Claix, France) according to the manufacturer’s instructions for 15 min at room temperature. Apoptotic cells were defined as Annexin V + with or without PI uptake. Apoptosis was determined by cytofluorometric analysis and analyzed with the FlowJo flow cytometry software (FlowJo LLC, Ashland, OR, USA).
2.3. CRSPR-Cas9 TP53 Kock Out
To CRISPR out P53, gRNA targeting human P53 (5′CCATTGTTCAATATCGTCCG), negative control (CGTTAATCGCGTATAATACGGTTTTAGAGCTATGCT), and recombinant Cas9 protein was synthesized from IDT to form Alt-R CRISPR/Cas9 RNP. OCI-AML3 cells were transiently transfected with Alt-R CRISPR/Cas9 RNP by using Nucleofector kit T (Amaxa) and applied program number X-01 in the nucleofector device (Lonza). The stable CRISPR knockout clones undergo serial dilution for single-cell separation. The DNA was extracted from these clones and the region surrounding the Cas9 cutting site was PCR amplified for sequencing.
2.4. Differentiation Assessment
Morphologic differentiation of OCI-AML3, IMS-M2, K562 or patient cells was determined by CD11b expression and morphologic assessment of cells stained with May-Grünwald-Giemsa. Cells were treated for 48 h and 72 h with either 500 nM OTX015 (MK-8628), 500 nM JQ1, 1 µM ATRA + 1 µM ATO, or 0.1% DMSO followed by flow cytometric detection of the differentiation marker CD11b Alexa Fluor® 488 (#557701, Becton Dickinson, Le Pont de Claix, France) using a CytoFLEX flow cytometer (Beckman Coulter, Villepinte, France) and analyzed with the FlowJo flow cytometry software (FlowJo LLC, Ashland, OR, USA). For morphologic analysis, cytospin preparations (Cytospin 4, Fisher Scientific, Illkirch, France) of OCI-AML3, IMS-M2, K562 or patient cells treated for 48 h by OTX015 (MK-8628) 500 nM, JQ1 500 nM, ATRA 1 µM + ATO 1 µM, or 0.1% DMSO were stained with May-Grünwald Giemsa solution and examined under light microscopy with a Zeiss microscope (Carl Zeiss, Marly le Roi, France) with a X40 objective.
2.5. Immunoblotting
Protein was extracted from 5 × 106 cells exposed to either 500 nM OTX015 (MK-8628), 500 nM JQ1, 1 µM ATRA, 1 or 3 µM ATO, or 0.1% DMSO; 30 μg of protein was loaded on SDS-polyacrylamide gels using 4–15% gradient gels (#4568084, Bio-Rad, Marnes-La-Coquette, France) and transferred to nitrocellulose membranes (#1704158, Bio-Rad, Marnes-La-Coquette, France) using a Mini Trans-Blot Electrophoretic Transfer cell (Bio-Rad, Marnes-La-Coquette, France). Membranes were blocked with LI-COR blocking buffer (#927-40000, Eurobio, Courtaboeuf, France) and incubated with the primary antibody overnight at 4 °C: rabbit anti-NPM1m (#PA1-46356, Life Technologies, Courtaboeuf, France), mouse anti-NPM1total (#H00004869-M01), mouse anti-TP53 (#sc-126) both of CliniSciences, Nanterre, France. Rabbit anti-PARP (#9542), rabbit anti-cleaved caspase 3 (#9661), mouse anti-vinculin (#sc-73614) were purchased from Ozyme, Saint-Cyr-l’École, France, and mouse anti-GAPDH (#398600) from Life Technologies, Courtaboeuf, France. Goat anti rabbit HRP or goat anti mouse HRP secondary antibodies (#1706515 and # 1706516, Bio-Rad, Marnes-La-Coquette, France), were incubated for 1 h at room temperature. Bands were visualized using the ChemiDoc Touch (Bio-Rad, Marnes-La-Coquette, France).
2.6. Separation of Nuclear and Cytosolic Extracts
Cytoplasmic and nuclear protein were extracted from 5 × 106 OCI-AML3 cells exposed to OTX015 (MK-8628), JQ1, ATO + ATRA or 0.1% DMSO with NE-PER Nuclear and Cytoplasmic kit (#78833, Life Technologies, Courtaboeuf, France). Proteins thus obtained were concentrated with Amicon Ultra centrifugal filters, Ultracel 30 K and 10 K (#UFC503096 and #UFC501096, Merck Millipore, St. Quentin Fallavier, France). Thirty microgrammes of cytoplasmic proteins and 5–10 µg of nuclear proteins were loaded on SDS-polyacrylamide gels using 4–15% gradient gels (Bio-Rad, Marnes-La-Coquette, France) and transferred to nitrocellulose membranes using a Mini Trans-Blot Electrophoretic Transfer cell (Bio-Rad, Marnes-La-Coquette, France). Membranes were blocked with LI-COR blocking buffer and incubated with the primary antibody overnight at 4 °C: anti-NPM1m (#ab65816, Abcam, Paris, France), anti-NPM1total (#H00004869-M01, CliniSciences, Nanterre, France), anti-BRD4 (#ab128874, Abcam, Paris, France), anti-tubulin (#ab176560, Abcam, Paris, France), or anti-lamin (#ab16048, Abcam, Paris, France). Secondary antibodies were goat anti rabbit HRP or goat anti mouse HRP (Bio-Rad, Marnes-La-Coquette, France), incubated for 1 h at room temperature. Bands were visualized using the ChemiDoc Touch (Bio-Rad, Marnes-La-Coquette, France).
2.7. Immunofluorescence
OCI-AML3, IMS-M2, and K562 or patient cells were fixed for 20 min with methanol at −20 °C, then cytospined on polylysine-L slides (#045797, Dominique Dutscher, Brumath, France), permeabilized using Triton X-100 0.5% for 15 min and blocked for 1 h with 3% BSA in DPBS (pH 7.4). Cells were incubated with a mouse anti NPM1 antibody recognizing its wild type and mutated form (#sc-47725, CliniSciences, Nanterre, France) 1 h at room temperature, slides were then washed and incubated for 1 h at room temperature with a secondary antibody goat anti-mouse IgG-coupled Alexa 488 fluorochrome (#A-11017, Life Technologies, Courtaboeuf, France). Nuclei were counterstained with DAPI (#H-1200, Eurobio, Courtaboeuf, France). Images were acquired by immunofluorescence microscopy on a Zeiss Axiovert microscope with a Plan-Apochromat X40 N.A.1.4 oil immersion objective using the Axiovison software v4.2 (Carl Zeiss, Marly le Roi, France).
2.8. In Situ Proximity Ligation Assays (Duolink®)
OCI-AML3 cells were fixed in methanol onto glass coverslips by cytospin. Protein-protein interactions were visualized using the Duolink® in situ proximity ligation assay (PLA) system from Sigma (Saint Quentin Fallavier, France), using an anti-NPMwt + c antibody (#sc-47725, CliniSciences).
2.9. Microarray
Gene expression profile was performed as described previously [
15]: untreated OCI-AML3 and IMS-M2 cells were compared to treated cells (exposure for 24 h either 500 nM OTX015 (MK-8628), 500 nM JQ1, 1 µM ATRA, 1 µM ATO, 1 µM ATRA + 1 µM ATO, or 0.1% DMSO). After extraction of total RNA, 500 ng of RNA of each sample was processed using WT PLUS Amplification and Labeling Kit according to the manufacturer’s instructions. Analysis was performed with the GeneChip Human Transcriptome Array HTA 2.0 Array (Affymetrix
®, Life Technologies, Courtaboeuf, France). We generated each sample in triplicates (
n = 21).
We analyzed differential gene expression using the Bioconductor limma library on annotated coding transcripts (n = 32,670) and metabolic pathways analysis was performed using the GSEA v2.0 software with 1000 gene set permutations.
2.10. Targeting Sequencing Using NGS
Targeting sequencing of all exons of 66 genes recurrently involved in myeloid hematological malignancies was performed using a customized SureSelect™ (Agilent) capture panel (List of genes below). Libraries were prepared from 200 ng of genomic DNA from leukemia cells according to manufacturer’s instructions and sequenced on NextSeq 550™ using Illumina reagents. The mean depth was 995× and the coverage at a minimum depth of 200× was 97%.
Data analysis was performed using an in-house pipeline using GATK, Varscan and Pindel and VISCAP tools. Interpretation of variants was performed with the help of human genome databases, COSMIC database, prediction algorithms (including SIFT and PolyPhen) and literature review. List of genes: ASXL1, ASXL2, ATRX, BCOR, BCORL1, BRAF, BRCA2, BRCC3, CALR, CBL, CEBPA, CREBBP, CSF3R, CTCF, CUX1, DDX41, D NMT3A, EP300, ERCC6L2, ETNK1, ETV6, EZH2, FLT3, GATA2, HRAS, IDH1, IDH2, IRF1, JAK2, KDM5A, KDM6A, KIT, KMT2A/MLL, KMT2D/MLL2, KRAS, MECOM, MPL, MYC, NF1, NPM1, NRAS, PHF6, PPM1D, PRPF8, PTEN, PTPN11, RAD21, RIT1, RUNX1, SAMD9, SAMD9L, SBDS, SETBP1, SF1, SF3B1, SMC1A, SMC3, SRP72, SRSF2, STAG2, TET2, TP53, U2AF1, U2AF2, WT1, ZRSR2.
4. Discussion
About 30–40% of AML patients bear
NPM1c leading to the expression of an oncoprotein driving leukemogenesis in this subtype [
9]. Even if not fully elucidated,
NPM1c is an AML founding genetic lesion representing a potential target for therapeutic intervention. Even if of rather good prognosis many patients with
NPM1c AML relapse and novel treatment approaches are needed.
Two recent studies demonstrated potent biological effects of ATRA and ATO particularly in combination in
NPM1c OCI-AML3 cells, patient-derived blast cells and patients [
13,
14]. Those effects include apoptosis induction, differentiation, proteasome-dependent degradation of the NPM1c oncoprotein in the cytosol, NPMwt nucleolar localization and blast clearance in relapsed/refractory patients treated in a compassionate setting [
13]. We compared biological effects of two BETi OTX015 (MK-8628) and JQ1 in
NPM1c cells as preclinical data suggested that the
NPM1c AML subtype may be particularly sensitive to this treatment approach [
15,
16]. It was shown that if
NPM1 is mutated, transcriptional repression of BRD4 by NPM1 is lost due to dissociation of both proteins [
16]. This results in increased expression of specific BET core signature including oncogenic
c-MYC and
BCL2 [
16]. Exposure of OCI-AML3 to the pan BET inhibitor I-BET151 resulted in the downregulation of
BCL2 and
c-MYC and subsequent induction of apoptosis and decreased proliferation. Furthermore, significant activity of I-BET was found in a
NPM1c mouse model [
16]. We have already demonstrated that OTX015 (MK-8628) and JQ1 induce apoptosis in OCI-AML3 cells and downregulation of
BCL2 and
c-MYC [
15]. Interestingly we found here that exposure to BETi induced differentiation, proteasome-dependent NPM1c degradation leading to disappearance of NPM1c in the cytosol and mainly nuclear localization of NPM1wt. Nevertheless, BETi triggered effects on
NPM1c cells yielding some differences compared to ATO + ATRA treatment. ATO + ATRA-induced apoptosis is P53 dependent in
NPM1c cells [
13,
14,
26]. Similar to ATO + ATRA, BETi lead to caspase 3 and PARP cleavage. In OCI-AML3 cells, ATO + ATRA induced strong upregulation of genes of the
TP53-dependent pathway (
BAX/
GADD45) while the anti-apoptotic gene
BCL2 was downregulated. In contrast, treatment with BETi lead to strong downregulation of the
TP53-dependent pathway also including
BCL2 which is a biomarker of BETi treatment [
15,
17]. OTX015 (MK-8628) and JQ1 did not induce P53 protein expression and TP53 knock out by CRISPR left apoptosis rather unaffected upon exposure to OTX015 (MK-8628) and JQ1 suggesting that apoptosis induced by BET inhibitors is at least partially
TP53 independent. This should be investigated in
TP53-mutated AML subtypes with complex karyotypes as
TP53 mutations occur only rarely upon clonal evolution in relapsed
NPM1c patients [
29]. BETi may overcome treatment resistance due to
TP53-independent apoptosis mechanisms. Interestingly, BETi induced differentiation comparable to ATO + ATRA, as detected by CD11b surface expression and by morphologic analysis in OCI-AML3 cells indicating that BETi are also capable to induce differentiation in
NPM1c AML as it has been shown in MLL-driven AML formerly [
19]. Furthermore, it would be interesting to study in the future the precise mechanisms of these drugs on differentiation and to design comprehensive drug combinations. It was recently shown that
NPM1c abrogates monocyte and granulocyte terminal differentiation by disrupting the PU.1/CEBPA/RUNX1 interplay [
30]. Especially combinations with the hypomethylating agent decitabine could be of potential interest as it drives granulocytic differentiation.
It was demonstrated that ATO + ATRA degrade the NPM1c oncoprotein in
NPM1c cells and this degradation is at least in part dependent on proteasome activity [
13]. Nevertheless, the precise mechanisms of NPM1c protein ubiquitination and degradation are unknown. It is thought that upon degradation, NPM1c-NPMwt oligomerization is disrupted and NPM1wt accumulates mainly in the nucleus where it exerts again its tumor-suppressive activity leading to differentiation and apoptosis [
16,
27]. Interestingly, we could show that BETi also lead to proteasome-dependent degradation of NPM1c in the cytosol and to main localization of NPM1 in the nucleus and it seems that this degradation is a common downstream effect of different treatment approaches. As shown by Dawson et al. [
16] NPMwt-NPMwt oligomers shuttle from the nucleus to the cytosol. In
NPM1c leukemic cells NPM1wt and NPM1c form an oligomer abrogating NPM1wt onco-suppressive activity. In NPM1wt cells, NPM1wt interacts with BRD4 in the nucleus and abrogates BRD4-mediated leukemogenic activity [
16]. In our experiments BRD4 expression is suppressed upon BETi treatment in the nucleus. This suggests that restoration of the NPM1wt/BRD4 equilibrium in the nucleus of
NPM1c cells is essential for the efficacy of BETi in
NPM1c cells and differs from action induced by ATO + ATRA in
NPM1c cells.
Intriguingly, the
NPM1c cell line IMS-M2 is resistant to BETi treatment. Upon treatment with OTX015 (MK-8628) and JQ1 no apoptosis, differentiation, or NPM1c degradation could be observed. We performed gene profiling and BETi downregulate a BET-specific core gene signature in OCI-AML3 and IMS-M2 cells demonstrating that BETi trigger a common core gene signature reported for
NPM1c AML. We demonstrate here with gene profiling analysis that IMS-M2 cells yield a resistance signature including upregulation of the LSC pathways MAPK, JAK-STAT, and Wnt/Beta-catenin signaling pathway. These pathways were shown to confer generally resistance to BETi in the LSC compartment and in BETi-resistant cell lines and cell clones [
24,
25]. We also found significant upregulation of the VEGF pathway also known to be associated with BETi resistance [
24]. Our results indicate that
NPM1c AML is heterogenous even if AML with NPM1 mutation is a distinct genetic entity in the revised World Health Organization classification [
4]. Distinct co-mutations may impact on response to therapy and expression of different levels of LSC gene pathways may contribute to this heterogeneity. Two distinct subtypes within
NPM1c AML patients were recently defined, which were labeled as primitive and committed based on the respective presence or absence of a stem cell signature which is in line with our results [
31].
As shown by our microarray data
NPM1c OCI-AML3 and IMS-M2 cell lines express the same HOX gene signature as published by Alcalay et al. for NPM1c patients [
10]. ATO + ATRA downregulate the specific
NPM1c HOX gene signature as it was recently reported for Selinexor treatment of
NPM1c cells and this suggests a HOX gene-dependent pathway to trigger cell death and differentiation induced by these drugs in
NPM1c cells [
11]. On the other hand, as published by Dawson et al. BETi trigger a core BET-responsive transcriptional program containing BCL-2 and c-MYC [
16]. We confirm that this program is also downregulated in OCI-AML3 and IMS-M2 cells without downregulation of the
NPM1c-specific HOX program. This suggests a
HOX-independent mechanism mediated by BCL-2 and c-MYC downregulation. Furthermore, in IMS-M2 cells resistance to BETi is mediated by upregulation of LSC pathways independently of the downregulation of the core BET-responsive transcriptional program.
As reported formerly for ATO + ATRA treatment, we could show the disappearance of NPM1c pattern in the cytosol in NPM1c cell lines and primary AML blasts upon treatment with BETi. Interestingly, NPM1c is not degraded in IMS-M2 by BETi cells but we could observe NPM1c disappearance in the cytosol in those cells. This indicates that BETi may interfere with NPM1c/NPM1wt oligomerization and that resistance mechanisms via deregulated gene pathways exert their activity up- or downstream in the tumor suppressive action of NPM1wt in IMS-M2 cells.
We could also demonstrate in vivo activity of OTX015 (MK-8628) in a patient with relapsing
NPM1c AML treated in the phase I dose escalating multicenter trial in hematologic diseases (NCT01713582). On day 1 of treatment with 120 mg once daily OTX015 (MK-8628) the NPM1 protein (wt + c) was localized in the cytosol in bone marrow blast cells while on day 22 the NPM1c disappeared from the cytosol. This illustrates in vivo activity of BETi in an AML patient and recapitulates effects observed upon treatment with ATO + ATRA in relapsed/refractory
NPM1c patients [
13]. Furthermore, detection of NPM1 translocations in patient cells could be used as biomarker for clinical activity of different drugs in future clinical trials.