The Anti-Fibrotic Effect of Cold Atmospheric Plasma on Localized Scleroderma In Vitro and In Vivo
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plasma Device and the Treatment of Cells and Animals
2.2. Cell Lines and Cell Culture Conditions
2.3. Animals and Treatment Groups
2.4. Isolation of Ribonucleic Acid (RNA) and Reverse Transcription
2.5. Quantitative Real-Time Polymerase Chain Reaction (PCR) Analysis
2.6. Immunohistochemical Analysis
2.7. Immunofluorescence Analysis
2.8. Spheroid Migration Assay
2.9. Co-Culture Assay
2.10. Statistical Analysis
3. Results
3.1. Pro-Fibrotic Gene Expression in Untreated and CAP-Treated hNF, hAF and hLSF
3.2. Migration of CAP-Treated hNF, hAF and hLSF
3.3. Expression of Key Mediators in the Induction of Fibrogenesis in Scleroderma Analyzed in hNF, hAF and hLSF Co-Cultured with CAP-Treated hEK
3.4. Examination of the Cytoskeletal Organization in hNF, hAF, and hLSF after CAP Treatment
3.5. Examination of the Dermal Diameter, the Collagen Content and the Presence of Macrophages in the BLM-Induced Fibrosis Model after CAP-Treatment
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Murray, K.J.; Laxer, R.M. Scleroderma in children and adolescents. Rheum. Dis. Clin. N. Am. 2002, 28, 603–624. [Google Scholar] [CrossRef]
- Peterson, L.S.; Nelson, A.M.; Su, W.D. Classification of morphea (localized scleroderma). Mayo Clin. Proc. 1995, 70, 1068–1076. [Google Scholar] [CrossRef] [PubMed]
- Careta, M.F.; Romiti, R. Localized scleroderma: Clinical spectrum and therapeutic update. An. Bras. Dermatol. 2015, 90, 62–73. [Google Scholar] [CrossRef] [Green Version]
- Leask, A.; Abraham, D.J. TGF-beta signaling and the fibrotic response. FASEB J. 2004, 18, 816–827. [Google Scholar] [CrossRef]
- Branton, M.H.; Kopp, J.B. TGF-beta and fibrosis. Microbes Infect. 1999, 1, 1349–1365. [Google Scholar] [CrossRef]
- Mishra, R.; Zhu, L.; Eckert, R.L.; Simonson, M.S. TGF-β-regulated collagen type I accumulation: Role of Src-based signals. Am. J. Physiol. Cell Physiol. 2007, 292, C1361–C1369. [Google Scholar] [CrossRef] [Green Version]
- Roberts, A.B.; McCune, B.K.; Sporn, M.B. TGF-beta: Regulation of extracellular matrix. Kidney Int. 1992, 41, 557–559. [Google Scholar] [CrossRef] [Green Version]
- Carthy, J.M. TGFβ signaling and the control of myofibroblast differentiation: Implications for chronic inflammatory disorders. J. Cell. Physiol. 2018, 233, 98–106. [Google Scholar] [CrossRef] [Green Version]
- Gu, L.; Zhu, Y.J.; Yang, X.; Guo, Z.J.; Xu, W.B.; Tian, X.L. Effect of TGF-β/Smad signaling pathway on lung myofibroblast differentiation. Acta Pharmacol. Sin. 2007, 28, 382–391. [Google Scholar] [CrossRef] [Green Version]
- Rao, B.; Malathi, N.; Narashiman, S.; Rajan, S.T. Evaluation of myofibroblasts by expression of alpha smooth muscle actin: A marker in fibrosis, dysplasia and carcinoma. JCDR 2014, 8, ZC14. [Google Scholar]
- Hall, M.C.; Young, D.A.; Waters, J.G.; Rowan, A.D.; Chantry, A.; Edwards, D.R.; Clark, I.M. The comparative role of activator protein 1 and Smad factors in the regulation of Timp-1 and MMP-1 gene expression by transforming growth factor-β1. J. Biol. Chem. 2003, 278, 10304–10313. [Google Scholar] [CrossRef] [Green Version]
- Akira, S.; Hirano, T.; Taga, T.; Kishimoto, T. Biology of multifunctional cytokines: IL 6 and related molecules (IL 1 and TNF). FASEB J. 1990, 4, 2860–2867. [Google Scholar] [CrossRef]
- Larsen, C.G.; Anderson, A.O.; Oppenheim, J.J.; Matsushima, K. Production of interleukin-8 by human dermal fibroblasts and keratinocytes in response to interleukin-1 or tumour necrosis factor. Immunology 1989, 68, 31–36. [Google Scholar]
- Dinarello, C.A. Proinflammatory cytokines. Chest 2000, 118, 503–508. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Yan, J.W.; Wang, Y.J.; Wan, Y.N.; Wang, B.X.; Tao, J.H.; Chen, B.; Li, B.Z.; Yang, G.J.; Wang, J. Association of interleukin 1 family with systemic sclerosis. Inflammation 2014, 37, 1213–1220. [Google Scholar] [CrossRef]
- Distler, O.; Cozzio, A. Systemic sclerosis and localized scleroderma—Current concepts and novel targets for therapy. Semin. Immunopathol. 2016, 38, 87–95. [Google Scholar] [CrossRef]
- Knobler, R.; Moinzadeh, P.; Hunzelmann, N.; Kreuter, A.; Cozzio, A.; Mouthon, L.; Cutolo, M.; Rongioletti, F.; Denton, C.P.; Rudnicka, L.; et al. European Dermatology Forum S1-guideline on the diagnosis and treatment of sclerosing diseases of the skin, Part 1: Localized scleroderma, systemic sclerosis and overlap syndromes. J. Eur. Acad. Dermatol. Venereol. 2017, 31, 1401–1424. [Google Scholar] [CrossRef]
- Kreuter, A.; Krieg, T.; Worm, M.; Wenzel, J.; Moinzadeh, P.; Kuhn, A.; Aberer, E.; Scharffetter-Kochanek, K.; Horneff, G.; Reil, E.; et al. German guidelines for the diagnosis and therapy of localized scleroderma. J. Dtsch. Dermatol. Ges. 2016, 14, 199–216. [Google Scholar] [CrossRef] [Green Version]
- Gordon Spratt, E.; Gorcey, L.; Soter, N.; Brauer, J. Phototherapy, photodynamic therapy and photophoresis in the treatment of connective-tissue diseases: A review. Br. J. Dermatol. 2015, 173, 19–30. [Google Scholar] [CrossRef] [PubMed]
- Zhao, M.; Wu, J.; Wu, H.; Sawalha, A.H.; Lu, Q. Clinical Treatment Options in Scleroderma: Recommendations and Comprehensive Review. Clin. Rev. Allergy Immunol. 2021. [Google Scholar] [CrossRef] [PubMed]
- Kreuter, A.; Hyun, J.; Stücker, M.; Sommer, A.; Altmeyer, P.; Gambichler, T. A randomized controlled study of low-dose UVA1, medium-dose UVA1, and narrowband UVB phototherapy in the treatment of localized scleroderma. J. Am. Acad. Dermatol. 2006, 54, 440–447. [Google Scholar] [CrossRef]
- Vasquez, R.; Jabbar, A.; Khan, F.; Buethe, D.; Ahn, C.; Jacobe, H. Recurrence of morphea after successful ultraviolet A1 phototherapy: A cohort study. J. Am. Acad. Dermatol. 2014, 70, 481–488. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Petersen, M.J.; Hansen, C.; Craig, S. Ultraviolet A irradiation stimulates collagenase production in cultured human fibroblasts. J. Investig. Dermatol. 1992, 99, 440–444. [Google Scholar] [CrossRef] [Green Version]
- Scharffetter, K.; Wlaschek, M.; Hogg, A.; Bolsen, K.; Schothorst, A.; Goerz, G.; Krieg, T.; Plewig, G. UVA irradiation induces collagenase in human dermal fibroblasts in vitro and in vivo. Arch. Dermatol. Res. 1991, 283, 506–511. [Google Scholar] [CrossRef]
- Tyrrell, R.M. Modulation of gene expression by the oxidative stress generated in human skin cells by UVA radiation and the restoration of redox homeostasis. Photochem. Photobiol. Sci. 2012, 11, 135–147. [Google Scholar] [CrossRef]
- Gambichler, T.; Skrygan, M.; Tomi, N.; Breuksch, S.; Altmeyer, P.; Kreuter, A. Significant downregulation of transforming growth factor-β signal transducers in human skin following ultraviolet-A1 irradiation. Br. J. Dermatol. 2007, 156, 951–956. [Google Scholar] [CrossRef]
- Arndt, S.; Lissner, C.; Unger, P.; Baumler, W.; Berneburg, M.; Karrer, S. Biological effects of a new ultraviolet A1 prototype based on light-emitting diodes on the treatment of localized scleroderma. Exp. Dermatol. 2020, 29, 1199–1208. [Google Scholar] [CrossRef] [PubMed]
- Kreuter, A. Localized scleroderma. Dermatol. Ther. 2012, 25, 135–147. [Google Scholar] [CrossRef] [PubMed]
- Fitch, P.G.; Rettig, P.; Burnham, J.M.; Finkel, T.H.; Yan, A.C.; Akin, E.; Cron, R.Q. Treatment of pediatric localized scleroderma with methotrexate. J. Rheumatol. 2006, 33, 609–614. [Google Scholar]
- Martini, G.; Ramanan, A.V.; Falcini, F.; Girschick, H.; Goldsmith, D.P.; Zulian, F. Successful treatment of severe or methotrexate-resistant juvenile localized scleroderma with mycophenolate mofetil. Rheumatology 2009, 48, 1410–1413. [Google Scholar] [CrossRef] [Green Version]
- Torok, K.S.; Arkachaisri, T. Methotrexate and corticosteroids in the treatment of localized scleroderma: A standardized prospective longitudinal single-center study. J. Rheumatol. 2012, 39, 286–294. [Google Scholar] [CrossRef] [Green Version]
- Uziel, Y.; Feldman, B.M.; Krafchik, B.R.; Yeung, R.S.; Laxer, R.M. Methotrexate and corticosteroid therapy for pediatric localized scleroderma. J. Pediatr. 2000, 136, 91–95. [Google Scholar] [CrossRef]
- Kim, S.R.; Charos, A.; Damsky, W.; Heald, P.; Girardi, M.; King, B.A. Treatment of generalized deep morphea and eosinophilic fasciitis with the Janus kinase inhibitor tofacitinib. JAAD Case Rep. 2018, 4, 443. [Google Scholar] [CrossRef] [PubMed]
- Damsky, W.; Patel, D.; Garelli, C.J.; Garg, M.; Wang, A.; Dresser, K.; Deng, A.; Harris, J.E.; Richmond, J.; King, B. Jak Inhibition Prevents Bleomycin-Induced Fibrosis in Mice and Is Effective in Patients with Morphea. J. Investig. Dermatol. 2020, 140, 1446–1449. [Google Scholar] [CrossRef]
- Bonella, F.; Stowasser, S.; Wollin, L. Idiopathic pulmonary fibrosis: Current treatment options and critical appraisal of nintedanib. Ann. Rheum. Dis. 2015, 9, 6407. [Google Scholar]
- Huang, J.; Beyer, C.; Palumbo-Zerr, K.; Zhang, Y.; Ramming, A.; Distler, A.; Gelse, K.; Distler, O.; Schett, G.; Wollin, L. Nintedanib inhibits fibroblast activation and ameliorates fibrosis in preclinical models of systemic sclerosis. Ann. Rheum. Dis. 2016, 75, 883–890. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Torok, K.S.; Li, S.C.; Jacobe, H.M.; Taber, S.F.; Stevens, A.M.; Zulian, F.; Lu, T.T. Immunopathogenesis of Pediatric Localized Scleroderma. Front. Immunol. 2019, 10, 908. [Google Scholar] [CrossRef] [Green Version]
- Haertel, B.; von Woedtke, T.; Weltmann, K.D.; Lindequist, U. Non-thermal atmospheric-pressure plasma possible application in wound healing. Biomol. Ther. 2014, 22, 477–490. [Google Scholar] [CrossRef] [Green Version]
- Heinlin, J.; Isbary, G.; Stolz, W.; Morfill, G.; Landthaler, M.; Shimizu, T.; Steffes, B.; Nosenko, T.; Zimmermann, J.; Karrer, S. Plasma applications in medicine with a special focus on dermatology. J. Eur. Acad. Dermatol. Venereol. 2011, 25, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Heinlin, J.; Morfill, G.; Landthaler, M.; Stolz, W.; Isbary, G.; Zimmermann, J.L.; Shimizu, T.; Karrer, S. Plasma medicine: Possible applications in dermatology. J. Dtsch. Dermatol. Ges. 2010, 8, 968–976. [Google Scholar] [CrossRef]
- Hirst, A.M.; Frame, F.M.; Arya, M.; Maitland, N.J.; O’Connell, D. Low temperature plasmas as emerging cancer therapeutics: The state of play and thoughts for the future. Tumour Biol. 2016, 37, 7021–7031. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Heinlin, J.; Isbary, G.; Stolz, W.; Zeman, F.; Landthaler, M.; Morfill, G.; Shimizu, T.; Zimmermann, J.L.; Karrer, S. A randomized two-sided placebo-controlled study on the efficacy and safety of atmospheric non-thermal argon plasma for pruritus. J. Eur. Acad. Dermatol. Venereol. 2013, 27, 324–331. [Google Scholar] [CrossRef] [PubMed]
- Isbary, G.; Shimizu, T.; Li, Y.F.; Stolz, W.; Thomas, H.M.; Morfill, G.E.; Zimmermann, J.L. Cold atmospheric plasma devices for medical issues. Expert Rev. Med. Devices 2013, 10, 367–377. [Google Scholar] [CrossRef]
- Karrer, S.; Arndt, S. Plasma medicine in dermatology: Mechanisms of action and clinical applications. Hautarzt 2015, 66, 819–828. [Google Scholar] [CrossRef] [PubMed]
- Mai-Prochnow, A.; Murphy, A.B.; McLean, K.M.; Kong, M.G.; Ostrikov, K.K. Atmospheric pressure plasmas: Infection control and bacterial responses. Int. J. Antimicrob. Agents 2014, 43, 508–517. [Google Scholar] [CrossRef]
- Brehmer, F.; Haenssle, H.A.; Daeschlein, G.; Ahmed, R.; Pfeiffer, S.; Gorlitz, A.; Simon, D.; Schon, M.P.; Wandke, D.; Emmert, S. Alleviation of chronic venous leg ulcers with a hand-held dielectric barrier discharge plasma generator (PlasmaDerm((R)) VU-2010): Results of a monocentric, two-armed, open, prospective, randomized and controlled trial (NCT01415622). J. Eur. Acad. Dermatol. Venereol. 2015, 29, 148–155. [Google Scholar] [CrossRef] [PubMed]
- Isbary, G.; Heinlin, J.; Shimizu, T.; Zimmermann, J.L.; Morfill, G.; Schmidt, H.U.; Monetti, R.; Steffes, B.; Bunk, W.; Li, Y.; et al. Successful and safe use of 2 min cold atmospheric argon plasma in chronic wounds: Results of a randomized controlled trial. Br. J. Dermatol. 2012, 167, 404–410. [Google Scholar] [CrossRef]
- Isbary, G.; Stolz, W.; Shimizu, T.; Monetti, R.; Bunk, W.; Schmidt, H.-U.; Morfill, G.; Klämpfl, T.; Steffes, B.; Thomas, H.; et al. Cold atmospheric argon plasma treatment may accelerate wound healing in chronic wounds: Results of an open retrospective randomized controlled study in vivo. Clin. Plasma Med. J. 2013, 1, 25–30. [Google Scholar] [CrossRef]
- Kramer, A.; Lademann, J.; Bender, C.; Sckell, A.; Hartmann, B.; Münch, S.; Hinz, P.; Ekkernkamp, A.; Matthes, R.; Koban, I.; et al. Suitability of tissue tolerable plasmas (ttp) for the management of chronic wounds. Clin. Plasma Med. 2013, 1, 11–18. [Google Scholar] [CrossRef]
- Mohd Nasir, N.; Lee, B.K.; Yap, S.S.; Thong, K.L.; Yap, S.L. Cold plasma inactivation of chronic wound bacteria. Arch. Biochem. Biophys. 2016, 605, 76–85. [Google Scholar] [CrossRef]
- Nosenko, T.; Shimizu, T.; Morfill, G.E. Designing plasmas for chronic wound disinfection. New J. Phys. 2009, 11, 115013. [Google Scholar] [CrossRef] [Green Version]
- Ruttermann, M.; Maier-Hasselmann, A.; Nink-Grebe, B.; Burckhardt, M. Local treatment of chronic wounds: In patients with peripheral vascular disease, chronic venous insufficiency, and diabetes. Dtsch. Arztebl. Int. 2013, 110, 25–31. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Schmidt, A.; Woedtke, T.V.; Stenzel, J.; Lindner, T.; Polei, S.; Vollmar, B.; Bekeschus, S. One Year Follow-Up Risk Assessment in SKH-1 Mice and Wounds Treated with an Argon Plasma Jet. Int. J. Mol. Sci. 2017, 18, 868. [Google Scholar] [CrossRef] [PubMed]
- Ulrich, C.; Kluschke, F.; Patzelt, A.; Vandersee, S.; Czaika, V.A.; Richter, H.; Bob, A.; Hutten, J.; Painsi, C.; Huge, R.; et al. Clinical use of cold atmospheric pressure argon plasma in chronic leg ulcers: A pilot study. J. Wound Care 2015, 24, 196–203. [Google Scholar] [CrossRef]
- Balzer, J.; Heuer, K.; Demir, E.; Hoffmanns, M.A.; Baldus, S.; Fuchs, P.C.; Awakowicz, P.; Suschek, C.V.; Oplander, C. Non-Thermal Dielectric Barrier Discharge (DBD) Effects on Proliferation and Differentiation of Human Fibroblasts Are Primary Mediated by Hydrogen Peroxide. PLoS ONE 2015, 10, e0144968. [Google Scholar] [CrossRef]
- Brun, P.; Pathak, S.; Castagliuolo, I.; Palu, G.; Brun, P.; Zuin, M.; Cavazzana, R.; Martines, E. Helium generated cold plasma finely regulates activation of human fibroblast-like primary cells. PLoS ONE 2014, 9, e104397. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liebmann, J.; Scherer, J.; Bibinov, N.; Rajasekaran, P.; Kovacs, R.; Gesche, R.; Awakowicz, P.; Kolb-Bachofen, V. Biological effects of nitric oxide generated by an atmospheric pressure gas-plasma on human skin cells. Nitric Oxide 2011, 24, 8–16. [Google Scholar] [CrossRef]
- Schmidt, A.; Dietrich, S.; Steuer, A.; Weltmann, K.D.; von Woedtke, T.; Masur, K.; Wende, K. Non-thermal plasma activates human keratinocytes by stimulation of antioxidant and phase II pathways. J. Biol. Chem. 2015, 290, 6731–6750. [Google Scholar] [CrossRef] [Green Version]
- Arndt, S.; Landthaler, M.; Zimmermann, J.L.; Unger, P.; Wacker, E.; Shimizu, T.; Li, Y.F.; Morfill, G.E.; Bosserhoff, A.K.; Karrer, S. Effects of cold atmospheric plasma (CAP) on ss-defensins, inflammatory cytokines, and apoptosis-related molecules in keratinocytes in vitro and in vivo. PLoS ONE 2015, 10, e0120041. [Google Scholar] [CrossRef] [Green Version]
- Arndt, S.; Unger, P.; Wacker, E.; Shimizu, T.; Heinlin, J.; Li, Y.F.; Thomas, H.M.; Morfill, G.E.; Zimmermann, J.L.; Bosserhoff, A.K.; et al. Cold atmospheric plasma (CAP) changes gene expression of key molecules of the wound healing machinery and improves wound healing in vitro and in vivo. PLoS ONE 2013, 8, e79325. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Schmidt, A.; von Woedtke, T.; Vollmar, B.; Hasse, S.; Bekeschus, S. Nrf2 signaling and inflammation are key events in physical plasma-spurred wound healing. Theranostics 2019, 9, 1066–1084. [Google Scholar] [CrossRef] [PubMed]
- Bekeschus, S.; Masur, K.; Kolata, J.; Wende, K.; Schmidt, A.; Bundscherer, L.; Barton, A.; Kramer, A.; Broker, B.; Weltmann, K.D. Human Mononuclear Cell Survival and Proliferation is Modulated by Cold Atmospheric Plasma Jet. Plasma Process. Polym. 2013, 10, 706–713. [Google Scholar] [CrossRef]
- Hasse, S.; Duong Tran, T.; Hahn, O.; Kindler, S.; Metelmann, H.R.; von Woedtke, T.; Masur, K. Induction of proliferation of basal epidermal keratinocytes by cold atmospheric-pressure plasma. Clin. Exp. Dermatol. 2016, 41, 202–209. [Google Scholar] [CrossRef] [PubMed]
- Kalghatgi, S.; Friedman, G.; Fridman, A.; Clyne, A.M. Endothelial cell proliferation is enhanced by low dose non-thermal plasma through fibroblast growth factor-2 release. Ann. Biomed. Eng. 2010, 38, 748–757. [Google Scholar] [CrossRef] [PubMed]
- Ushio-Fukai, M.; Alexander, R.W. Reactive oxygen species as mediators of angiogenesis signaling: Role of NAD(P)H oxidase. Mol. Cell. Biochem. 2004, 264, 85–97. [Google Scholar] [CrossRef]
- Arjunan, K.P.; Friedman, G.; Fridman, A.; Clyne, A.M. Non-thermal dielectric barrier discharge plasma induces angiogenesis through reactive oxygen species. J. R. Soc. Interface 2012, 9, 147–157. [Google Scholar] [CrossRef] [Green Version]
- Arndt, S.; Unger, P.; Berneburg, M.; Bosserhoff, A.K.; Karrer, S. Cold atmospheric plasma (CAP) activates angiogenesis-related molecules in skin keratinocytes, fibroblasts and endothelial cells and improves wound angiogenesis in an autocrine and paracrine mode. J. Dermatol. Sci. 2018, 89, 181–190. [Google Scholar] [CrossRef]
- Heinlin, J.; Zimmermann, J.L.; Zeman, F.; Bunk, W.; Isbary, G.; Landthaler, M.; Maisch, T.; Monetti, R.; Morfill, G.; Shimizu, T.; et al. Randomized placebo-controlled human pilot study of cold atmospheric argon plasma on skin graft donor sites. Wound Repair Regen. 2013, 21, 800–807. [Google Scholar] [CrossRef]
- Isbary, G.; Morfill, G.; Schmidt, H.U.; Georgi, M.; Ramrath, K.; Heinlin, J.; Karrer, S.; Landthaler, M.; Shimizu, T.; Steffes, B.; et al. A first prospective randomized controlled trial to decrease bacterial load using cold atmospheric argon plasma on chronic wounds in patients. Br. J. Dermatol. 2010, 163, 78–82. [Google Scholar] [CrossRef]
- Wirtz, M.; Stoffels, I.; Dissemond, J.; Schadendorf, D.; Roesch, A. Actinic keratoses treated with cold atmospheric plasma. J. Eur. Acad. Dermatol. Venereol. 2018, 32, e37–e39. [Google Scholar] [CrossRef]
- Maisch, T.; Bosserhoff, A.K.; Unger, P.; Heider, J.; Shimizu, T.; Zimmermann, J.L.; Morfill, G.E.; Landthaler, M.; Karrer, S. Investigation of toxicity and mutagenicity of cold atmospheric argon plasma. Environ. Mol. Mutagen. 2017, 58, 172–177. [Google Scholar] [CrossRef]
- Arndt, S.; Karrer, S.; Hellerbrand, C.; Bosserhoff, A.K. Bone Morphogenetic Protein-6 Inhibits Fibrogenesis in Scleroderma Offering Treatment Options for Fibrotic Skin Disease. J. Investig. Dermatol. 2019, 139, 1914–1924.e6. [Google Scholar] [CrossRef]
- Yamamoto, T. The bleomycin-induced scleroderma model: What have we learned for scleroderma pathogenesis? Arch. Dermatol. Res. 2006, 297, 333–344. [Google Scholar] [CrossRef]
- Yamamoto, T.; Nishioka, K. Cellular and molecular mechanisms of bleomycin-induced murine scleroderma: Current update and future perspective. Exp. Dermatol. 2005, 14, 81–95. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yamamoto, T.; Takagawa, S.; Katayama, I.; Yamazaki, K.; Hamazaki, Y.; Shinkai, H.; Nishioka, K. Animal model of sclerotic skin. I: Local injections of bleomycin induce sclerotic skin mimicking scleroderma. J. Investig. Dermatol. 1999, 112, 456–462. [Google Scholar] [CrossRef] [Green Version]
- Arndt, S.; Wacker, E.; Dorn, C.; Koch, A.; Saugspier, M.; Thasler, W.E.; Hartmann, A.; Bosserhoff, A.K.; Hellerbrand, C. Enhanced expression of BMP6 inhibits hepatic fibrosis in non-alcoholic fatty liver disease. Gut 2015, 64, 973–981. [Google Scholar] [CrossRef] [Green Version]
- Arndt, S.; Schmidt, J.; Wacker, E.; Karrer, S.; Bosserhoff, A.K. Fussel-15, a new player in wound healing, is deregulated in keloid and localized scleroderma. Am. J. Pathol. 2011, 178, 2622–2631. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ruedel, A.; Dietrich, P.; Schubert, T.; Hofmeister, S.; Hellerbrand, C.; Bosserhoff, A.K. Expression and function of microRNA-188-5p in activated rheumatoid arthritis synovial fibroblasts. Int. J. Clin. Exp. Pathol. 2015, 8, 4953. [Google Scholar] [PubMed]
- Kleineidam, B.; Nokhbehsaim, M.; Deschner, J.; Wahl, G. Effect of cold plasma on periodontal wound healing—An in vitro study. Clin. Oral Investig. 2019, 23, 1941–1950. [Google Scholar] [CrossRef]
- Schmidt, A.; Bekeschus, S.; Wende, K.; Vollmar, B.; von Woedtke, T. A cold plasma jet accelerates wound healing in a murine model of full-thickness skin wounds. Exp. Dermatol. 2017, 26, 156–162. [Google Scholar] [CrossRef] [PubMed]
- Abraham, D.J.; Eckes, B.; Rajkumar, V.; Krieg, T. New developments in fibroblast and myofibroblast biology: Implications for fibrosis and scleroderma. Curr. Rheumatol. Rep. 2007, 9, 136–143. [Google Scholar] [CrossRef] [PubMed]
- Sandbo, N.; Ngam, C.; Torr, E.; Kregel, S.; Kach, J.; Dulin, N. Control of myofibroblast differentiation by microtubule dynamics through a regulated localization of mDia2. J. Biol. Chem. 2013, 288, 15466–15473. [Google Scholar] [CrossRef] [Green Version]
- Korn, J.H. What’s wrong with the scleroderma fibroblast? Clin. Exp. Rheumatol. 2004, 22, S64–S65. [Google Scholar] [PubMed]
- Yamamoto, T.; Kuroda, M.; Nishioka, K. Animal model of sclerotic skin. III: Histopathological comparison of bleomycin-induced scleroderma in various mice strains. Arch. Dermatol. Res. 2000, 292, 535–541. [Google Scholar] [CrossRef] [PubMed]
- Yamamoto, T.; Nishioka, K. Animal model of sclerotic skin. V: Increased expression of alpha-smooth muscle actin in fibroblastic cells in bleomycin-induced scleroderma. Clin. Immunol. 2002, 102, 77–83. [Google Scholar] [CrossRef]
- Cui, H.S.; Joo, S.Y.; Lee, D.H.; Yu, J.H.; Jeong, J.H.; Kim, J.B.; Seo, C.H. Low temperature plasma induces angiogenic growth factor via up-regulating hypoxia–inducible factor 1α in human dermal fibroblasts. Arch. Biochem. Biophys. 2017, 630, 9–17. [Google Scholar] [CrossRef]
- Wiegand, C.; Fink, S.; Beier, O.; Horn, K.; Pfuch, A.; Schimanski, A.; Grunler, B.; Hipler, U.C.; Elsner, P. Dose- and Time-Dependent Cellular Effects of Cold Atmospheric Pressure Plasma Evaluated in 3D Skin Models. Skin Pharmacol. Physiol. 2016, 29, 257–265. [Google Scholar] [CrossRef]
- Zhang, J.P.; Guo, L.; Chen, Q.L.; Zhang, K.Y.; Wang, T.; An, G.Z.; Zhang, X.F.; Li, H.P.; Ding, G.R. Effects and mechanisms of cold atmospheric plasma on skin wound healing of rats. Contrib. Plasma Phys. 2019, 59, 92–101. [Google Scholar] [CrossRef] [Green Version]
- Nakajima, Y.; Mukai, K.; Rahayu, H.S.; Nur, M.; Ishijima, T.; Enomoto, H.; Uesugi, Y.; Sugama, J.; Nakatani, T. Cold plasma on full-thickness cutaneous wound accelerates healing through promoting inflammation, re-epithelialization and wound contraction. Clin. Plasma Med. 2014, 2, 28–35. [Google Scholar]
- Xingmin, S.; Jingfen, C.; Guimin, X.; Hongbin, R.; Sile, C.; Zhengshi, C.; Jinren, L.; Chongya, H.; Guanjun, Z.; Xili, W. Effect of cold plasma on cell viability and collagen synthesis in cultured murine fibroblasts. Plasma Sci. Technol. 2016, 18, 353. [Google Scholar]
- Wynn, T.A. Cellular and molecular mechanisms of fibrosis. J. Pathol. 2008, 214, 199–210. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wenzel, T.; Carvajal Berrio, D.A.; Daum, R.; Reisenauer, C.; Weltmann, K.D.; Wallwiener, D.; Brucker, S.Y.; Schenke-Layland, K.; Brauchle, E.M.; Weiss, M. Molecular Effects and Tissue Penetration Depth of Physical Plasma in Human Mucosa Analyzed by Contact- and Marker-Independent Raman Microspectroscopy. ACS Appl. Mater. Interfaces 2019, 11, 42885–42895. [Google Scholar] [CrossRef] [PubMed]
- Kuroda, K.; Shinkai, H. Gene expression of types I and III collagen, decorin, matrix metalloproteinases and tissue inhibitors of metalloproteinases in skin fibroblasts from patients with systemic sclerosis. Arch. Dermatol. Res. 1997, 289, 567–572. [Google Scholar] [CrossRef]
- Yuan, W.; Varga, J. Transforming growth factor-beta repression of matrix metalloproteinase-1 in dermal fibroblasts involves Smad3. J. Biol. Chem. 2001, 276, 38502–38510. [Google Scholar] [CrossRef] [Green Version]
- Balbir-Gurman, A.; Braun-Moscovici, Y. Scleroderma–New aspects in pathogenesis and treatment. Best Pract. Res. Clin. Rheumatol. 2012, 26, 13–24. [Google Scholar] [CrossRef] [PubMed]
- Kang, S.U.; Kim, Y.S.; Kim, Y.E.; Park, J.K.; Lee, Y.S.; Kang, H.Y.; Jang, J.W.; Ryeo, J.B.; Lee, Y.; Shin, Y.S.; et al. Opposite effects of non-thermal plasma on cell migration and collagen production in keloid and normal fibroblasts. PLoS ONE 2017, 12, e0187978. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gauglitz, G.G.; Korting, H.C.; Pavicic, T.; Ruzicka, T.; Jeschke, M.G. Hypertrophic scarring and keloids: Pathomechanisms and current and emerging treatment strategies. Mol. Med. 2011, 17, 113–125. [Google Scholar] [CrossRef] [PubMed]
- Hartwig, S.; Doll, C.; Voss, J.O.; Hertel, M.; Preissner, S.; Raguse, J.D. Treatment of Wound Healing Disorders of Radial Forearm Free Flap Donor Sites Using Cold Atmospheric Plasma: A Proof of Concept. J. Oral Maxillofac. Surg. 2017, 75, 429–435. [Google Scholar] [CrossRef]
Primer Name | Forward Primer 5′→ 3′ | Reverse Primer 5′→ 3 | Condition 1 (Annealing, Melting) |
---|---|---|---|
β-actin | CTACGTCGCCCTGGACTTCGAGC | GATGGAGCCGCCGATCCACACGG | ann. 60 °C, melt. 85 °C |
Coll I | CGGCTCCTGCTCCTCTT | GGGGCAGTTCTTGGTCTC | ann. 60 °C, melt. 86 °C |
αSMA | GGCCGAGATCTCACTGACTAC | TTCATGGATGCCAGCAGA | ann. 58 °C, melt. 84 °C |
FAP | CGGCCCAGGCATCCCCATTT | CACTCTGACTGCAGGGACCACC | ann. 60 °C, melt. 76°C |
IL-6 | GGTACATCCTCGACGGCATCT | GTGCCTCTTTGCTGCTTTCAC | ann. 60 °C, melt. 79 °C |
TNFα | ATCCTGGGGGACCCAATCTA | AAAAGAAGGCACAGAGGCCA | ann. 60 °C, melt. 81 °C |
MMP-1 | TCACCAAGGTCTCTGAGGGTCAAGC | GGATGCCATCAATGTCATCCTGAGC | ann. 65 °C, melt. 80 °C |
(a) CAP Treatment Effects In Vitro | hNF | hAF | hLSF | |||
ctrl. | CAP | ctrl. | CAP | ctrl. | CAP | |
pro-fibrotic gene expression (Coll I, αSMA, FAP) in mono-culture | ↑ | ↑↑ | ↑↑ | ↔ | ↑↑ | ↔ |
pro-inflammatory gene expression (IL-6, TNFα) in co-culture | ↑ | ↑↑ | ↑↑ | ↔ | ↑↑ | ↓ |
pro-fibrotic gene expression (Coll I, αSMA) in co-culture | ↑ | ↑↑ | ↑↑ | ↔ | ↑↑ | ↔ |
expression of MMP-1 in co-culture | ↑↑ | ↔ | ↑ | ↑↑ | ↑ | ↑↑↑ |
migration (48 h after CAP treatment) | ↑ | ↑↑ | ↑↑ | ↓↓ | ↑↑ | ↓↓ |
cytoskeletal organization (F-actin fibers) | ↑ | ↔ | ↑↑ | ↓↓ | ↑↑ | ↓↓ |
(b) CAP Treatment Effects In Vivo | Untreated Group (1) | CAP-Treated Group (2) | ||||
ctrl. skin | BLM-ind. fibrosis | ctrl. skin | BLM-ind. fibrosis | |||
dermal thickness | ↑ | ↑↑↑ | ↑ | ↑↑ | ||
collagen content | ↑ | ↑↑↑ | ↑ | ↑↑ | ||
macrophages | ↑ | ↑↑↑ | ↑ | ↑↑ | ||
myofibroblasts | ↑ | ↑↑↑ | ↑ | ↑↑ |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Arndt, S.; Unger, P.; Bosserhoff, A.-K.; Berneburg, M.; Karrer, S. The Anti-Fibrotic Effect of Cold Atmospheric Plasma on Localized Scleroderma In Vitro and In Vivo. Biomedicines 2021, 9, 1545. https://doi.org/10.3390/biomedicines9111545
Arndt S, Unger P, Bosserhoff A-K, Berneburg M, Karrer S. The Anti-Fibrotic Effect of Cold Atmospheric Plasma on Localized Scleroderma In Vitro and In Vivo. Biomedicines. 2021; 9(11):1545. https://doi.org/10.3390/biomedicines9111545
Chicago/Turabian StyleArndt, Stephanie, Petra Unger, Anja-Katrin Bosserhoff, Mark Berneburg, and Sigrid Karrer. 2021. "The Anti-Fibrotic Effect of Cold Atmospheric Plasma on Localized Scleroderma In Vitro and In Vivo" Biomedicines 9, no. 11: 1545. https://doi.org/10.3390/biomedicines9111545
APA StyleArndt, S., Unger, P., Bosserhoff, A.-K., Berneburg, M., & Karrer, S. (2021). The Anti-Fibrotic Effect of Cold Atmospheric Plasma on Localized Scleroderma In Vitro and In Vivo. Biomedicines, 9(11), 1545. https://doi.org/10.3390/biomedicines9111545