Integrative Whole-Genome and Epigenome Profiling of cfDNA in Familial Prostate Cancer: Insights from a Pilot Study
Abstract
1. Introduction
2. Materials and Methods
2.1. Patient Cohort and Clinical Data Collection
2.2. Patients’ Blood Collection and Cell-Free DNA Extraction
2.3. cfDNA Sequencing
2.4. Data Analysis
3. Results
3.1. Somatic Variants Identified in cfDNA
3.2. Epigenetic Profiles and Allele-Specific Methylation
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| PCa | Prostate cancer |
| cfDNA | cell-free DNA |
| ASM | Allele-specific methylation |
| PSA | Prostate-Specific Antigen |
| BPH | Benign prostatic hyperplasia |
| ctDNA | Circulating tumor DNA |
| CNV | Copy number variations |
| 5mC | 5-methylcytosine |
| 5hmC | 5-hydroxymethylcytosine |
| AF | Allele Frequency |
| SNPs | Single Nucleotide Polymorphisms |
| SNVs | Single Nucleotide Variants |
| IGV | Integrative Genomics Viewer |
References
- Stamey, T.A.; Yang, N.; Hay, A.R.; McNeal, J.E.; Freiha, F.S.; Redwine, E. Prostate-specific antigen as a serum marker for adenocarcinoma of the prostate. N. Engl. J. Med. 1987, 317, 909–916. [Google Scholar] [CrossRef] [Scilit]
- Sundaresan, V.M.; Smani, S.; Rajwa, P.; Renzulli, J.; Sprenkle, P.C.; Kim, I.Y.; Leapman, M.S. Prostate-specific antigen screening for prostate cancer: Diagnostic performance, clinical thresholds, and strategies for refinement. Urol. Oncol. 2025, 43, 41–48. [Google Scholar] [CrossRef] [Scilit]
- Canby-Hagino, E.; Hernandez, J.; Brand, T.C.; Troyer, D.A.; Higgins, B.; Ankerst, D.P.; Thompson, I.M.; Leach, R.J.; Parekh, D.J. Prostate cancer risk with positive family history, normal prostate examination findings, and PSA less than 4.0 ng/mL. Urology 2007, 70, 748–752. [Google Scholar] [CrossRef] [Scilit]
- Ma, C.; Ericsson, C.; Carlsson, S.V.; Lilja, H.; Kibel, A.; Graff, R.E.; Plym, A.; Giovannucci, E.; Mucci, L.A.; Preston, M.A.; et al. Addition of a Genetic Risk Score for Identification of Men with a Low Prostate-specific Antigen Level in Midlife at Risk of Developing Lethal Prostate Cancer. Eur. Urol. Open Sci. 2023, 50, 27–30. [Google Scholar] [CrossRef] [Scilit]
- Siegel, R.L.; Miller, K.D.; Jemal, A. Cancer statistics, 2018. CA Cancer J. Clin. 2018, 68, 7–30. [Google Scholar] [CrossRef] [Scilit]
- Siegel, R.L.; Miller, K.D.; Fuchs, H.E.; Jemal, A. Cancer statistics, 2022. CA Cancer J. Clin. 2022, 72, 7–33. [Google Scholar] [CrossRef] [Scilit]
- Raychaudhuri, R.; Lin, D.W.; Montgomery, R.B. Prostate Cancer: A Review. JAMA 2025, 333, 1433–1446. [Google Scholar] [CrossRef] [Scilit]
- Eickelschulte, S.; Riediger, A.L.; Angeles, A.K.; Janke, F.; Duensing, S.; Sültmann, H.; Görtz, M. Biomarkers for the Detection and Risk Stratification of Aggressive Prostate Cancer. Cancers 2022, 14, 6094. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Boehm, B.E.; York, M.E.; Petrovics, G.; Kohaar, I.; Chesnut, G.T. Biomarkers of Aggressive Prostate Cancer at Diagnosis. Int. J. Mol. Sci. 2023, 24, 2185. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sekhoacha, M.; Riet, K.; Motloung, P.; Gumenku, L.; Adegoke, A.; Mashele, S. Prostate Cancer Review: Genetics, Diagnosis, Treatment Options, and Alternative Approaches. Molecules 2022, 27, 5730. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wilson, T.K.; Zishiri, O.T. Prostate Cancer: A Review of Genetics, Current Biomarkers and Personalised Treatments. Cancer Rep. 2024, 7, e70016. [Google Scholar] [CrossRef] [Scilit]
- Fontana, F.; Anselmi, M.; Limonta, P. Molecular mechanisms and genetic alterations in prostate cancer: From diagnosis to targeted therapy. Cancer Lett. 2022, 534, 215619. [Google Scholar] [CrossRef] [Scilit]
- Vietri, M.T.; D’Elia, G.; Caliendo, G.; Resse, M.; Casamassimi, A.; Passariello, L.; Albanese, L.; Cioffi, M.; Molinari, A.M. Hereditary Prostate Cancer: Genes Related, Target Therapy and Prevention. Int. J. Mol. Sci. 2021, 22, 3753. [Google Scholar] [CrossRef] [Scilit]
- Wang, A.; Shen, J.; Rodriguez, A.A.; Saunders, E.J.; Chen, F.; Janivara, R.; Darst, B.F.; Sheng, X.; Xu, Y.; Chou, A.J.; et al. Characterizing prostate cancer risk through multi-ancestry genome-wide discovery of 187 novel risk variants. Nat. Genet. 2023, 55, 2065–2074. [Google Scholar] [CrossRef] [Scilit]
- McNevin, C.S.; Cadoo, K.; Baird, A.-M.; Murchan, P.; Sheils, O.; McDermott, R.; Finn, S. Pathogenic BRCA Variants as Biomarkers for Risk in Prostate Cancer. Cancers 2021, 13, 5697. [Google Scholar] [CrossRef] [Scilit]
- Shah, S.; Rachmat, R.; Enyioma, S.; Ghose, A.; Revythis, A.; Boussios, S. BRCA Mutations in Prostate Cancer: Assessment, Implications and Treatment Considerations. Int. J. Mol. Sci. 2021, 22, 12628. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Khan, H.M.; Cheng, H.H. Germline genetics of prostate cancer. Prostate 2022, 82, S3–S12. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Marino, F.; Totaro, A.; Gandi, C.; Bientinesi, R.; Moretto, S.; Gavi, F.; Pierconti, F.; Iacovelli, R.; Bassi, P.; Sacco, E. Germline mutations in prostate cancer: A systematic review of the evidence for personalized medicine. Prostate Cancer Prostatic Dis. 2023, 26, 655–664. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kasuga, A.; Okamoto, T.; Udagawa, S.; Mori, C.; Mie, T.; Furukawa, T.; Yamada, Y.; Takeda, T.; Matsuyama, M.; Sasaki, T.; et al. Molecular Features and Clinical Management of Hereditary Pancreatic Cancer Syndromes and Familial Pancreatic Cancer. Int. J. Mol. Sci. 2022, 23, 1205. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.; Dai, B.; Ye, D. CHEK2 mutation and risk of prostate cancer: A systematic review and meta-analysis. Int. J. Clin. Exp. Med. 2015, 8, 15708–15715. [Google Scholar]
- Kaur, H.B.; Salles, D.C.; Murali, S.; Hicks, J.; Nguyen, M.; Pritchard, C.C.; De Marzo, A.M.; Lanchbury, J.S.; Trock, B.J.; Isaacs, W.B.; et al. Genomic and Clinical-Pathologic Characterization of ATM-deficient Prostate Cancer. Clin. Cancer Res. 2020, 26, 4869–4881. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Beebe-Dimmer, J.L.; Kapron, A.L.; Fraser, A.M.; Smith, K.R.; Cooney, K.A. Risk of Prostate Cancer Associated with Familial and Hereditary Cancer Syndromes. J. Clin. Oncol. 2020, 38, 1807–1813. [Google Scholar] [CrossRef] [Scilit]
- D’Elia, G.; Caliendo, G.; Tzioni, M.-M.; Albanese, L.; Passariello, L.; Molinari, A.M.; Vietri, M.T. Increased Risk of Hereditary Prostate Cancer in Italian Families with Hereditary Breast and Ovarian Cancer Syndrome Harboring Mutations in BRCA and in Other Susceptibility Genes. Genes 2022, 13, 1692. [Google Scholar] [CrossRef] [Scilit]
- He, W.; Xiao, Y.; Yan, S.; Zhu, Y.; Ren, S. Cell-free DNA in the management of prostate cancer: Current status and future prospective. Asian J. Urol. 2023, 10, 298–316. [Google Scholar] [CrossRef] [Scilit]
- Urabe, F.; Sumiyoshi, T.; Tashiro, K.; Goto, T.; Kimura, T.; Kobayashi, T. Prostate cancer and liquid biopsies: Clinical applications and challenges. Int. J. Urol. 2024, 31, 617–626. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jahr, S.; Hentze, H.; Englisch, S.; Hardt, D.; Fackelmayer, F.O.; Hesch, R.D.; Knippers, R. DNA fragments in the blood plasma of cancer patients: Quantitations and evidence for their origin from apoptotic and necrotic cells. Cancer Res. 2001, 61, 1659–1665. [Google Scholar]
- Chen, E.; Cario, C.L.; Leong, L.; Lopez, K.; Márquez, C.P.; Chu, C.; Li, P.S.; Oropeza, E.; Tenggara, I.; Cowan, J.; et al. Cell-free DNA concentration and fragment size as a biomarker for prostate cancer. Sci. Rep. 2021, 11, 5040. [Google Scholar] [CrossRef] [Scilit]
- Han, D.S.C.; Lo, Y.M.D. The Nexus of cfDNA and Nuclease Biology. Trends Genet. 2021, 37, 758–770. [Google Scholar] [CrossRef] [Scilit]
- Rahimirad, S.; Derderian, S.; Hamel, L.; Scarlata, E.; McKercher, G.; Brimo, F.; Rajan, R.; Rompre-Brodeur, A.; Kassouf, W.; Sanchez-Salas, R.; et al. Refined Procedure to Purify and Sequence Circulating Cell-Free DNA in Prostate Cancer. Int. J. Mol. Sci. 2025, 26, 5839. [Google Scholar] [CrossRef] [Scilit]
- Li, W.; Liu, J.-B.; Hou, L.-K.; Yu, F.; Zhang, J.; Wu, W.; Tang, X.-M.; Sun, F.; Lu, H.-M.; Deng, J.; et al. Liquid biopsy in lung cancer: Significance in diagnostics, prediction, and treatment monitoring. Mol. Cancer 2022, 21, 25. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kopytov, S.A.; Sagitova, G.R.; Guschin, D.Y.; Egorova, V.S.; Zvyagin, A.V.; Rzhevskiy, A.S. Circulating Tumor DNA in Prostate Cancer: A Dual Perspective on Early Detection and Advanced Disease Management. Cancers 2025, 17, 2589. [Google Scholar] [CrossRef] [Scilit]
- Ye, Q.; Ling, S.; Zheng, S.; Xu, X. Liquid biopsy in hepatocellular carcinoma: Circulating tumor cells and circulating tumor DNA. Mol. Cancer 2019, 18, 114. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Parums, D.V. A Review of Circulating Tumor DNA (ctDNA) and the Liquid Biopsy in Cancer Diagnosis, Screening, and Monitoring Treatment Response. Med. Sci. Monit. 2025, 31, e949300. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, Q.; Huang, C.-C.; Huang, S.; Tian, Y.; Huang, J.; Bitaraf, A.; Dong, X.; Nevalanen, M.T.; Patel, M.; Wong, J.; et al. 5-hydroxymethylcytosine sequencing in plasma cell-free DNA identifies unique epigenomic features in prostate cancer patients resistant to androgen deprivation therapies. medRxiv 2024, preprint. [Google Scholar] [CrossRef] [Scilit]
- Sjöström, M.; Zhao, S.G.; Levy, S.; Zhang, M.; Ning, Y.; Shrestha, R.; Lundberg, A.; Herberts, C.; Foye, A.; Aggarwal, R.; et al. The 5-Hydroxymethylcytosine Landscape of Prostate Cancer. Cancer Res. 2022, 82, 3888–3902. [Google Scholar] [CrossRef] [Scilit]
- Corradi, C.; Lencioni, G.; Gentiluomo, M.; Felici, A.; Latiano, A.; Kiudelis, G.; van Eijck, C.H.J.; Marta, K.; Lawlor, R.T.; Tavano, F.; et al. Polymorphic variants involved in methylation regulation: A strategy to discover risk loci for pancreatic ductal adenocarcinoma. J. Med. Genet. 2023, 60, 980–986. [Google Scholar] [CrossRef] [Scilit]
- Toth, R.; Scherer, D.; Kelemen, L.E.; Risch, A.; Hazra, A.; Balavarca, Y.; Issa, J.-P.J.; Moreno, V.; Eeles, R.A.; Ogino, S.; et al. Genetic Variants in Epigenetic Pathways and Risks of Multiple Cancers in the GAME-ON Consortium. Cancer Epidemiol. Biomark. Prev. 2017, 26, 816–825. [Google Scholar] [CrossRef] [Scilit]
- Ulirsch, J.; Fan, C.; Knafl, G.; Wu, M.J.; Coleman, B.; Perou, C.M.; Swift-Scanlan, T. Vimentin DNA methylation predicts survival in breast cancer. Breast Cancer Res. Treat. 2013, 137, 383–396. [Google Scholar] [CrossRef] [Scilit]
- Zeng, Y.; Jain, R.; Lam, M.; Ahmed, M.; Guo, H.; Xu, W.; Zhong, Y.; Wei, G.-H.; Xu, W.; He, H.H. DNA methylation modulated genetic variant effect on gene transcriptional regulation. Genome Biol. 2023, 24, 285. [Google Scholar] [CrossRef] [Scilit]
- Huang, Q.; Whitington, T.; Gao, P.; Lindberg, J.F.; Yang, Y.; Sun, J.; Väisänen, M.-R.; Szulkin, R.; Annala, M.; Yan, J.; et al. A prostate cancer susceptibility allele at 6q22 increases RFX6 expression by modulating HOXB13 chromatin binding. Nat. Genet. 2014, 46, 126–135. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kechin, A.; Boyarskikh, U.; Kel, A.; Filipenko, M. cutPrimers: A New Tool for Accurate Cutting of Primers from Reads of Targeted Next Generation Sequencing. J. Comput. Biol. 2017, 24, 1138–1143. [Google Scholar] [CrossRef] [Scilit]
- Li, H.; Durbin, R. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics 2009, 25, 1754–1760. [Google Scholar] [CrossRef] [Scilit]
- McKenna, A.; Hanna, M.; Banks, E.; Sivachenko, A.; Cibulskis, K.; Kernytsky, A.; Garimella, K.; Altshuler, D.; Gabriel, S.; Daly, M.; et al. The Genome Analysis Toolkit: A MapReduce framework for analyzing next-generation DNA sequencing data. Genome Res. 2010, 20, 1297–1303. [Google Scholar] [CrossRef] [Scilit]
- Van der Auwera, G.A.; Carneiro, M.O.; Hartl, C.; Poplin, R.; Del Angel, G.; Levy-Moonshine, A.; Jordan, T.; Shakir, K.; Roazen, D.; Thibault, J.; et al. From FastQ data to high confidence variant calls: The Genome Analysis Toolkit best practices pipeline. Curr. Protoc. Bioinform. 2013, 43, 11.10.1–11.10.33. [Google Scholar] [CrossRef] [Scilit]
- Cibulskis, K.; Lawrence, M.S.; Carter, S.L.; Sivachenko, A.; Jaffe, D.; Sougnez, C.; Gabriel, S.; Meyerson, M.; Lander, E.S.; Getz, G. Sensitive detection of somatic point mutations in impure and heterogeneous cancer samples. Nat. Biotechnol. 2013, 31, 213–219. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, K.; Li, M.; Hakonarson, H. ANNOVAR: Functional annotation of genetic variants from high-throughput sequencing data. Nucleic Acids Res. 2010, 38, e164. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pruitt, K.D.; Brown, G.R.; Hiatt, S.M.; Thibaud-Nissen, F.; Astashyn, A.; Ermolaeva, O.; Farrell, C.M.; Hart, J.; Landrum, M.J.; McGarvey, K.M.; et al. RefSeq: An update on mammalian reference sequences. Nucleic Acids Res. 2014, 42, D756–D763. [Google Scholar] [CrossRef] [Scilit]
- Landrum, M.J.; Lee, J.M.; Benson, M.; Brown, G.R.; Chao, C.; Chitipiralla, S.; Gu, B.; Hart, J.; Hoffman, D.; Jang, W.; et al. ClinVar: Improving access to variant interpretations and supporting evidence. Nucleic Acids Res. 2018, 46, D1062–D1067. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gudmundsson, S.; Singer-Berk, M.; Watts, N.A.; Phu, W.; Goodrich, J.K.; Solomonson, M.; Genome Aggregation Database Consortium; Rehm, H.L.; MacArthur, D.G.; O’Donnell-Luria, A. Variant interpretation using population databases: Lessons from gnomAD. Hum. Mutat. 2022, 43, 1012–1030. [Google Scholar] [CrossRef] [Scilit]
- Sondka, Z.; Dhir, N.B.; Carvalho-Silva, D.; Jupe, S.; Madhumita; McLaren, K.; Starkey, M.; Ward, S.; Wilding, J.; Ahmed, M.; et al. COSMIC: A curated database of somatic variants and clinical data for cancer. Nucleic Acids Res. 2024, 52, D1210–D1217. [Google Scholar] [CrossRef] [Scilit]
- Liu, X.; Li, C.; Mou, C.; Dong, Y.; Tu, Y. dbNSFP v4: A comprehensive database of transcript-specific functional predictions and annotations for human nonsynonymous and splice-site SNVs. Genome Med. 2020, 12, 103. [Google Scholar] [CrossRef] [Scilit]
- Park, J.; Long, D.T.; Lee, K.Y.; Abbas, T.; Shibata, E.; Negishi, M.; Luo, Y.; Schimenti, J.C.; Gambus, A.; Walter, J.C.; et al. The MCM8-MCM9 complex promotes RAD51 recruitment at DNA damage sites to facilitate homologous recombination. Mol. Cell. Biol. 2013, 33, 1632–1644. [Google Scholar] [CrossRef] [Scilit]
- Gao, X.-P.; Dong, J.-J.; Xie, T.; Guan, X. Integrative Analysis of MUC4 to Prognosis and Immune Infiltration in Pan-Cancer: Friend or Foe? Front. Cell Dev. Biol. 2021, 9, 695544. [Google Scholar] [CrossRef] [Scilit]
- Singh, A.P.; Chauhan, S.C.; Bafna, S.; Johansson, S.L.; Smith, L.M.; Moniaux, N.; Lin, M.-F.; Batra, S.K. Aberrant expression of transmembrane mucins, MUC1 and MUC4, in human prostate carcinomas. Prostate 2006, 66, 421–429. [Google Scholar] [CrossRef] [Scilit]
- Hustedt, N.; Saito, Y.; Zimmermann, M.; Álvarez-Quilón, A.; Setiaputra, D.; Adam, S.; McEwan, A.; Yuan, J.Y.; Olivieri, M.; Zhao, Y.; et al. Control of homologous recombination by the HROB-MCM8-MCM9 pathway. Genes Dev. 2019, 33, 1397–1415. [Google Scholar] [CrossRef] [Scilit]
- Helderman, N.C.; Terlouw, D.; Bonjoch, L.; Golubicki, M.; Antelo, M.; Morreau, H.; van Wezel, T.; Castellví-Bel, S.; Goldberg, Y.; Nielsen, M. Molecular functions of MCM8 and MCM9 and their associated pathologies. iScience 2023, 26, 106737. [Google Scholar] [CrossRef] [Scilit]
- Zhang, W.; van Gent, D.C.; Incrocci, L.; van Weerden, W.M.; Nonnekens, J. Role of the DNA damage response in prostate cancer formation, progression and treatment. Prostate Cancer Prostatic Dis. 2020, 23, 24–37. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schiewer, M.J.; Knudsen, K.E. DNA Damage Response in Prostate Cancer. Cold Spring Harb. Perspect. Med. 2019, 9, a030486. [Google Scholar] [CrossRef] [Scilit]
- Morii, I.; Iwabuchi, Y.; Mori, S.; Suekuni, M.; Natsume, T.; Yoshida, K.; Sugimoto, N.; Kanemaki, M.T.; Fujita, M. Inhibiting the MCM8-9 complex selectively sensitizes cancer cells to cisplatin and olaparib. Cancer Sci. 2019, 110, 1044–1053. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wood-Trageser, M.A.; Gurbuz, F.; Yatsenko, S.A.; Jeffries, E.P.; Kotan, L.D.; Surti, U.; Ketterer, D.M.; Matic, J.; Chipkin, J.; Jiang, H.; et al. MCM9 mutations are associated with ovarian failure, short stature, and chromosomal instability. Am. J. Hum. Genet. 2014, 95, 754–762. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bhatia, R.; Siddiqui, J.A.; Ganguly, K.; Thompson, C.M.; Cannon, A.; Aithal, A.; Perumal, N.; Maurya, S.K.; Li, X.; Cox, J.L.; et al. Muc4 loss mitigates epidermal growth factor receptor activity essential for PDAC tumorigenesis. Oncogene 2023, 42, 759–770. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- King, R.J.; Yu, F.; Singh, P.K. Genomic alterations in mucins across cancers. Oncotarget 2017, 8, 67152–67168. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mateo, J.; Carreira, S.; Sandhu, S.; Miranda, S.; Mossop, H.; Perez-Lopez, R.; Nava Rodrigues, D.; Robinson, D.; Omlin, A.; Tunariu, N.; et al. DNA-Repair Defects and Olaparib in Metastatic Prostate Cancer. N. Engl. J. Med. 2015, 373, 1697–1708. [Google Scholar] [CrossRef] [Scilit]
- Matsumoto, T.; Shiota, M.; Blas, L.; Eto, M. Role of Olaparib in the Management of Metastatic Castration-Resistant Prostate Cancer: A Japanese Clinician’s Perspective. Cancer Manag. Res. 2022, 14, 2389–2397. [Google Scholar] [CrossRef] [Scilit]
- Taylor, A.K.; Kosoff, D.; Emamekhoo, H.; Lang, J.M.; Kyriakopoulos, C.E. PARP inhibitors in metastatic prostate cancer. Front. Oncol. 2023, 13, 1159557. [Google Scholar] [CrossRef] [Scilit]
- Liu, K.; Wang, Y.; Zhu, Q.; Li, P.; Chen, J.; Tang, Z.; Shen, Y.; Cheng, X.; Lu, L.-Y.; Liu, Y. Aberrantly expressed HORMAD1 disrupts nuclear localization of MCM8-MCM9 complex and compromises DNA mismatch repair in cancer cells. Cell Death Dis. 2020, 11, 519. [Google Scholar] [CrossRef] [Scilit]
- Belhadj, S.; Terradas, M.; Munoz-Torres, P.M.; Aiza, G.; Navarro, M.; Capellá, G.; Valle, L. Candidate genes for hereditary colorectal cancer: Mutational screening and systematic review. Hum. Mutat. 2020, 41, 1563–1576. [Google Scholar] [CrossRef] [Scilit]
- Ahmed, M.; Soares, F.; Xia, J.-H.; Yang, Y.; Li, J.; Guo, H.; Su, P.; Tian, Y.; Lee, H.J.; Wang, M.; et al. CRISPRi screens reveal a DNA methylation-mediated 3D genome dependent causal mechanism in prostate cancer. Nat. Commun. 2021, 12, 1781. [Google Scholar] [CrossRef] [Scilit]
- Chen, Y.-T.; Panarelli, N.C.; Piotti, K.C.; Yantiss, R.K. Cancer-testis antigen expression in digestive tract carcinomas: Frequent expression in esophageal squamous cell carcinoma and its precursor lesions. Cancer Immunol. Res. 2014, 2, 480–486. [Google Scholar] [CrossRef] [Scilit]
- Ding, Y.; Wang, H.; Cao, W.; Cao, T.; Jiang, H.; Yu, Z.; Zhou, Y.; Xu, M. TTC22 as a potential prognostic marker and therapeutic target in pancreatic cancer: Insights into immune infiltration and epithelial-mesenchymal transition. Oncol. Lett. 2024, 27, 11. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- You, A.; Tian, W.; Yuan, H.; Gu, L.; Zhou, J.; Deng, D. TTC22 promotes m6A-mediated WTAP expression and colon cancer metastasis in an RPL4 binding-dependent pattern. Oncogene 2022, 41, 3925–3938. [Google Scholar] [CrossRef] [Scilit]
- Baryshev, M.; Vjaters, E. Allele-Specific CG/CCWGG Methylation of the PSA Promoter Discriminates Aggressive, Indolent, and Benign Prostate Cell Lines and Is Involved in the Regulation of PSA Expression. Int. J. Mol. Sci. 2025, 26, 1243. [Google Scholar] [CrossRef] [Scilit]
- Feng, D.; Zhu, W.; Shi, X.; Xiong, Q.; Li, D.; Wei, W.; Han, P.; Wei, Q.; Yang, L. Spindle and kinetochore-associated complex subunit 3 could serve as a prognostic biomarker for prostate cancer. Exp. Hematol. Oncol. 2022, 11, 76. [Google Scholar] [CrossRef] [Scilit]
- Vlasschaert, C.; Mack, T.; Heimlich, J.B.; Niroula, A.; Uddin, M.M.; Weinstock, J.; Sharber, B.; Silver, A.J.; Xu, Y.; Savona, M.; et al. A practical approach to curate clonal hematopoiesis of indeterminate potential in human genetic data sets. Blood 2023, 141, 2214–2223. [Google Scholar] [CrossRef] [Scilit]
- Dong, D.; Wang, Z.; Liu, M.; Zhang, Q.; Xu, W.; Wei, Y.; Zhu, J.; Yang, X.; Zhang, Q.; Zhu, Y.; et al. Combined SNPs sequencing and allele specific proteomics capture reveal functional causality underpinning the 2p25 prostate cancer susceptibility locus. Nat. Commun. 2025, 16, 8950. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, P.; Xia, J.-H.; Zhu, J.; Gao, P.; Tian, Y.-J.; Du, M.; Guo, Y.-C.; Suleman, S.; Zhang, Q.; Kohli, M.; et al. High-throughput screening of prostate cancer risk loci by single nucleotide polymorphisms sequencing. Nat. Commun. 2018, 9, 2022. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ci, X.; Chen, S.; Zhu, R.; Zarif, M.; Jain, R.; Guo, W.; Ramotar, M.; Gong, L.; Xu, W.; Singh, O.; et al. Oral pimonidazole unveils clinicopathologic and epigenetic features of hypoxic tumour aggressiveness in localized prostate cancer. BMC Cancer 2024, 24, 744. [Google Scholar] [CrossRef] [Scilit] [PubMed]



| Chr | Start | End | Ref | Alt | Gene. | Transcript | HGVSC | HGVSP | N° Patients | AF | Mean Read Depth |
|---|---|---|---|---|---|---|---|---|---|---|---|
| chr1 | 12,860,036 | 12,860,036 | G | T | PRAMEF2 | NM_023014 | c.G631T | p.E211X | 3 | 0.0466 | 69 |
| chr1 | 109,280,835 | 109,280,835 | T | A | PSRC1 | NM_001005290 | c.A745T | p.K249X | 2 | 0.0144 | 40 |
| chr1 | 54,785,641 | 54,785,641 | G | A | TTC22 | NM_017904 | c.C1024T | p.R342X | 3 | 0.0639 | 50 |
| chr2 | 126,899,285 | 126,899,285 | C | T | TEX51 | NM_001322244 | c.C214T | p.R72X | 2 | 0.0629 | 60 |
| chr3 | 195,781,189 | 195,781,189 | G | - | MUC4 | NM_018406 | c.10391delC | p.S3464X | 2 | 0.0176 | 45 |
| chr5 | 141,433,208 | 141,433,208 | - | T | PCDHGA12 | NM_032094 | c.2450dupT | p.*821L | 2 | 0.0010 | 50 |
| chr6 | 17,605,931 | 17,605,931 | C | T | FAM8A1 | NM_016255 | c.C1015T | p.R339X | 5 | 0.0042 | 47 |
| chr6 | 32,584,158 | 32,584,158 | G | T | HLA-DRB1 | NM_002124 | c.C321A | p.Y107X | 2 | 0.0094 | 31 |
| chr6 | 118,894,558 | 118,894,558 | G | A | MCM9 | NM_001378365 | c.C1918T | p.Q640X | 3 | 0.0573 | 30 |
| chr6 | 154,246,729 | 154,246,729 | C | T | OPRM1 | NM_001008503 | c.C1201T | R401X | 2 | 0.0478 | 50 |
| chr9 | 136,253,933 | 136,253,933 | - | CCACCAGGCCCAGGCGCCCGGCTCTCAG | CCDC187 | NM_001378188 | c.5894_5895insCTGAGAGCCGGGCGCCTGGGCCTGGTGG | p.N1966* | 2 | 0.0464 | 49 |
| chr9 | 127,714,388 | 127,714,388 | G | C | PTRH1 | NM_001345979 | c.C353G | p.S118X | 3 | 0.0235 | 48 |
| chr10 | 1,019,770 | 1,019,770 | C | T | IDI2 | NM_033261 | c.G431A | p.W144X | 2 | 0.0582 | 40 |
| chr11 | 5,967,993 | 5,967,993 | G | A | OR56A5 | NM_001146033 | c.C502T | p.R168X | 2 | 0.0608 | 51 |
| chr12 | 7,322,485 | 7,322,485 | C | T | ACSM4 | NM_001080454 | c.C1069T | p.Q357X | 3 | 0.0587 | 35 |
| chr13 | 21,176,399 | 21,176,399 | G | A | SKA3 | NM_001166017 | c.C79T | p.R27X | 3 | 0.0499 | 32 |
| chr14 | 63,599,645 | 63,599,645 | G | A | WDR89 | NM_001258272 | c.C298T | p.R100X | 6 | 0.0024 | 52 |
| chr15 | 83,008,518 | 83,008,518 | - | AA | C15orf40 | NM_001160113 | c.395_396insTT | p.L132Ffs*2 | 3 | 0.0004 | 30 |
| chr17 | 41,439,232 | 41,439,232 | G | A | KRT38 | NM_006771 | c.C703T | p.Q235X | 5 | 0.0642 | 50 |
| chr17 | 41,054,930 | 41,054,930 | C | T | KRTAP2-2 | NM_033032 | c.G282A | p.W94X | 5 | 0.0539 | 20 |
| chr17 | 28,326,780 | 28,326,780 | - | A | TMEM97 | NM_014573 | c.519dupA | p.*177delinsMKETTTGPG* | 3 | 0.0001 | 40 |
| chr18 | 7,456,247 | 7,456,247 | G | A | LOC112577592 | NM_001364581 | c.C205T | p.R69X | 2 | 0.0814 | 56 |
| chr18 | 46,946,874 | 46,946,874 | T | C | KATNAL2 | NM_001367621 | c.T2C | p.M27T | 2 | 0.0259 | 45 |
| chr19 | 54,508,046 | 54,508,046 | C | T | LAIR2 | NM_002288 | c.C226T | p.R76X | 2 | 0.0323 | 40 |
| chr19 | 2,936,537 | 2,936,537 | G | A | ZNF77 | NM_021217 | c.C298T | p.Q100X | 2 | 0.0339 | 37 |
| chr21 | 10,462,836 | 10,462,836 | C | T | BAGE3 | NM_182481 | c.C280T | p.R94X | 6 | 0.0489 | 68 |
| ACSM4 | BAGE3 | C15orf40 | CCDC187 | FAM8A1 | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| %_5mC | %_5hmC | Total_C | %_5mC | %_5hmC | Total_C | %_5mC | %_5hmC | Total_C | %_5mC | %_5hmC | Total_C | %_5mC | %_5hmC | Total_C | |
| PC10 | 87.59 | 2.37 | 9493 | 2.71 | 0.19 | 76,460 | 71.47 | 2.92 | 14,223 | 78.43 | 1.96 | 72,584 | 47.36 | 5.43 | 6611 |
| PC14 | 87.27 | 1.69 | 9002 | 1.93 | 0.19 | 62,899 | 74.28 | 2.14 | 12,841 | 78.38 | 1.44 | 71,011 | 51.45 | 4.05 | 6202 |
| PC24 | 87.21 | 1.2 | 8470 | 1.38 | 0.24 | 70,005 | 74.95 | 2.09 | 11,855 | 79.25 | 1.24 | 59,073 | 51.57 | 3.4 | 5379 |
| PC26 | 85.62 | 1.55 | 9879 | 1.81 | 0.2 | 80,974 | 73.04 | 2.74 | 14,404 | 77.96 | 1.56 | 79,124 | 49.28 | 4.01 | 6863 |
| PC30 | 87.07 | 1.47 | 8861 | 1.69 | 0.19 | 70,914 | 73.78 | 2.08 | 13,512 | 79.64 | 1.29 | 68,732 | 47.99 | 3.36 | 6216 |
| PC4 | 87.57 | 1.92 | 9770 | 2.2 | 0.24 | 72,565 | 73.35 | 2.59 | 13,953 | 80.51 | 1.59 | 76,500 | 51.96 | 4.35 | 6320 |
| PC5 | 84.71 | 2.2 | 8181 | 2.6 | 0.28 | 62,365 | 62.65 | 3.57 | 13,313 | 75.92 | 2.33 | 62,677 | 37.17 | 4.51 | 7313 |
| PC6 | 87.13 | 1.32 | 10,095 | 1.51 | 0.15 | 71,256 | 68.6 | 1.97 | 14,916 | 78.41 | 1.27 | 72,614 | 43.54 | 3.56 | 7609 |
| HLA-DRB | IDI2 | KATNAL2 | KRT38 | KRTAP2-2 | |||||||||||
| %_5mC | %_5hmC | Total_C | %_5mC | %_5hmC | Total_C | %_5mC | %_5hmC | Total_C | %_5mC | %_5hmC | Total_C | %_5mC | %_5hmC | Total_C | |
| PC10 | 55.19 | 1.27 | 4553 | 88.6 | 2.36 | 8547 | 79.37 | 1.24 | 70,352 | 83.01 | 1.26 | 3815 | 84.33 | 0.62 | 970 |
| PC14 | 53.8 | 1.13 | 4766 | 89.58 | 1.8 | 7900 | 81.05 | 0.86 | 65,683 | 81.73 | 1.08 | 3700 | 87.93 | 0.19 | 1036 |
| PC24 | 51.27 | 0.69 | 4203 | 89.39 | 1.38 | 7379 | 81.47 | 0.94 | 59,876 | 84.42 | 0.73 | 3274 | 86.02 | 0.24 | 830 |
| PC26 | 47.24 | 1.9 | 6463 | 89.83 | 1.99 | 9015 | 80.8 | 1.2 | 72,925 | 81.26 | 0.91 | 4088 | 85.71 | 0.38 | 1057 |
| PC30 | 50.87 | 1.08 | 3613 | 88.94 | 1.82 | 8090 | 81.38 | 1.15 | 63,990 | 83.24 | 1.32 | 3706 | 87.47 | 0.11 | 870 |
| PC4 | 55.02 | 0.88 | 5234 | 90.31 | 2.15 | 9183 | 81.32 | 0.97 | 71,952 | 82.58 | 1.15 | 4184 | 90.14 | 0.3 | 1004 |
| PC5 | 48.18 | 1.98 | 4541 | 88.26 | 3.13 | 7606 | 76.6 | 1.76 | 61,747 | 78.78 | 1.1 | 3284 | 82.75 | 0.48 | 835 |
| PC6 | 49.36 | 1.09 | 5581 | 89.44 | 1.45 | 9145 | 78.04 | 0.88 | 73,326 | 81.02 | 0.98 | 3994 | 88.32 | 0.1 | 976 |
| LAIR2 | LOC112577592 | MCM9 | MUC4 | OPRM1 | |||||||||||
| %_5mC | %_5hmC | Total_C | %_5mC | %_5hmC | Total_C | %_5mC | %_5hmC | Total_C | %_5mC | %_5hmC | Total_C | %_5mC | %_5hmC | Total_C | |
| PC10 | 76.41 | 1.39 | 7842 | 87.41 | 1.31 | 5330 | 67.56 | 4.22 | 43,041 | 74.49 | 3 | 71,288 | 81.27 | 2.5 | 81,156 |
| PC14 | 77.19 | 0.96 | 7400 | 85.67 | 1.13 | 5324 | 74.12 | 2.93 | 39,991 | 75.08 | 2.36 | 72,034 | 81.76 | 1.94 | 77,657 |
| PC24 | 77.03 | 0.94 | 6490 | 84.37 | 0.86 | 4990 | 74.87 | 2.5 | 36,592 | 75.83 | 2 | 59,504 | 82.84 | 1.64 | 73,257 |
| PC26 | 75.96 | 1.1 | 8337 | 83.99 | 1.53 | 5827 | 71.93 | 3.08 | 45,464 | 73.98 | 2.55 | 77,347 | 80.59 | 1.66 | 87,327 |
| PC30 | 78.04 | 0.97 | 7289 | 85.81 | 1.03 | 5512 | 74.2 | 2.73 | 40,129 | 76.55 | 2.34 | 66,747 | 81.76 | 1.95 | 78,238 |
| PC4 | 78.78 | 0.89 | 8397 | 86.98 | 1.77 | 5877 | 73.87 | 3.5 | 43,635 | 75.51 | 2.41 | 78,859 | 82.93 | 1.88 | 85,909 |
| PC5 | 76.21 | 1.42 | 7133 | 82.7 | 1.71 | 4666 | 61.06 | 4.04 | 42,392 | 71.65 | 3.14 | 62,596 | 78.88 | 2.49 | 72,293 |
| PC6 | 74.08 | 0.73 | 7794 | 86.11 | 1.36 | 5963 | 66.57 | 2.37 | 49,622 | 76.46 | 2.23 | 69,939 | 81.14 | 1.66 | 87,572 |
| OR56A5 | PCDHGA12 | PRAMEF2 | PSRC1 | PTRH1 | |||||||||||
| %_5mC | %_5hmC | Total_C | %_5mC | %_5hmC | Total_C | %_5mC | %_5hmC | Total_C | %_5mC | %_5hmC | Total_C | %_5mC | %_5hmC | Total_C | |
| PC10 | 81.27 | 0.79 | 630 | 56.7 | 1.5 | 59,495 | 76.24 | 0.73 | 4117 | 35.68 | 5.81 | 5162 | 61.94 | 2.8 | 18,707 |
| PC14 | 79.56 | 0.32 | 631 | 57.12 | 1.18 | 59,648 | 79.7 | 0.57 | 2970 | 43.09 | 5.18 | 4574 | 66.62 | 2.19 | 17,048 |
| PC24 | 77.89 | 1.19 | 588 | 59.84 | 0.9 | 52,534 | 83.45 | 0.49 | 2840 | 43.47 | 4.13 | 3752 | 68.33 | 1.71 | 14,416 |
| PC26 | 77.15 | 0.47 | 639 | 58.57 | 1.34 | 65,055 | 77.31 | 0.81 | 2838 | 43.37 | 4.11 | 5474 | 63.82 | 2.16 | 18,485 |
| PC30 | 84.33 | 0.65 | 619 | 60.44 | 1.11 | 58,130 | 80.26 | 0.61 | 2953 | 40.25 | 5.01 | 4288 | 66.01 | 2.06 | 16,320 |
| PC4 | 78.53 | 0.75 | 666 | 60.67 | 1.31 | 63,584 | 76.91 | 0.86 | 3820 | 40.78 | 5.71 | 4943 | 66.54 | 2.26 | 18,491 |
| PC5 | 72.71 | 0.54 | 557 | 54.62 | 1.83 | 53,334 | 74.85 | 1.05 | 2282 | 28.52 | 5.13 | 6298 | 52.31 | 2.6 | 18,200 |
| PC6 | 78.65 | 0.46 | 651 | 60.6 | 1.14 | 62,654 | 81.32 | 0.82 | 3185 | 34.03 | 3.17 | 6060 | 59.22 | 1.79 | 19,900 |
| SKA3 | TEX51 | TMEM97 | TTC22 | WDR89 | |||||||||||
| %_5mC | %_5hmC | Total_C | %_5mC | %_5hmC | Total_C | %_5mC | %_5hmC | Total_C | %_5mC | %_5hmC | Total_C | %_5mC | %_5hmC | Total_C | |
| PC10 | 67.2 | 2.01 | 13,529 | 86.71 | 0.72 | 2627 | 48.6 | 1.63 | 8018 | 70.44 | 3.02 | 15,160 | 72.32 | 3.18 | 23,943 |
| PC14 | 70.95 | 1.4 | 12,984 | 85.81 | 0.69 | 2622 | 53.3 | 1.78 | 7404 | 72.62 | 2.05 | 15,187 | 79.88 | 2.42 | 20,772 |
| PC24 | 72.84 | 1.06 | 11,750 | 87.73 | 0.87 | 2306 | 56.28 | 1.63 | 6311 | 73.87 | 1.75 | 13,234 | 80.47 | 2.28 | 19,054 |
| PC26 | 69.62 | 1.35 | 14,267 | 82.88 | 1.13 | 2915 | 47.9 | 2.23 | 8705 | 70.73 | 2.13 | 17,075 | 78.47 | 2.71 | 23,842 |
| PC30 | 69.97 | 1.18 | 13,169 | 88.13 | 0.68 | 2510 | 48.96 | 1.31 | 8016 | 72.3 | 1.87 | 15,058 | 79.01 | 2.4 | 21,806 |
| PC4 | 72.78 | 1.47 | 15,082 | 88 | 0.94 | 2776 | 52.59 | 1.74 | 8035 | 73.69 | 2.42 | 16,794 | 80.91 | 2.94 | 22,423 |
| PC5 | 59.18 | 1.88 | 13,688 | 83.34 | 0.89 | 2239 | 38.89 | 2.09 | 8579 | 62.15 | 3.72 | 14,124 | 66.91 | 3.52 | 22,826 |
| PC6 | 68.64 | 1.02 | 15,042 | 85.94 | 0.53 | 2631 | 46.76 | 1.22 | 9163 | 72.53 | 2.09 | 15,853 | 72 | 2.03 | 25,607 |
| ZNF77 | |||||||||||||||
| %_5mC | %_5hmC | Total_C | |||||||||||||
| PC10 | 64.59 | 1.6 | 14,167 | ||||||||||||
| PC14 | 72.5 | 1.21 | 12,024 | ||||||||||||
| PC24 | 73.06 | 1.37 | 11,050 | ||||||||||||
| PC26 | 69.92 | 1.46 | 13,917 | ||||||||||||
| PC30 | 70.87 | 1.25 | 12,588 | ||||||||||||
| PC4 | 74.47 | 1.82 | 12,979 | ||||||||||||
| PC5 | 59.27 | 1.88 | 13,691 | ||||||||||||
| PC6 | 60.11 | 1.3 | 15,953 | ||||||||||||
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Truda, A.; Cordella, A.; De Leo, I.; Di Palo, A.; Iorio, R.; Marino, S.; La Rocca, R.; Collà Ruvolo, C.; Potenza, N.; Ravo, M.; et al. Integrative Whole-Genome and Epigenome Profiling of cfDNA in Familial Prostate Cancer: Insights from a Pilot Study. Biomedicines 2026, 14, 818. https://doi.org/10.3390/biomedicines14040818
Truda A, Cordella A, De Leo I, Di Palo A, Iorio R, Marino S, La Rocca R, Collà Ruvolo C, Potenza N, Ravo M, et al. Integrative Whole-Genome and Epigenome Profiling of cfDNA in Familial Prostate Cancer: Insights from a Pilot Study. Biomedicines. 2026; 14(4):818. https://doi.org/10.3390/biomedicines14040818
Chicago/Turabian StyleTruda, Anna, Angela Cordella, Ilenia De Leo, Armando Di Palo, Roberta Iorio, Simona Marino, Roberto La Rocca, Claudia Collà Ruvolo, Nicoletta Potenza, Maria Ravo, and et al. 2026. "Integrative Whole-Genome and Epigenome Profiling of cfDNA in Familial Prostate Cancer: Insights from a Pilot Study" Biomedicines 14, no. 4: 818. https://doi.org/10.3390/biomedicines14040818
APA StyleTruda, A., Cordella, A., De Leo, I., Di Palo, A., Iorio, R., Marino, S., La Rocca, R., Collà Ruvolo, C., Potenza, N., Ravo, M., & Marchese, G. (2026). Integrative Whole-Genome and Epigenome Profiling of cfDNA in Familial Prostate Cancer: Insights from a Pilot Study. Biomedicines, 14(4), 818. https://doi.org/10.3390/biomedicines14040818

