Efficacy of an Innovative Poly-Component Formulation in Counteracting Human Dermal Fibroblast Aging by Influencing Oxidative and Inflammatory Pathways
Abstract
1. Introduction
2. Materials and Methods
2.1. Preparation of K Poly-Component Formulation for Cell Treatments
2.2. Cell Systems
2.3. DPPH Radical-Scavenging Activity Assay
2.4. Superoxide Dismutase (SOD) Activity
2.5. Catalase (CAT) Activity
2.6. Western Blot Analysis
2.7. Immunofluorescence Assay for Nrf2
2.8. Enzyme-Linked Immunostaining Assay for Interleukin Measurement
2.9. Total RNA Extraction and Quantitative Real-Time PCR (qPCR)
2.10. Advanced Glycation End-Product (AGE) ELISA Kit
2.11. Statistical Analysis
3. Results
3.1. K Formulation Neutralized Oxidative Damage by Radical-Scavenging Capacity
3.2. K Formulation Prevented Aging-Associated Oxidative Stress by Enhancing Cellular Anti-Oxidant Enzyme Activity
3.3. Effect of K Formulation on Phospho-Nrf2 Expression in Aged HDFs
3.4. Effect of K Formulation on Oxidative Stress-Induced NF-κB Pathway
3.5. Antiglycation Assessment of K Formulation
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Wlaschek, M.; Maity, P.; Makrantonaki, E.; Scharffetter-Kochanek, K. Connective Tissue and Fibroblast Senescence in Skin Aging. J. Investig. Dermatol. 2021, 141, 985–992. [Google Scholar] [CrossRef] [PubMed]
- Wang, B.; Han, J.; Elisseeff, J.H.; Demaria, M. The senescence-associated secretory phenotype and its physiological and pathological implications. Nat. Rev. Mol. Cell Biol. 2024. [Google Scholar] [CrossRef] [PubMed]
- Haydont, V.; Bernard, B.A.; Fortunel, N.O. Age-related evolutions of the dermis: Clinical signs, fibroblast and extracellular matrix dynamics. Mech. Ageing Dev. 2019, 177, 150–156. [Google Scholar] [CrossRef]
- Rinnerthaler, M.; Bischof, J.; Streubel, M.K.; Trost, A.; Richter, K. Oxidative stress in aging human skin. Biomolecules 2015, 5, 545–589. [Google Scholar] [CrossRef]
- Afzal, S.; Abdul Manap, A.S.; Attiq, A.; Albokhadaim, I.; Kandeel, M.; Alhojaily, S.M. From imbalance to impairment: The central role of reactive oxygen species in oxidative stress-induced disorders and therapeutic exploration. Front. Pharmacol. 2023, 14, 1269581. [Google Scholar] [CrossRef] [PubMed]
- Calvo, M.J.; Navarro, C.; Duran, P.; Galan-Freyle, N.J.; Parra Hernandez, L.A.; Pacheco-Londono, L.C.; Castelanich, D.; Bermudez, V.; Chacin, M. Antioxidants in Photoaging: From Molecular Insights to Clinical Applications. Int. J. Mol. Sci. 2024, 25, 2403. [Google Scholar] [CrossRef]
- Zhang, M.; Hwang, E.; Lin, P.; Gao, W.; Ngo, H.T.T.; Yi, T.H. Prunella vulgaris L. Exerts a Protective Effect Against Extrinsic Aging Through NF-kappaB, MAPKs, AP-1, and TGF-beta/Smad Signaling Pathways in UVB-Aged Normal Human Dermal Fibroblasts. Rejuvenation Res. 2018, 21, 313–322. [Google Scholar] [CrossRef]
- Wang, Y.; Wang, L.; Wen, X.; Hao, D.; Zhang, N.; He, G.; Jiang, X. NF-kappaB signaling in skin aging. Mech. Ageing Dev. 2019, 184, 111160. [Google Scholar] [CrossRef]
- Liu, Y.; Qu, L.; Wan, S.; Li, Y.; Fan, D. Ginsenoside Rk1 Prevents UVB Irradiation-Mediated Oxidative Stress, Inflammatory Response, and Collagen Degradation via the PI3K/AKT/NF-kappaB Pathway In Vitro and In Vivo. J. Agric. Food Chem. 2022, 70, 15804–15817. [Google Scholar] [CrossRef]
- He, T.; Quan, T.; Shao, Y.; Voorhees, J.J.; Fisher, G.J. Oxidative exposure impairs TGF-beta pathway via reduction of type II receptor and SMAD3 in human skin fibroblasts. Age 2014, 36, 9623. [Google Scholar] [CrossRef]
- Loboda, A.; Damulewicz, M.; Pyza, E.; Jozkowicz, A.; Dulak, J. Role of Nrf2/HO-1 system in development, oxidative stress response and diseases: An evolutionarily conserved mechanism. Cell. Mol. Life Sci. 2016, 73, 3221–3247. [Google Scholar] [CrossRef] [PubMed]
- Fang, M.; Lee, H.M.; Oh, S.; Zheng, S.; Bellere, A.D.; Kim, M.; Choi, J.; Kim, M.; Yu, D.; Yi, T.H. Rosa davurica inhibits skin photoaging via regulating MAPK/AP-1, NF-kappaB, and Nrf2/HO-1 signaling in UVB-irradiated HaCaTs. Photochem. Photobiol. Sci. 2022, 21, 2217–2230. [Google Scholar] [CrossRef] [PubMed]
- Cuadrado, A.; Rojo, A.I.; Wells, G.; Hayes, J.D.; Cousin, S.P.; Rumsey, W.L.; Attucks, O.C.; Franklin, S.; Levonen, A.L.; Kensler, T.W.; et al. Therapeutic targeting of the NRF2 and KEAP1 partnership in chronic diseases. Nat. Rev. Drug Discov. 2019, 18, 295–317. [Google Scholar] [CrossRef] [PubMed]
- Papaccio, F.; D’Arino, A.; Caputo, S.; Bellei, B. Focus on the Contribution of Oxidative Stress in Skin Aging. Antioxidants 2022, 11, 1121. [Google Scholar] [CrossRef]
- Zgutka, K.; Tkacz, M.; Tomasiak, P.; Tarnowski, M. A Role for Advanced Glycation End Products in Molecular Ageing. Int. J. Mol. Sci. 2023, 24, 9881. [Google Scholar] [CrossRef]
- Chen, C.Y.; Zhang, J.Q.; Li, L.; Guo, M.M.; He, Y.F.; Dong, Y.M.; Meng, H.; Yi, F. Advanced Glycation End Products in the Skin: Molecular Mechanisms, Methods of Measurement, and Inhibitory Pathways. Front. Med. 2022, 9, 837222. [Google Scholar] [CrossRef]
- Michalak, M.; Pierzak, M.; Krecisz, B.; Suliga, E. Bioactive Compounds for Skin Health: A Review. Nutrients 2021, 13, 203. [Google Scholar] [CrossRef]
- Jaros-Sajda, A.; Budzisz, E.; Erkiert-Polguj, A. Ascorbic Acid Treatments as Effective and Safe Anti-Aging Therapies for Sensitive Skin. Antioxidants 2024, 13, 174. [Google Scholar] [CrossRef]
- Karwal, K.; Mukovozov, I. Topical AHA in Dermatology: Formulations, Mechanisms of Action, Efficacy, and Future Perspectives. Cosmetics 2023, 10, 131. [Google Scholar] [CrossRef]
- Milosheska, D.; Roskar, R. Use of Retinoids in Topical Antiaging Treatments: A Focused Review of Clinical Evidence for Conventional and Nanoformulations. Adv. Ther. 2022, 39, 5351–5375. [Google Scholar] [CrossRef]
- Chen, S.X.; Cheng, J.; Watchmaker, J.; Dover, J.S.; Chung, H.J. Review of Lasers and Energy-Based Devices for Skin Rejuvenation and Scar Treatment With Histologic Correlations. Dermatol. Surg. 2022, 48, 441–448. [Google Scholar] [CrossRef]
- Majidian, M.; Kolli, H.; Moy, R.L. Management of skin thinning and aging: Review of therapies for neocollagenesis; hormones and energy devices. Int. J. Dermatol. 2021, 60, 1481–1487. [Google Scholar] [CrossRef]
- Orringer, J.S.; Sachs, D.L.; Shao, Y.; Hammerberg, C.; Cui, Y.; Voorhees, J.J.; Fisher, G.J. Direct quantitative comparison of molecular responses in photodamaged human skin to fractionated and fully ablative carbon dioxide laser resurfacing. Dermatol. Surg. 2012, 38, 1668–1677. [Google Scholar] [CrossRef] [PubMed]
- Attenello, N.H.; Maas, C.S. Injectable fillers: Review of material and properties. Facial Plast. Surg. 2015, 31, 29–34. [Google Scholar] [CrossRef]
- Laurino, C.; Palmieri, B.; Coacci, A. Efficacy, Safety, and Tolerance of a New Injection Technique for High- and Low-Molecular-Weight Hyaluronic Acid Hybrid Complexes. Eplasty 2015, 15, e46. [Google Scholar]
- Oh, S.; Seo, S.B.; Kim, G.; Batsukh, S.; Park, C.H.; Son, K.H.; Byun, K. Poly-D,L-Lactic Acid Filler Increases Extracellular Matrix by Modulating Macrophages and Adipose-Derived Stem Cells in Aged Animal Skin. Antioxidants 2023, 12, 1204. [Google Scholar] [CrossRef]
- Stellavato, A.; Corsuto, L.; D’Agostino, A.; La Gatta, A.; Diana, P.; Bernini, P.; De Rosa, M.; Schiraldi, C. Hyaluronan Hybrid Cooperative Complexes as a Novel Frontier for Cellular Bioprocesses Re-Activation. PLoS ONE 2016, 11, e0163510. [Google Scholar] [CrossRef] [PubMed]
- Stellavato, A.; La Noce, M.; Corsuto, L.; Pirozzi, A.V.A.; De Rosa, M.; Papaccio, G.; Schiraldi, C.; Tirino, V. Hybrid Complexes of High and Low Molecular Weight Hyaluronans Highly Enhance HASCs Differentiation: Implication for Facial Bioremodelling. Cell. Physiol. Biochem. 2017, 44, 1078–1092. [Google Scholar] [CrossRef]
- Augello, F.R.; Lombardi, F.; Artone, S.; Ciafarone, A.; Altamura, S.; Di Marzio, L.; Cifone, M.G.; Palumbo, P.; Giuliani, M.; Cinque, B. Evaluation of the Effectiveness of an Innovative Polycomponent Formulation on Adult and Aged Human Dermal Fibroblasts. Biomedicines 2023, 11, 2410. [Google Scholar] [CrossRef]
- Di Rosa, L.; De Pasquale, A.; Baldassano, S.; Marguglio, N.; Drid, P.; Proia, P.; Vasto, S. New Regenerative and Anti-Aging Medicine Approach Based on Single-Stranded Alpha-1 Collagen for Neo-Collagenesis Induction: Clinical and Instrumental Experience of a New Injective Polycomponent Formulation for Dermal Regeneration. Biomedicines 2024, 12, 916. [Google Scholar] [CrossRef] [PubMed]
- UNI EN ISO 10993-5:2009; Biological Evaluation of Medical Devices–Part 5: In Vitro Cyto-Toxicity Testing. International Organization for Standardization: Geneva, Switzerland, 2009.
- Cruz, A.M.; Gonçalves, M.C.; Marques, M.S.; Veiga, F.; Paiva-Santos, A.C.; Pires, P.C. In Vitro Models for Anti-Aging Efficacy Assessment: A Critical Update in Dermocosmetic Research. Cosmetics 2023, 10, 66. [Google Scholar] [CrossRef]
- Csekes, E.; Racková, L. Skin Aging, Cellular Senescence and Natural Polyphenols. Int. J. Mol. Sci. 2021, 22, 12641. [Google Scholar] [CrossRef] [PubMed]
- Gerasymchuk, M.; Robinson, G.I.; Kovalchuk, O.; Kovalchuk, I. Modeling of the Senescence-Associated Phenotype in Human Skin Fibroblasts. Int. J. Mol. Sci. 2022, 23, 7124. [Google Scholar] [CrossRef] [PubMed]
- de Almeida, A.; de Oliveira, J.; da Silva Pontes, L.V.; de Souza Junior, J.F.; Goncalves, T.A.F.; Dantas, S.H.; de Almeida Feitosa, M.S.; Silva, A.O.; de Medeiros, I.A. ROS: Basic Concepts, Sources, Cellular Signaling, and its Implications in Aging Pathways. Oxid. Med. Cell. Longev. 2022, 2022, 1225578. [Google Scholar] [CrossRef]
- Lee, H.; Hong, Y.; Kim, M. Structural and Functional Changes and Possible Molecular Mechanisms in Aged Skin. Int. J. Mol. Sci. 2021, 22, 12489. [Google Scholar] [CrossRef] [PubMed]
- Fisher, G.J.; Wang, B.; Cui, Y.; Shi, M.; Zhao, Y.; Quan, T.; Voorhees, J.J. Skin aging from the perspective of dermal fibroblasts: The interplay between the adaptation to the extracellular matrix microenvironment and cell autonomous processes. J. Cell Commun. Signal. 2023, 17, 523–529. [Google Scholar] [CrossRef]
- Kim, J.H.; Kwon, T.R.; Hong, S.W.; Seok, J.; Kim, J.M.; Hong, J.Y.; Lee, S.E.; Han, S.W.; Kim, B.J. Comparative Evaluation of the Biodegradability and Wrinkle Reduction Efficacy of Human-Derived Collagen Filler and Hyaluronic Acid Filler. Aesthet. Plast. Surg. 2019, 43, 1095–1101. [Google Scholar] [CrossRef]
- Kim, J.H.; Kwon, T.R.; Lee, S.E.; Jang, Y.N.; Han, H.S.; Mun, S.K.; Kim, B.J. Comparative Evaluation of the Effectiveness of Novel Hyaluronic Acid-Polynucleotide Complex Dermal Filler. Sci. Rep. 2020, 10, 5127. [Google Scholar] [CrossRef]
- La Gatta, A.; Aschettino, M.; Stellavato, A.; D’Agostino, A.; Vassallo, V.; Bedini, E.; Bellia, G.; Schiraldi, C. Hyaluronan Hydrogels for Injection in Superficial Dermal Layers: An In Vitro Characterization to Compare Performance and Unravel the Scientific Basis of Their Indication. Int. J. Mol. Sci. 2021, 22, 6005. [Google Scholar] [CrossRef]
- Courderot-Masuyer, C.; Robin, S.; Tauzin, H.; Humbert, P. Evaluation of lifting and antiwrinkle effects of calcium hydroxylapatite filler quantification of contractile forces of human wrinkle and normal aged fibroblasts treated with calcium hydroxylapatite. J. Cosmet. Dermatol. 2016, 15, 260–268. [Google Scholar] [CrossRef]
- Landau, M.; Fagien, S. Science of Hyaluronic Acid Beyond Filling: Fibroblasts and Their Response to the Extracellular Matrix. Plast. Reconstr. Surg. 2015, 136, 188s–195s. [Google Scholar] [CrossRef]
- Kabakci, A.G.; Cengizler, Ç.; Eren, D.; Bozkir, M.G. Morphometric analysis of the effects of high molecular weight sodium hyaluronate and amino acids mixture on face rejuvenation. J. Cosmet. Dermatol. 2024, 23, 2618–2627. [Google Scholar] [CrossRef]
- Shin, S.H.; Roh, Y.J.; Jin, S.C.; Hong, E.P.; Park, J.K.; Li, K.P.; Seo, S.J.; Park, K.Y. Rheological properties and preclinical data of novel hyaluronic acid filler containing epidermal growth factor. Exp. Dermatol. 2022, 31, 1685–1692. [Google Scholar] [CrossRef]
- Galvez-Martin, P.; Soto-Fernandez, C.; Romero-Rueda, J.; Cabañas, J.; Torrent, A.; Castells, G.; Martinez-Puig, D. A Novel Hyaluronic Acid Matrix Ingredient with Regenerative, Anti-Aging and Antioxidant Capacity. Int. J. Mol. Sci. 2023, 24, 4774. [Google Scholar] [CrossRef]
- Park, K.Y.; Seok, J.; Rho, N.K.; Kim, B.J.; Kim, M.N. Long-chain polynucleotide filler for skin rejuvenation: Efficacy and complications in five patients. Dermatol. Ther. 2016, 29, 37–40. [Google Scholar] [CrossRef]
- Paiva, W.K.V.; Medeiros, W.; Assis, C.F.; Dos Santos, E.S.; de Sousa Junior, F.C. Physicochemical characterization and in vitro antioxidant activity of hyaluronic acid produced by Streptococcus zooepidemicus CCT 7546. Prep. Biochem. Biotechnol. 2022, 52, 234–243. [Google Scholar] [CrossRef]
- Mohammed, A.A.; Niamah, A.K. Identification and antioxidant activity of hyaluronic acid extracted from local isolates of Streptococcus thermophilus. Mater. Today Proc. 2022, 60, 1523–1529. [Google Scholar] [CrossRef]
- Forman, H.J.; Zhang, H. Targeting oxidative stress in disease: Promise and limitations of antioxidant therapy. Nat. Rev. Drug Discov. 2021, 20, 689–709. [Google Scholar] [CrossRef]
- Matsumaru, D.; Motohashi, H. The KEAP1-NRF2 System in Healthy Aging and Longevity. Antioxidants 2021, 10, 1929. [Google Scholar] [CrossRef]
- Ngo, V.; Duennwald, M.L. Nrf2 and Oxidative Stress: A General Overview of Mechanisms and Implications in Human Disease. Antioxidants 2022, 11, 2345. [Google Scholar] [CrossRef]
- Liguori, I.; Russo, G.; Curcio, F.; Bulli, G.; Aran, L.; Della-Morte, D.; Gargiulo, G.; Testa, G.; Cacciatore, F.; Bonaduce, D.; et al. Oxidative stress, aging, and diseases. Clin. Interv. Aging 2018, 13, 757–772. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.M.; Anderson, P.C.; Padgitt, J.K.; Hanson, J.M.; Waters, C.M.; Johnson, J.A. Nrf2, not the estrogen receptor, mediates catechol estrogen-induced activation of the antioxidant responsive element. Biochim. Biophys. Acta 2003, 1629, 92–101. [Google Scholar] [CrossRef] [PubMed]
- Rushworth, S.A.; Macewan, D.J. The role of nrf2 and cytoprotection in regulating chemotherapy resistance of human leukemia cells. Cancers 2011, 3, 1605–1621. [Google Scholar] [CrossRef] [PubMed]
- Bellezza, I.; Tucci, A.; Galli, F.; Grottelli, S.; Mierla, A.L.; Pilolli, F.; Minelli, A. Inhibition of NF-kappaB nuclear translocation via HO-1 activation underlies alpha-tocopheryl succinate toxicity. J. Nutr. Biochem. 2012, 23, 1583–1591. [Google Scholar] [CrossRef]
- Lombardi, F.; Augello, F.R.; Ciafarone, A.; Ciummo, V.; Altamura, S.; Cinque, B.; Palumbo, P. 3D Models Currently Proposed to Investigate Human Skin Aging and Explore Preventive and Reparative Approaches: A Descriptive Review. Biomolecules 2024, 14, 1066. [Google Scholar] [CrossRef]
- Park, S.; Park, K.Y.; Yeo, I.K.; Cho, S.Y.; Ah, Y.C.; Koh, H.J.; Park, W.S.; Kim, B.J. Investigation of the degradation-retarding effect caused by the low swelling capacity of a novel hyaluronic Acid filler developed by solid-phase crosslinking technology. Ann. Dermatol. 2014, 26, 357–362. [Google Scholar] [CrossRef]
- La Gatta, A.; Salzillo, R.; Catalano, C.; D’Agostino, A.; Pirozzi, A.V.A.; De Rosa, M.; Schiraldi, C. Hyaluronan-based hydrogels as dermal fillers: The biophysical properties that translate into a “volumetric” effect. PLoS ONE 2019, 14, e0218287. [Google Scholar] [CrossRef]








| Target mRNA | Forward Primer | Reverse Primer |
|---|---|---|
| MMP-1 | GCTAACAAATACTGGAGGTATGATG | GTCATGTGCTATCATTTTGGGA |
| MMP-9 | CTGGACAGCCAGACACTAAAG | CTCGCGGCAAGTCTTCAGAG |
| GAPDH | TTGCCCTCAACGACCACTTT | TGGTCCAGGGGTCTTACTCC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Augello, F.R.; Lombardi, F.; Ciafarone, A.; Ciummo, V.; Altamura, S.; Giuliani, M.; Cinque, B.; Palumbo, P. Efficacy of an Innovative Poly-Component Formulation in Counteracting Human Dermal Fibroblast Aging by Influencing Oxidative and Inflammatory Pathways. Biomedicines 2024, 12, 2030. https://doi.org/10.3390/biomedicines12092030
Augello FR, Lombardi F, Ciafarone A, Ciummo V, Altamura S, Giuliani M, Cinque B, Palumbo P. Efficacy of an Innovative Poly-Component Formulation in Counteracting Human Dermal Fibroblast Aging by Influencing Oxidative and Inflammatory Pathways. Biomedicines. 2024; 12(9):2030. https://doi.org/10.3390/biomedicines12092030
Chicago/Turabian StyleAugello, Francesca Rosaria, Francesca Lombardi, Alessia Ciafarone, Valeria Ciummo, Serena Altamura, Maurizio Giuliani, Benedetta Cinque, and Paola Palumbo. 2024. "Efficacy of an Innovative Poly-Component Formulation in Counteracting Human Dermal Fibroblast Aging by Influencing Oxidative and Inflammatory Pathways" Biomedicines 12, no. 9: 2030. https://doi.org/10.3390/biomedicines12092030
APA StyleAugello, F. R., Lombardi, F., Ciafarone, A., Ciummo, V., Altamura, S., Giuliani, M., Cinque, B., & Palumbo, P. (2024). Efficacy of an Innovative Poly-Component Formulation in Counteracting Human Dermal Fibroblast Aging by Influencing Oxidative and Inflammatory Pathways. Biomedicines, 12(9), 2030. https://doi.org/10.3390/biomedicines12092030

