Expression of CISH, an Inhibitor of NK Cell Function, Increases in Association with Ovarian Cancer Development and Progression
Abstract
1. Introduction
2. Materials and Methods
2.1. Clinical Specimens
2.2. Immunohistochemistry
Counting of Immunopositive Cells or Intensity of Immunostaining
2.3. Immunoblotting
2.4. Reverse-Transcriptase Polymerase Chain Reaction (RT-PCR) and Quantitative-RT-PCR (q-RT-PCR)
| CISH- | F: CTGCTGTGCATAGCCAAGAC | R: TAAGAACGTGCCTTCTGGCAT |
| IL-10- | F: CCTGCCTAACATGCTTCGAGA | R: TGGCAACCCAGGTAACCCTT |
| GRP78- | F: GCCTGTATTTCTAGACCTGCC | R: TTCATCTTGCCAGCCAGTTG |
| β -Actin- | F: CCACCATGTACCCTGGCATT | R: GTACTTGCGCTCAGGAGGAG |
2.5. Statistical Analysis
3. Results
3.1. Microscopic Features of Ovarian Malignant Tumors
3.2. Changes in Population of Ovarian CISH-Expressing Cells during OVCA Development and Progression
3.3. Development and Progression of OVCA Are Associated with Increased Expression of IL-10
3.4. Overexpression of CISH and IL-10 during OVCA Development and Progression Are Associated with Increased Expression of GRP78
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Paris, E.A.; Bahr, J.M.; Bitterman, P.; Basu, S.; Abramowicz, J.S.; Barua, A. Incidence of malignant transformation in the oviductal fimbria in laying hens, a preclinical model of spontaneous ovarian cancer. PLoS ONE 2021, 16, e0255007. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zheng, S.; Fu, Y. Age-related copy number variations and expression levels of F-box protein FBXL20 predict ovarian cancer prognosis. Transl. Oncol. 2020, 13, 100863. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Abubaker, K.; Latifi, A.; Luwor, R.; Nazaretian, S.; Zhu, H.; Quinn, M.A.; Thompson, E.W.; Findlay, J.K.; Ahmed, N. Short-term single treatment of chemotherapy results in the enrichment of ovarian cancer stem cell-like cells leading to an increased tumor burden. Mol. Cancer 2013, 12, 24. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Palaia, I.; Tomao, F.; Sassu, C.M.; Musacchio, L.; Benedetti Panici, P. Immunotherapy For Ovarian Cancer: Recent Advances And Combination Therapeutic Approaches. Onco Targets Ther. 2020, 13, 6109–6129. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Farsinejad, S.; Cattabiani, T.; Muranen, T.; Iwanicki, M. Ovarian Cancer Dissemination-A Cell Biologist’s Perspective. Cancers 2019, 11, 1957. [Google Scholar] [CrossRef] [Scilit]
- Preston, C.C.; Goode, E.L.; Hartmann, L.C.; Kalli, K.R.; Knutson, K.L. Immunity and immune suppression in human ovarian cancer. Immunotherapy 2011, 3, 539–556. [Google Scholar] [CrossRef] [Scilit]
- Wertel, I.; Okła, K.; Surówka, J.; Bilska, M.; Polak, G.; Bednarek, W.; Kotarski, J. Why ovarian cancer cells escape from immune surveillance? Wiad. Lek. 2017, 70, 74–80. [Google Scholar]
- Tang, F.; Du, X.; Liu, M.; Zheng, P.; Liu, Y. Anti-CTLA-4 antibodies in cancer immunotherapy: Selective depletion of intratumoral regulatory T cells or checkpoint blockade? Cell Biosci. 2018, 8, 30. [Google Scholar] [CrossRef] [Scilit]
- Seidel, J.A.; Otsuka, A.; Kabashima, K. Anti-PD-1 and Anti-CTLA-4 Therapies in Cancer: Mechanisms of Action, Efficacy, and Limitations. Front. Oncol. 2018, 8, 86. [Google Scholar] [CrossRef] [Scilit]
- Kärre, K. NK cells, MHC class I molecules and the missing self. Scand. J. Immunol. 2002, 55, 221–228. [Google Scholar] [CrossRef] [Scilit]
- Lanier, L.L.; Phillips, J.H. Inhibitory MHC class I receptors on NK cells and T cells. Immunol. Today 1996, 17, 86–91. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xing, S.; Ferrari de Andrade, L. NKG2D and MICA/B shedding: A ‘tag game’ between NK cells and malignant cells. Clin. Transl. Immunol. 2020, 9, e1230. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Felder, M.; Kapur, A.; Gonzalez-Bosquet, J.; Horibata, S.; Heintz, J.; Albrecht, R.; Fass, L.; Kaur, J.; Hu, K.; Shojaei, H.; et al. MUC16 (CA125): Tumor biomarker to cancer therapy, a work in progress. Mol. Cancer 2014, 13, 129. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- da Silva, R.F.; Yoshida, A.; Cardozo, D.M.; Jales, R.M.; Paust, S.; Derchain, S.; Guimaraes, F. Natural Killer Cells Response to IL-2 Stimulation Is Distinct between Ascites with the Presence or Absence of Malignant Cells in Ovarian Cancer Patients. Int. J. Mol. Sci. 2017, 18, 856. [Google Scholar] [CrossRef] [Scilit]
- Carlsten, M.; Norell, H.; Bryceson, Y.T.; Poschke, I.; Schedvins, K.; Ljunggren, H.G.; Kiessling, R.; Malmberg, K.J. Primary human tumor cells expressing CD155 impair tumor targeting by down-regulating DNAM-1 on NK cells. J. Immunol. 2009, 183, 4921–4930. [Google Scholar] [CrossRef] [Scilit]
- Barua, A.; Bradaric, M.J.; Bitterman, P.; Abramowicz, J.S.; Sharma, S.; Basu, S.; Lopez, H.; Bahr, J.M. Dietary supplementation of Ashwagandha (Withania somnifera, Dunal) enhances NK cell function in ovarian tumors in the laying hen model of spontaneous ovarian cancer. Am. J. Reprod. Immunol. 2013, 70, 538–550. [Google Scholar] [CrossRef] [Scilit]
- Felices, M.; Lenvik, A.J.; McElmurry, R.; Chu, S.; Hinderlie, P.; Bendzick, L.; Geller, M.A.; Tolar, J.; Blazar, B.R.; Miller, J.S. Continuous treatment with IL-15 exhausts human NK cells via a metabolic defect. JCI Insight 2018, 3, e96219. [Google Scholar] [CrossRef] [Scilit]
- Zhu, H.; Blum, R.H.; Bernareggi, D.; Ask, E.H.; Wu, Z.; Hoel, H.J.; Meng, Z.; Wu, C.; Guan, K.L.; Malmberg, K.J.; et al. Metabolic Reprograming via Deletion of CISH in Human iPSC-Derived NK Cells Promotes In Vivo Persistence and Enhances Anti-tumor Activity. Cell Stem. Cell 2020, 27, 224–237.e6. [Google Scholar] [CrossRef] [Scilit]
- Batchu, R.B.; Gruzdyn, O.V.; Kolli, B.K.; Dachepalli, R.; Umar, P.S.; Rai, S.K.; Singh, N.; Tavva, P.S.; Weaver, D.W.; Gruber, S.A. IL-10 Signaling in the Tumor Microenvironment of Ovarian Cancer. Adv. Exp. Med. Biol. 2021, 1290, 51–65. [Google Scholar] [CrossRef] [Scilit]
- Fiore, P.F.; Di Matteo, S.; Tumino, N.; Mariotti, F.R.; Pietra, G.; Ottonello, S.; Negrini, S.; Bottazzi, B.; Moretta, L.; Mortier, E.; et al. Interleukin-15 and cancer: Some solved and many unsolved questions. J. Immunother Cancer 2020, 8, e001428. [Google Scholar] [CrossRef] [Scilit]
- Iyer, S.S.; Cheng, G. Role of interleukin 10 transcriptional regulation in inflammation and autoimmune disease. Crit. Rev. Immunol. 2012, 32, 23–63. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rojas, J.M.; Avia, M.; Martín, V.; Sevilla, N. IL-10: A Multifunctional Cytokine in Viral Infections. J. Immunol. Res. 2017, 2017, 6104054. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rutz, S.; Ouyang, W. Regulation of Interleukin-10 Expression. Adv. Exp. Med. Biol. 2016, 941, 89–116. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Casas, C. GRP78 at the Centre of the Stage in Cancer and Neuroprotection. Front. Neurosci. 2017, 11, 177. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ibrahim, I.M.; Abdelmalek, D.H.; Elfiky, A.A. GRP78: A cell’s response to stress. Life Sci. 2019, 226, 156–163. [Google Scholar] [CrossRef] [Scilit]
- Qin, K.; Ma, S.; Li, H.; Wu, M.; Sun, Y.; Fu, M.; Guo, Z.; Zhu, H.; Gong, F.; Lei, P.; et al. GRP78 Impairs Production of Lipopolysaccharide-Induced Cytokines by Interaction with CD14. Front. Immunol. 2017, 8, 579. [Google Scholar] [CrossRef] [Scilit]
- Barua, A.; Bitterman, P.; Abramowicz, J.S.; Dirks, A.L.; Bahr, J.M.; Hales, D.B.; Bradaric, M.J.; Edassery, S.L.; Rotmensch, J.; Luborsky, J.L. Histopathology of ovarian tumors in laying hens: A preclinical model of human ovarian cancer. Int. J. Gynecol. Cancer 2009, 19, 531–539. [Google Scholar] [CrossRef] [Scilit]
- Prat, J. Staging classification for cancer of the ovary, fallopian tube, and peritoneum. Int. J. Gynaecol. Obstet. 2014, 124, 1–5. [Google Scholar] [CrossRef] [Scilit]
- Yellapa, A.; Bitterman, P.; Sharma, S.; Guirguis, A.S.; Bahr, J.M.; Basu, S.; Abramowicz, J.S.; Barua, A. Interleukin 16 expression changes in association with ovarian malignant transformation. Am. J. Obstet. Gynecol. 2014, 210, e271–e272. [Google Scholar] [CrossRef] [Scilit]
- Allam, S.; Paris, E.; Lazcano, I.; Bitterman, P.; Basu, S.; O’Donnell, J.; Barua, A. Detection of Cannabinoid Receptor Expression by Endometriotic Lesions in Women with Endometriosis as an Alternative to Opioid-Based Pain Medication. J. Immunol. Res. 2022, 2022, 4323259. [Google Scholar] [CrossRef] [Scilit]
- Khan, M.F.; Bahr, J.M.; Yellapa, A.; Bitterman, P.; Abramowicz, J.S.; Edassery, S.L.; Basu, S.; Rotmensch, J.; Barua, A. Expression of Leukocyte Inhibitory Immunoglobulin-like Transcript 3 Receptors by Ovarian Tumors in Laying Hen Model of Spontaneous Ovarian Cancer. Transl. Oncol. 2012, 5, 85–91. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, H.J.; Bahr, J.M.; Bitterman, P.; Basu, S.; Sharma, S.; Abramowicz, J.S.; Barua, A. Polycystic Ovarian Condition May Be a Risk Factor for Ovarian Tumor Development in the Laying Hen Model of Spontaneous Ovarian Cancer. J. Immunol. Res. 2018, 2018, 2590910. [Google Scholar] [CrossRef] [Scilit]
- Pukac, L.A.; Carter, J.E.; Morrison, K.S.; Karnovsky, M.J. Enhancement of Diaminobenzidine Colorimetric Signal in Immunoblotting. BioTechniques 1997, 23, 385–388. [Google Scholar] [CrossRef] [Scilit]
- Ramirez, J.; Bitterman, P.; Basu, S.; Barua, A. Changes in IL-16 Expression in the Ovary during Aging and Its Potential Consequences to Ovarian Pathology. J. Immunol. Res. 2022, 2022, 2870389. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Luborsky, J.; Barua, A.; Edassery, S.; Bahr, J.M.; Edassery, S.L. Inflammasome expression is higher in ovarian tumors than in normal ovary. PLoS ONE 2020, 15, e0227081. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Delconte, R.B.; Kolesnik, T.B.; Dagley, L.F.; Rautela, J.; Shi, W.; Putz, E.M.; Stannard, K.; Zhang, J.G.; Teh, C.; Firth, M.; et al. CIS is a potent checkpoint in NK cell-mediated tumor immunity. Nat. Immunol. 2016, 17, 816–824. [Google Scholar] [CrossRef] [Scilit]
- Wu, J.; Lanier, L.L. Natural killer cells and cancer. Adv. Cancer Res. 2003, 90, 127–156. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pardoll, D.M. Distinct mechanisms of tumor resistance to NK killing: Of mice and men. Immunity 2015, 42, 605–606. [Google Scholar] [CrossRef] [Scilit]
- Kartikasari, A.E.R.; Huertas, C.S.; Mitchell, A.; Plebanski, M. Tumor-Induced Inflammatory Cytokines and the Emerging Diagnostic Devices for Cancer Detection and Prognosis. Front. Oncol. 2021, 11, 692142. [Google Scholar] [CrossRef] [Scilit]
- Kano, A. Tumor cell secretion of soluble factor(s) for specific immunosuppression. Sci. Rep. 2015, 5, 8913. [Google Scholar] [CrossRef] [Scilit]
- Oft, M. IL-10: Master switch from tumor-promoting inflammation to antitumor immunity. Cancer Immunol. Res. 2014, 2, 194–199. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mirlekar, B. Tumor promoting roles of IL-10, TGF-β, IL-4, and IL-35: Its implications in cancer immunotherapy. SAGE Open Med. 2022, 10, 20503121211069012. [Google Scholar] [CrossRef] [Scilit]
- Fernanda Costa Brandão, B.; de Oliveira, K.B. IL-10 in cancer: Just a classical immunosuppressive factor or also an immunostimulating one? AIMS Allergy Immunol. 2018, 2, 88–97. [Google Scholar] [CrossRef] [Scilit]
- Sheikhpour, E.; Noorbakhsh, P.; Foroughi, E.; Farahnak, S.; Nasiri, R.; Neamatzadeh, H. A Survey on the Role of Interleukin-10 in Breast Cancer: A Narrative. Rep. Biochem. Mol. Biol. 2018, 7, 30–37. [Google Scholar] [PubMed]
- Steen, E.H.; Wang, X.; Balaji, S.; Butte, M.J.; Bollyky, P.L.; Keswani, S.G. The Role of the Anti-Inflammatory Cytokine Interleukin-10 in Tissue Fibrosis. Adv. Wound Care 2020, 9, 184–198. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Carson, W.; Lindemann, M.; Baiocchi, R.; Linett, M.; Tan, J.; Chou, C.; Narula, S.; Caligiuri, M. The functional characterization of interleukin-10 receptor expression on human natural killer cells. Blood 1995, 85, 3577–3585. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Delie, F.; Petignat, P.; Cohen, M. GRP78 Protein Expression in Ovarian Cancer Patients and Perspectives for a Drug-Targeting Approach. J. Oncol. 2012, 2012, 468615. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, A.S. GRP78 Induction in Cancer: Therapeutic and Prognostic Implications. Cancer Res. 2007, 67, 3496–3499. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.; Wang, J.H.; Zhang, X.L.; Wang, X.L.; Yang, L. Endoplasmic reticulum chaperone glucose-regulated protein 78 in gastric cancer: An emerging biomarker (Review). Oncol. Lett. 2018, 15, 6087–6093. [Google Scholar] [CrossRef] [Scilit]
- Niu, Z.; Wang, M.; Zhou, L.; Yao, L.; Liao, Q.; Zhao, Y. Elevated GRP78 expression is associated with poor prognosis in patients with pancreatic cancer. Sci. Rep. 2015, 5, 16067. [Google Scholar] [CrossRef] [Scilit]
- Yao, X.; Liu, H.; Zhang, X.; Zhang, L.; Li, X.; Wang, C.; Sun, S. Cell Surface GRP78 Accelerated Breast Cancer Cell Proliferation and Migration by Activating STAT3. PLoS ONE 2015, 10, e0125634. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Couper, K.N.; Blount, D.G.; Riley, E.M. IL-10: The Master Regulator of Immunity to Infection. J. Immunol. 2008, 180, 5771–5777. [Google Scholar] [CrossRef] [Scilit] [PubMed]




Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Acosta, J.C.; Bahr, J.M.; Basu, S.; O’Donnell, J.T.; Barua, A. Expression of CISH, an Inhibitor of NK Cell Function, Increases in Association with Ovarian Cancer Development and Progression. Biomedicines 2023, 11, 299. https://doi.org/10.3390/biomedicines11020299
Acosta JC, Bahr JM, Basu S, O’Donnell JT, Barua A. Expression of CISH, an Inhibitor of NK Cell Function, Increases in Association with Ovarian Cancer Development and Progression. Biomedicines. 2023; 11(2):299. https://doi.org/10.3390/biomedicines11020299
Chicago/Turabian StyleAcosta, Jasmin C., Janice M. Bahr, Sanjib Basu, James T. O’Donnell, and Animesh Barua. 2023. "Expression of CISH, an Inhibitor of NK Cell Function, Increases in Association with Ovarian Cancer Development and Progression" Biomedicines 11, no. 2: 299. https://doi.org/10.3390/biomedicines11020299
APA StyleAcosta, J. C., Bahr, J. M., Basu, S., O’Donnell, J. T., & Barua, A. (2023). Expression of CISH, an Inhibitor of NK Cell Function, Increases in Association with Ovarian Cancer Development and Progression. Biomedicines, 11(2), 299. https://doi.org/10.3390/biomedicines11020299

