Next Article in Journal
Longitudinal Measurement of Histidine-Rich Glycoprotein Levels in Bronchopulmonary Dysplasia: A Pilot Study
Previous Article in Journal
Biomechanical Properties of the Aortic Wall: Changes during Vascular Calcification
Previous Article in Special Issue
Stabilization of F-Actin Cytoskeleton by Paclitaxel Improves the Blastocyst Developmental Competence through P38 MAPK Activity in Porcine Embryos
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Biomedicines
Volume 11
Issue 1
10.3390/biomedicines11010210
biomedicines-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Inflammatory Cytokine-Induced HIF-1 Activation Promotes Epithelial–Mesenchymal Transition in Endometrial Epithelial Cells

by
Yoshiko Hashimoto
1,
Tomoko Tsuzuki-Nakao
1,
Naoko Kida
1,
Yoshiyuki Matsuo
2,
Tetsuo Maruyama
3,
Hidetaka Okada
1 and
Kiichi Hirota
2,*
1
Department of Obstetrics and Gynecology, Kansai Medical University, 2-5-1 Shinmachi, Hirakata 573-1191, Japan
2
Department of Human Stress Response Science, Institute of Biomedical Science, Kansai Medical University, 2-5-1 Shinmachi, Hirakata 573-1010, Japan
3
Department of Obstetrics and Gynecology, Keio University School of Medicine, Tokyo 160-8582, Japan
*
Author to whom correspondence should be addressed.
Biomedicines 2023, 11(1), 210; https://doi.org/10.3390/biomedicines11010210
Submission received: 30 October 2022 / Revised: 10 January 2023 / Accepted: 12 January 2023 / Published: 14 January 2023
(This article belongs to the Special Issue Molecular and Cellular Biology in Reproductive Medicine)
Browse Figures
Versions Notes

Abstract

:
The endometrium undergoes repeated proliferation and shedding during the menstrual cycle. Significant changes to this environment include fluctuations in the partial pressure of oxygen, exposure to a high-cytokine environment associated with intrauterine infection, and inflammation. Chronic endometritis is a condition wherein mild inflammation persists in the endometrium and is one of the causes of implantation failure and miscarriage in early pregnancy. It is thought that the invasion of embryos into the endometrium requires epithelial–mesenchymal transition (EMT)-associated changes in the endometrial epithelium. However, the effects of inflammation on the endometrium remain poorly understood. In this study, we investigated the effects of the intrauterine oxygen environment, hypoxia-inducible factor (HIF), and inflammation on the differentiation and function of endometrial epithelial cells. We elucidated the ways in which inflammatory cytokines affect HIF activity and EMT in an immortalized cell line (EM-E6/E7/TERT) derived from endometrial epithelium. Pro-inflammatory cytokines caused significant accumulation of HIF-1α protein, increased HIF-1α mRNA levels, and enhanced hypoxia-induced accumulation of HIF-1α protein. The combined effect of inflammatory cytokines and hypoxia increased the expression of EMT-inducing factors and upregulated cell migration. Our findings indicate that pro-inflammatory factors, including cytokines and LPS, work synergistically with hypoxia to activate HIF-1 and promote EMT in endometrial epithelial cells.

1. Introduction

The endometrium undergoes repeated proliferation and shedding during the menstrual cycle. Important changes to this environment include fluctuations in the partial pressure of oxygen, exposure to a high-cytokine environment associated with intrauterine infection, and inflammation. Numerous studies support the idea that hypoxia-inducible factors (HIFs) play a key role in the dynamics of endometrial shedding during menstruation owing to considerable changes in the oxygen partial pressure in tissue [1,2,3,4,5]. Pathways regulating HIF activation, independent of changes in oxygen partial pressure, have also been identified [6,7,8]. Inflammation plays essential roles as prostaglandins and inflammatory mediators, such as tumor necrosis factor-α (TNFα) and lipopolysaccharide (LPS), induce HIF-1α activation under non-hypoxic conditions [9,10,11]. The regulatory pathway of HIF activity by these inflammatory agents, together with the regulation of activation by changes in the partial pressure of oxygen, explain the diverse roles of HIF. HIF-1 activation by pro-inflammatory cytokines has been documented in various cells, including macrophages, monocytes, hepatocytes, and renal cells [12,13,14]. The regulation of HIF activity through these inflammatory agents along with changes in oxygen partial pressure—including hypoxia—hint at the diverse roles of HIF. However, few studies have reported HIF activity in the endometrium under inflammatory conditions.
Chronic endometritis is a condition in which mild inflammation persists in the endometrium [15]. It is considered one of the causes of implantation failure and miscarriage in early pregnancy [16,17]. Chronic endometritis is a reactive process caused by bacterial infection, among other factors, and occurs in 2.8–56.8% of infertile women [18,19,20,21]. This broad range of the frequency of occurrence is likely due to a lack of uniform diagnostic criteria, which stems from a lack of knowledge regarding its pathogenesis. In addition to chronic endometritis, endometriosis is also one of the benign and chronic inflammatory diseases associated with the endometrium wherein endometrium-like tissues are present outside the uterus. Endometriosis has unique characteristics in that endometriotic cells share some features with cancer cells, such as invasiveness and metastatic potential. Several studies have indicated that the epithelial–mesenchymal transition (EMT) is involved in the pathogenesis of endometriosis [22,23,24]. In the EMT, epithelial traits are lost, mesenchymal features develop, and the potential for migration and invasion is boosted. E-cadherin deficiency is closely associated with cancer invasion and poor prognosis in patients with endometrial cancer [25]. A fertility-preserving treatment can be taken into consideration in some patients with early-stage endometrial cancer, since it occurs in up to 29% of women before 40 years of age [26,27]. The prediction of prognosis is an important component of the choice of treatment, and one of the established prognostic factors is the mutation of genes including PTEN, POLE, and TP53 [28]. On the other hand, several investigations found genetic anomalies in tumor-suppressing genes such as TP53 and PTEN in endometriosis, a chronic inflammatory disease [29,30]. Inflammatory cells and cytokines promote the production of reactive oxygen species, which may, in turn, induce DNA damage and gene mutations. Deletions or mutations in tumor-suppressor genes such as TP53 and PTEN have been reported to result in the activation of HIFs even under non-hypoxic conditions [7,31]. High expression of HIF-1α has also been shown to predict decreased survival in endometrial cancer [32]. The induction of the EMT and increased expression of HIFs have recently been reported in endometriotic lesions, which consist mainly of stromal and glandular epithelial cells [33,34]. To elucidate potential therapeutic targets for diseases of the endometrium, it is imperative that we evaluate the involvement of endometrial cells in the EMT and that of inflammatory agents under hypoxia.
This study investigates the interaction between the intrauterine oxygen environment, HIF activation, and inflammation, and evaluates the roles of these interactions in the differentiation and function of endometrial epithelial cells. We used an immortalized cell line derived from endometrial epithelium to examine how inflammatory cytokines affect the activity of the transcription factor HIF and its consequent impact on the EMT.

2. Materials and Methods

2.1. Reagents

Recombinant human TNFα and IL-1β were purchased from PeproTech (Cranbury, NJ, USA), and LPS (from E. coli O111:B4) was purchased from InvivoGen (Toulouse, France). N-(2-methoxy-2-oxoacetyl) glycine methyl ester (DMOG; Sigma-Aldrich, St. Louis, MO, USA) and N-acetyl-L-cysteine (NAC; Abcam, Cambridge, UK) were dissolved in ultrapure water, LY294002 (FUJIFILM Wako Pure Chemical Corporation, Osaka, Japan), PD98059 (FUJIFILM), and SC-514 (Sigma-Aldrich) in dimethyl sulfoxide. Echinomycin was purchased from Enzo Life Sciences (Farmingdale, NY, USA). Table A1 provides a list of the reagents and supplies utilized in this study.

2.2. Cell Culture

The immortalized human endometrial epithelial cell line EM-E6/E7/TERT was kindly provided by Dr. T. Maruyama (Keio University School of Medicine, Shinjuku, Tokyo, Japan) [35]. Cells were cultured on plastic dishes and maintained in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal calf serum (FCS; HyClone, Logan, UT, USA), 100 U/mL penicillin, and 0.1 mg/mL streptomycin (Nacalai Tesque, Kyoto, Japan) at 37 °C under 5% CO2 in a humidified incubator.

2.3. Western Blot Analysis

As previously mentioned [36,37], whole-cell lysates were created using lysis solution including RIPA buffer (FUJI-FILM) and a protease inhibitor cocktail (Calbiochem, La Jolla, CA, USA). To create cell pellets, the samples were centrifuged at 10,000× g. A Bio-Rad DC Protein Assay was used to measure protein concentrations (Bio-Rad La-boratories, Hercules, CA, USA). Using a Trans-Blot Turbo transfer device, equal amounts of lysates were electrophoresed on a 7.5 or 12% sodium dodecyl sulfate polyacrylamide gel and electro-transferred onto membranes (Bio-Rad). Blocking One solution (Nacalai Tesque) was used to block non-specific binding sites for 20 min. Purified primary antibodies were used to probe the membranes, including mouse monoclonal anti-HIF-1α (1:1000; BD Transduction Laboratories, Tokyo, Japan), rabbit polyclonal anti-HIF-2α (1:1000; Novus Biologicals, Centennial, CO, USA), rabbit monoclonal anti-HIF-1 β(1:1000; Cell Signaling Technology, Danvers, MA, USA), rabbit monoclonal anti-p44/42 MAPK (1:2000), rabbit monoclonal anti-p38 MAPK (1:1000), rabbit monoclonal anti-Phospho-p44/42 MAPK (1:1000), rabbit monoclonal anti-Phospho-p38 MAPK (1:1000; Cell Signaling Technology), and mouse monoclonal anti-β-actin (1:5000; Sigma-Aldrich). Anti-rabbit IgG peroxidase-labeled (1:5000; Cell Signaling Technology) or anti-mouse IgG peroxidase-labeled (1:5000; Cytiva, Marlborough, MA, USA) antibodies were used as secondary antibodies. Enhanced chemi-luminescence and Western-blotting detection agents were used to observe immune complexes (Cytiva).

2.4. Semi-Quantitative Reverse Transcriptase-Polymerase Chain Reaction (qRT-PCR)

Total RNA was extracted from the cells using a Maxwell RSC simplyRNA Cells Kit (Promega, Madison, WI, USA). Reverse transcription was carried out in accordance with the manufacturer’s instructions using a first-strand cDNA synthesis kit called ReverTra Ace qPCR RT master mix from TOYOBO in Osaka, Japan. Using a Thunderbird SYBER qPCR mix kit (TOYOBO) and Rotor-Gene QHRM (Qiagen, Hilden, Germany) in accordance with the manufacturer’s guidelines, real-time PCR was carried out. The Ct technique was used to calculate the relative gene expression. The elongation factor (EF)-1, which was utilized as an internal control, was used to standardize Ct readings. The list of primer sets used for RT-PCR is displayed in Table 1.

2.5. RNA-Seq

Total RNA was extracted from the cells using a Maxwell RSC simplyRNA Cells Kit (Promega). RNA sequence libraries were prepared using a TruSeq Stranded mRNA Sample Prep Kit and a TruSeq Stranded mRNA Library Preparation Kit (Illu-mina, San Diego, CA, USA) and sequenced in 100 bp paired-end reads on a NovaSeq 6000 platform (Illumina). The raw sequencing data were deposited in the Sequence Read Archive (https://www.ddbj.nig.ac.jp/dra/index-e.html, accessed on 14 July 2022; accession numbers: DRR395305–DRR395313). RNA-Seq was carried out three times. The website protocols.io (dx.doi.org/10.17504/protocols.io.x9qfr5w) contains detailed protocols.

2.6. Transcriptomics Analysis

Transcriptomic analysis was carried out as previously described [36,37]. RNA-Seq reads were quantified using ikra v1.2.2 [38]—an RNA-Seq pipeline centered on Salmon. Trim Galore! v0.6.6 and Cutadapt v3.2 were used to process FASTQ files from transcriptome sequencing using the default parameters [39,40]. Using Salmon v1.4.0 and default parameters, trim FASTQ files were quantified in transcripts per million (TPM) [41]. In order to analyze Gene Ontology (GO) data from RNA-Seq, count tables were imported into integrated differential expression and pathway analysis (iDEP) v 0.91 [42]. At least one sample of quantified transcript readings was filtered at 0.5 counts per million (CPM) and log2-transformed (CPM + c) using EdgeR with a pseudocount of 4. iDEP’s gene set enrichment analysis was carried out using the DESeq2 fold-change values. False-positive rates with q < 0.05 were deemed enriched and subjected to further research. The TRRUST method [43,44], which is used to analyze human transcriptional regulatory interactions, was applied using the web-based Metascape algorithm [45].

2.7. Wound Healing Assay

Cells were seeded in 60 mm dishes and cultured overnight. We used a sterile pipette tip to scratch confluent monolayer cells, which were then cultured in the absence or presence of 500 ng/mL TNFα with 100 ng/mL IL-1β and exposed for 24 h to 20% or 1% O2 and 5% CO2 balanced with nitrogen. Images for each scratch were recorded at 0, 6, 12, 18, and 24 h using a BZ-9000 fluorescence microscope (Keyence, Itasca, IL, USA). Quantification was performed by measuring the number of pixels in each wound closure area using Image J v1.51 (National Institutes of Health, Bethesda, MD, USA).

2.8. Statistical Analysis

Data are presented as the mean ± standard deviation (SD). Differences between groups were evaluated using one-way analysis of variance (ANOVA), followed by Dunnett’s or Tukey’s test for multiple comparisons. GraphPad Prism 8 was used to conduct the statistical analysis (GraphPad Software, La Jolla, CA, USA). The cutoff for statistical significance was set to p < 0.05.

3. Results

3.1. Pro-Inflammatory Agents Induce HIF-1α Protein Accumulation under Non-Hypoxic Conditions in Endometrial Epithelial Cells

To investigate the effects of pro-inflammatory cytokines and LPS on the activation of transcription factor HIFs, including HIF-1 and HIF-2, the immortalized endometrial epithelial cells EM-E6/E7/TERT were exposed to TNFα, IL-1β, LPS, or DMOG under 1% or 20% O2 for 6 h (Figure 1A and Figure S1). HIF-1α and HIF-2α protein accumulation was induced by exposure to 1% O2 or DMOG (1 mmol/L) under 20% O2 conditions (Figure S1). An atmosphere of 1% O2 and DMOG are authoritative stimuli for HIF-1 activation in endometrial epithelial cells as well. Exposure to TNFα (500 ng/mL), IL-1β (100 ng/mL), or LPS (500 ng/mL) alone did not alter the protein expression of HIF-1α under normoxia. Although not statistically significant in the densitometric evaluation, we observed a reproducible induction of HIF-1α protein in response to combined exposure to these cytokines, even under normoxic conditions. HIF-2α and HIF-1β protein levels were unaffected by any treatment (Figure 1B). We examined the expression of HIF-1α, HIF-2α, and HIF-1β mRNAs using semi-quantitative qRT-PCR and found that TNFα, IL-1β, and LPS alone did not affect HIF-1α mRNA levels, but in combination, they increased HIF-1α mRNA levels within 6 h. Exposure to 1% O2 did not alter HIF-1α mRNA levels. The mRNA levels of HIF-2α and HIF-1β were not affected by inflammatory cytokines, LPS, or hypoxia (Figure 1C).
Next, we examined HIF activation under 5% O2 conditions, which is close to the O2 environment in the uterus. IL-1β or TNFα and IL-1β treatment enhanced HIF-1α protein expression induced by 5% oxygen conditions (Figure 2A,B). Pro-inflammatory agents and hypoxic stimuli synergistically induced HIF activation.

3.2. Involvement of the PI3K and MAPK Signaling Pathway in Cytokine-Induced HIF-1 Activation

It is known that the PI3k-Akt-mTOR pathway promotes HIF-1α translation, and in parallel with this pathway, a MAPK-mediated increase in HIF-1α translation has also been reported [46]. We investigated the signaling pathway involved in pro-inflammatory cytokine-induced HIF activation in EM-E6/E7/TERT cells. We investigated the effects of kinase inhibitors to determine whether PI3K or MAPK signaling was involved in the regulation of HIF-1 protein levels. We discovered that LY294002 (25 µmol/L), PD98059 (20 µmol/L), and SC-514 (100 µmol/L) attenuated TNFα- (500 ng/mL) and IL-1β (500 ng/mL)-induced HIF-1α protein expression (Figure 3A). We also investigated the phosphorylation of ERK1/2 and p38 proteins exposed to pro-inflammatory cytokines or hypoxia in EM-E6/E7/TERT cells. Treatment with TNFα and IL-1β or hypoxia increased the levels of phosphorylated p38 and ERK. We detected further phosphorylation of ERK1/2 and p38 as the levels of inflammatory cytokines increased during hypoxia. ERK1/2 and p38 protein expression was not affected by cytokine or hypoxic treatment (Figure 3B,C).

3.3. Global Gene Expression Analysis Using RNA-Seq

To investigate the effects of proinflammatory cytokines and hypoxia (1% O2 conditions), we used RNA-Seq to examine the patterns of gene expression throughout the entire genome. EM-E6/E7/TERT cells were exposed to 1% O2 or either TNF (500 ng/mL) or IL-1 (100 ng/mL) for 8 h (Table S1). For differential expression and pathway analysis, the expression matrix, which represents transcripts per kilobase million (TPM) values aggregated at the gene level, was utilized. The results of the principal component analysis (PCA) and hierarchical clustering analysis are presented in Figure S2. Among the genes whose expression was regulated by transcription factor HIF-1, the expression of PDK1, VEGFA, SLCA2A1, and LDHA was demonstrated as a heatmap with HIF1A and EPAS1. The expression of PDK1, VEGFA, SLCA2A1, and LDHA was induced by cytokine or hypoxic treatment (Figure 4A). Interestingly, and consistent with our qRT-PCR results (Figure 1C), HIF1A expression was induced by the cytokine treatment. Gene set enrichment analysis (GSEA) was used to compare genes whose expression ratios were significantly altered under pro-inflammatory cytokine exposure (Figure S3) and hypoxic conditions (Figure S4). We observed the enrichment of some pathways associated with inflammation (Figure 4B and Figure S3, Table S2). In addition to the inflammatory pathways, the “response to hypoxia” (GO:0001666) pathway was identified with statistical significance (LogP < –11). “Responses to decreased oxygen levels” (GO:0036293) and “response to oxygen levels” (GO:0070482) were also identified as enriched pathways. Figure 4B displays the expression levels of the selected genes inside GO:0071456 (cellular response to hypoxia). Pathways such as wound healing (GO:0042060) and epithelial cell migration (GO:0010631) were also enriched. From a list of common genes (those upregulated by cytokine treatment or hypoxic exposure; Figure 4C and Figure S5, Table S3), we identified GO pathways related to oxygen levels in the GSEA. GO:0048762 (mesenchymal cell differentiation) was also identified (Figure 4D). In addition, pathways related to tight junction formation, wound healing, and focal adhesions were enriched. Analysis using the TRRUST database made it abundantly evident that the enriched pathways were controlled by the gene products of the HIF1A, SNAI1, RUNX2, TWIST1, TWIST2, and SP1 genes (Figure 4E). Thus, treatment with cytokines activated signaling pathways similar to those activated by hypoxic exposure. The enriched pathways were regulated by HIFs and EMT-related transcription factors, according to analysis using the TRRUST database.

3.4. Representative Genes of EMT were Induced by Cytokines

Further analysis by GSEA revealed genes encoding transcription factors associated with the EMT, including SNAI1, TWIST1, TWIST2, RUNX2, ZEB1, ZEB2, MMP1, MMP3, and MMP9 (Figure 5A,B). Notably, cytokine stimulation decreased the expression of CDH1 (cadherin-1, E-cadherin) and increased the expression of CDH2 (cadherin-2/N-cadherin), indicating that cytokine stimulation induced a so-called “cadherin switch” (Figure 5C). We attempted to detect this gene expression change at the protein level. However, we were unable to show the cadherin switch at the protein level due to poor detection with several specific antibodies.

3.5. Cytokines Facilitate Morphological Changes in EM-E6/E7/TERT Cells

We examined the effects of cytokine stimulation on cell phenotypes. EM-E6/E7/TERT cells were cultured for 24 h, treated with 500 ng/mL of TNFα and 100 ng/mL of IL-1β, and observed over 72 h. When cultured in the presence of pro-inflammatory cytokines, the cells changed from polygon- to spindle-shaped, became more flattened, and spread extensively. Morphological changes were visible from 24 h after the treatment and progressed gradually until 72 h (Figure 6).

3.6. Cytokines Facilitate Wound Healing

A strong migratory potential is one of the most significant features of the mesenchymal state. We performed a wound-healing assay to examine the effects of pro-inflammatory cytokines and hypoxia on cell migration. Confluent monolayers of EM-E6/E7/TERT cells were scratched to form wounds and cultured under 1% or 20% O2 conditions in the absence or presence of TNFα (500 ng/mL) and IL-1β (100 ng/mL, Figure 7A). Proinflammatory cytokines under hypoxia augmented wound healing, and the effect was significant after 6 h (Figure 7B). In contrast, treatment with pro-inflammatory cytokines or hypoxia alone did not upregulate the migration ability of EM-E6/E7/TERT cells.

3.7. Effect of HIF-1 Suppression by Echinomycin on EMT-Related Genes

We used echinomycin—a small-molecule inhibitor of HIF-1 activity—to determine whether HIF-1 is mediated in the EMT induced by pro-inflammatory cytokines. Treatment with 10 nM of echinomycin inhibited cytokine-induced VEGFA and SLC2A1 expression (Figure 8A). We examined the effect of echinomycin on the mRNA levels of SNAI2, ZEB1, ZEB2, VIM, MMP1, MMP3, and MMP9 with or without the addition of echinomycin in EM-E6/E7/TERT cells and found that the expression levels of SNAI2 and ZEB2 mRNA were significantly increased by the pro-inflammatory cytokine treatment and suppressed by echinomycin. Even in the controls, the echinomycin treatment inhibited SNAI2 and ZEB2 mRNA expression levels. ZEB1 mRNA levels were not increased by pro-inflammatory cytokines but were suppressed by echinomycin (Figure 8B). The mRNA expression of MMP1, MMP3, and MMP9 mRNA was upregulated by the treatment with inflammatory cytokines (Figure 8C).

4. Discussion

We showed that pro-inflammatory factors including TNFα, IL-1β, and LPS in concert with hypoxic environments activate HIF-1 and promote the EMT in endometrial epithelial cells. Although it has been reported for immunocompetent cells and cells of other organs, this is the first report of cytokine-induced HIF-1 activation in endometrial epithelial cells. The human endometrium has a physical and immunological barrier in the form of a glandular epithelial cell layer. The penetration of this glandular epithelial barrier is essential for the embryo to attach to the endometrial stroma during human implantation. The destruction of the epithelial barrier by the embryo must be rapidly repaired to protect the uterus and embryo from infection and avoid implantation failure. The EMT is a phenomenon in which epithelial cells acquire the traits of mesenchymal cells in a coordinated and continuous biological response with a stepwise mechanism. It can be viewed as a combination of essential functions, such as cell adhesion, proliferation, differentiation, and motility. The invasion of embryos into the endometrium is thought to require EMT-associated changes in the endometrial epithelium, a barrier at the time of implantation, and evidence supports the presence of the EMT in the endometrial epithelium [47].
In this study, we demonstrated that inflammatory cytokine stimulation induced HIF-1 activation and the EMT in EM-E6/E7/TERT cells. Hypoxia is common on the surface of the human endometrium; during early human pregnancy, the oxygen concentration at the endometrial surface is 18 mmHg (2.5% O2 conditions) and that within the endometrium is 40 mmHg (about 5% O2 conditions) [48,49]. Furthermore, the endometrial luminal epithelium is distant from any blood vessel and separated from the endometrial stroma by a basement membrane. Matsumoto et al., in a study incorporating transgenic mice, found that HIFs regulate the process of embryonic invasion in the endometrium and HIF-2α promotes the shedding of the luminal epithelium to expose the endometrial stroma, ultimately allowing for the implantation of the embryo in the uterus [50]. Consistent with previous reports, we showed that a decrease in the oxygen partial pressure in endometrial epithelial cells led to the intracellular accumulation of both HIF-1α and HIF-2α proteins. Since its molecular cloning in 1995 [51], the oxygen partial pressure-dependent regulation of HIF has been comprehensively described. However, the partial pressure-independent regulation of HIF activation has also been reported. In cells lacking or mutated in VHL, as is often the case in renal carcinoma, HIF activation is observed even in the absence of hypoxia [52]. Similarly, deletions or mutations in tumor-suppressor genes, such as TP53 and PTEN, may also result in HIF activation [7,31]. Signals from growth factors such as epidermal growth factor (EGF), insulin-like growth factor (IGF)-1, orexin, muscarinic receptors, and nicotinic receptors mediated by acetylcholine and nicotine also result in HIF-1 activation [8,53,54]. In the present study, inflammatory cytokine treatment increased HIF-1α but not HIF-2α mRNA expression in EM-E6/E7/TERT cells; interestingly, hypoxic stimulation did not affect HIF-1α mRNA expression. Several studies have shown that inflammatory cytokines induce HIF-1α mRNA expression by activating NF-κB [55,56]. MAPK and NF-κB may also be involved in a reactive oxygen species (ROS)-dependent manner. The ROS scavenger, NAC, inhibited the induction of HIF-1α protein by cytokines. We found that treatment with LY294002 and SC-514 suppressed cytokine-mediated HIF-1α levels, which is consistent with earlier publications showing that the activation of the PI3K/Akt/mTOR and MAPK pathways increased the rate of HIF-1α mRNA expression and protein synthesis [46,57,58,59]. The induction of HIF-1α protein expression by inflammatory cytokines was blocked by PI3K or MAPK inhibition (Figure 3A). These cytokines induced the phosphorylation of p42/44 MAPK and p38 MAPK, both of which are involved in protein translation. Collectively, our findings indicate that cytokines increase the rate of HIF-1α protein synthesis by increasing HIF-1α mRNA levels and activating the PI3K/Akt and MAPK pathways.
The RNA-Seq analysis followed by GSEA clearly indicate that cytokines’ stimulation activates cytokine and hypoxia-related signaling pathways as well as the pathways related to the EMT. Of the common genes induced by cytokines and hypoxia, genes related to the HIF-1 pathway, the EMT, wound healing, and tight junction assembly were also induced. When common genes were analyzed against the TRRUST database, transcription factors closely related to EMT, such as HIF1A, SNAl1, TWIST2, TWIST1, and SP1, were also enriched. Cytokine stimulation resulted in the elevated expression of EMT markers and the increased activation of EMT-related transcription factors, such as SNAI1 and ZEB1. In addition, the expression of MMP2 and MMP9 and the motility of endometriotic epithelial cells were upregulated. Thus, EMT-related pathways are activated in endometrial epithelial cells exposed to a high-cytokine and low-oxygen-partial-pressure environment. These results clearly illustrated the involvement of the HIF-1 pathway in promoting EMT-associated phenotypic changes in endometrial epithelial cells.
Endometritis is a chronic inflammatory disease, and immune and inflammatory responses play an important role in its pathogenesis, including inflammatory cytokines, chemokines, proteases, prostaglandins, hormone receptors, and angiogenic factors. In the current study, we found that endometrial epithelial cells were activated by hypoxic exposure and the inflammatory cytokine stimulation of HIF. We also showed a synergistic effect between hypoxic exposure and inflammatory cytokine stimulation. Epithelial cell layers are generally formed by homodimers of the intercellular adhesion molecule E-cadherin, which firmly bind to each other. The cell–cell adhesion of mesothelial-like cells, which retain high motility, is also mediated by E-cadherin, but more frequently by N-cadherins. In the EMT, molecules responsible for cell–cell adhesion switch their main roles from E-cadherin to N-cadherin. This cadherin switch also occurred in the present study based on the changes in the expression of the related genes.
We acknowledge some limitations of our study design. Gene expression profiling using RNA-seq followed by qPCR validation indicated the close link between the hypoxic response and tissue remodeling, which remains to be investigated at the protein level. Further studies are required to explore the mechanisms underlying the interaction between the HIF-1 pathway and the EMT of endometrial epithelial cells. A detailed understanding of the temporal and spatial regulation of HIF-1 activity in endometritis will also await the generation of a suitable experimental system. Another limitation is that we used an immortalized cell line instead of primary-cultured cells. Few related studies have used primary-cultured cells since endometrial epithelial cells are difficult to isolate and cannot tolerate long-term culture. Additionally, due to individual variation, results are often inconsistent in studies employing primary-cultured endometrial epithelial cells. Our in vitro study design allows for the quantitative analysis of fundamental cellular processes, such as adhesion and motility, without relying solely on qualitative observations, which represents a significant improvement over in vivo studies, even in human research, which is subject to many ethical and social restrictions. Nevertheless, our findings require validation by in vivo studies.

5. Conclusions

We used comprehensive gene expression analysis to show that EMT-related pathways are activated by inflammatory cytokine stimulation, and the expression of these molecules is renewed in a hypoxic environment dependent on HIF-1 activation (Figure 9). Our results indicate that the intrauterine oxygen environment and inflammatory state establish crosstalk that drives the EMT in a complex manner.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/biomedicines11010210/s1, Figure S1: Immunoblots for HIF-1α, HIF-2α, HIF-1β, and β-actin under hypoxic conditions; Figure S2: Principal component analysis (PCA) for the RNA-Seq results; Figure S3: Results of gene set enrichment analyses upregulated by pro-inflammatory cytokine treatment; Figure S4: Results of gene set enrichment analyses upregulated by exposure to 1% O2; Figure S5: Results of gene set enrichment analyses commonly upregulated by pro-inflammatory cytokine treatment and exposure to 1% O2; Table S1: The expression matrix, calculated as scaled TPM and loaded at gene level by tximport; Table S2: Gene set enrichment analyses for gene lists using Metascape database between cytokines-treatment and control groups; Table S3: Gene set enrichment analyses for gene lists using Metascape database between 1% O2 conditions and control groups.

Author Contributions

Conceptualization, Y.H., H.O. and K.H.; methodology, Y.H., Y.M. and T.M.; investigation, Y.H. and N.K.; data curation, Y.H. and K.H.; funding acquisition, Y.H., T.T.-N., N.K., K.H. and H.O. writing—original draft preparation, Y.H. and K.H.; writing—review and editing, Y.H., T.T.-N., N.K., Y.M., T.M., H.O. and K.H.; project administration, H.O. and K.H. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by research grant D2 from Kansai Medical University (Osaka, Japan) and the Japan Society for the Promotion of Science KAKENHI (grant number JP19K09766 and JP21K09480).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are openly available in the DNA Data Bank of Japan Sequence Read Archive (https://www.ddbj.nig.ac.jp/dra/index-e.html, accessed on 14 July 2022; accession nos. DRR395305–DRR395313).

Conflicts of Interest

The authors declare no conflict of interest.

Appendix A

Table
Table A1. Table of Key Resources.
Table A1. Table of Key Resources.
ReagentsSourceIdentifier
12% Mini-PROTEAN® TGXTM Precast Protein GelsBIO-RAD4561043
30w/v% Albumin Solution, from Bovine Serum (BSA), Fatty Acid FreeFUJIFILM017-22231
7.5% Mini-PROTEAN® TGXTM Precast Protein GelsBIO-RAD4561023
Anti-rabbit IgG, HRP-linked AntibodyCell Signaling TECHNOLOGY7074
Anti-β-Actin antibodySigma-AldrichA5316
Blocking OneNacalai Tesque03953-95
DCTM Protein Assay Reagents PackageBIO-RAD5000116JA
DMEM, low glucose, pyruvateGibco11885-084
N-(2-methoxy-2-oxoacetyl) glycine methyl ester (DMOG)Sigma-AldrichD3695
Dimethyl SulfoxideFUJIFILM043-07216
EchinomycinEnzo Life SciencesALX-380-201
ECLTM anti-mouse IgG HRP Linked Whole AbcytivaNA931
ECLTM Prime Western Blotting Detection ReagentscytivaRPN2232
Fetal Bovine Serum CharacterizedHycloneSH30396
HIF-1β/ARNT (D28F3) XP® rabbit mAbCell Signaling TECHNOLOGY5537
HIF-2 alpha/EPAS1 AntibodyNovus BiologicalsNB100-122
LY294002FUJIFILM1290-4861
Maxwell® RSC simply RNA Cells KitPromegaAS1390
N-Acetyl-L-cysteine, ROS inhibitorabcam143032
p38 MAPK(D13E1) XP® Rabbit mAbCell Signaling TECHNOLOGY8690
p44/42 MAPK(Erk1/2) (137F5) Rabbit mAbCell Signaling TECHNOLOGY4695
PBS, pH 7.4Gibco10010-023
PD98059FUJIFILM169-19211
Penicillin-Streptomycin Mixed Solution (Stabilized)Nacalai Tesque09367-34
Phospho-p38MAPK(Thr180/Tyr182) (D3F9) XP® Rabbit mAbCell Signaling TECHNOLOGY4511
Phospho-p44/42MAPK(Erk1/2) (Thr202/Tyr204) (D13.14.4E) XP® Rabbit mAbCell Signaling TECHNOLOGY4370
Protease inhibitor cocktailCalbiochem539134
Purified Mouse Anti-Human HIF-1αBD Transduction LaboratoriesTM610959
Recombinant Human IL-1βPeproTech200-01B
Recombinant Human TNF-αPeproTech300-01A
ReverTra Ace® qPCR RT Master Mix with gDNA RemoverTOYOBOFSQ-301
RIPA BufferFUJIFILM182-02451
Running Buffer Solution for SDS-PAGENacalai Tesque30329-61
Sample Buffer Solution with Reducing Reagent (6×) for SDS-PAGENacalai Tesque09449-14
SC-514Sigma-AldrichSML0557
THUNDERBIRD® Next SYBR qPCR MixTOYOBOQPX-201
Trans-Blot® Turbo™ Mini PVDF Transfer PacksBIO-RAD1704156
Tris Bufferd Saline with Tween® 20 (TBS-T) Tablets, pH7.6TaKaRaT9142
Trypsin-EDTA (0.25%)Gibco25200-056
Ultrapure LPS, E. coli 0111: B4InvivoGentlrl-3pelps

References

  1. Aberdeen, G.W.; Wiegand, S.J.; Bonagura, T.W.; Pepe, G.J.; Albrecht, E.D. Vascular endothelial growth factor mediates the estrogen-induced breakdown of tight junctions between and increase in proliferation of microvessel endothelial cells in the baboon endometrium. Endocrinology 2008, 149, 6076–6083. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  2. Fan, X.; Krieg, S.; Kuo, C.J.; Wiegand, S.J.; Rabinovitch, M.; Druzin, M.L.; Brenner, R.M.; Giudice, L.C.; Nayak, N.R. VEGF blockade inhibits angiogenesis and reepithelialization of endometrium. FASEB J. 2008, 22, 3571–3580. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  3. Salamonsen, L.A. Tissue injury and repair in the female human reproductive tract. Reproduction 2003, 125, 301–311. [Google Scholar] [CrossRef] [PubMed]
  4. Dong, X.; Wang, Y.S.; Dou, G.R.; Hou, H.Y.; Shi, Y.Y.; Zhang, R.; Ma, K.; Wu, L.; Yao, L.B.; Cai, Y.; et al. Influence of Dll4 via HIF-1α-VEGF signaling on the angiogenesis of choroidal neovascularization under hypoxic conditions. PLoS ONE 2011, 6, e18481. [Google Scholar] [CrossRef] [Green Version]
  5. Tsuzuki, T.; Okada, H.; Cho, H.; Tsuji, S.; Nishigaki, A.; Yasuda, K.; Kanzaki, H. Hypoxic stress simultaneously stimulates vascular endothelial growth factor via hypoxia-inducible factor-1α and inhibits stromal cell-derived factor-1 in human endometrial stromal cells. Hum. Reprod. 2012, 27, 523–530. [Google Scholar] [CrossRef]
  6. Semenza, G.L. HIF-1 and human disease: One highly involved factor. Genes Dev. 2000, 14, 1983–1991. [Google Scholar] [CrossRef] [PubMed]
  7. Ravi, R.; Mookerjee, B.; Bhujwalla, Z.M.; Sutter, C.H.; Artemov, D.; Zeng, Q.; Dillehay, L.E.; Madan, A.; Semenza, G.L.; Bedi, A. Regulation of tumor angiogenesis by p53-induced degradation of hypoxia-inducible factor 1alpha. Genes Dev. 2000, 14, 34–44. [Google Scholar] [CrossRef]
  8. Treins, C.; Giorgetti-Peraldi, S.; Murdaca, J.; Semenza, G.L.; Van Obberghen, E. Insulin stimulates hypoxia-inducible factor 1 through a phosphatidylinositol 3-kinase/target of rapamycin-dependent signaling pathway. J. Biol. Chem. 2002, 277, 27975–27981. [Google Scholar] [CrossRef] [Green Version]
  9. Eltzschig, H.K.; Carmeliet, P. Hypoxia and inflammation. N. Engl. J. Med. 2011, 364, 656–665. [Google Scholar] [CrossRef] [Green Version]
  10. Haddad, J.J.; Land, S.C. A non-hypoxic, ROS-sensitive pathway mediates TNF-alpha-dependent regulation of HIF-1alpha. FEBS Lett. 2001, 505, 269–274. [Google Scholar] [CrossRef] [PubMed]
  11. Blouin, C.C.; Pagé, E.L.; Soucy, G.M.; Richard, D.E. Hypoxic gene activation by lipopolysaccharide in macrophages: Implication of hypoxia-inducible factor 1alpha. Blood 2004, 103, 1124–1130. [Google Scholar] [CrossRef]
  12. Oda, T.; Hirota, K.; Nishi, K.; Takabuchi, S.; Oda, S.; Yamada, H.; Arai, T.; Fukuda, K.; Kita, T.; Adachi, T.; et al. Activation of hypoxia-inducible factor 1 during macrophage differentiation. Am. J. Physiol. Cell Physiol. 2006, 291, C104–C113. [Google Scholar] [CrossRef] [PubMed]
  13. Hellwig-Bürgel, T.; Rutkowski, K.; Metzen, E.; Fandrey, J.; Jelkmann, W. Interleukin-1beta and tumor necrosis factor-alpha stimulate DNA binding of hypoxia-inducible factor-1. Blood 1999, 94, 1561–1567. [Google Scholar] [CrossRef]
  14. Zhou, J.; Schmid, T.; Brüne, B. Tumor necrosis factor-alpha causes accumulation of a ubiquitinated form of hypoxia inducible factor-1alpha through a nuclear factor-kappaB-dependent pathway. Mol. Biol. Cell 2003, 14, 2216–2225. [Google Scholar] [CrossRef] [Green Version]
  15. Tortorella, C.; Piazzolla, G.; Matteo, M.; Pinto, V.; Tinelli, R.; Sabbà, C.; Fanelli, M.; Cicinelli, E. Interleukin-6, interleukin-1β, and tumor necrosis factor α in menstrual effluents as biomarkers of chronic endometritis. Fertil. Steril. 2014, 101, 242–247. [Google Scholar] [CrossRef]
  16. Kimura, F.; Takebayashi, A.; Ishida, M.; Nakamura, A.; Kitazawa, J.; Morimune, A.; Hirata, K.; Takahashi, A.; Tsuji, S.; Takashima, A.; et al. Review: Chronic endometritis and its effect on reproduction. J. Obstet. Gynaecol. Res. 2019, 45, 951–960. [Google Scholar] [CrossRef] [Green Version]
  17. Johnston-MacAnanny, E.B.; Hartnett, J.; Engmann, L.L.; Nulsen, J.C.; Sanders, M.M.; Benadiva, C.A. Chronic endometritis is a frequent finding in women with recurrent implantation failure after in vitro fertilization. Fertil. Steril. 2010, 93, 437–441. [Google Scholar] [CrossRef] [PubMed]
  18. Cicinelli, E.; Resta, L.; Nicoletti, R.; Tartagni, M.; Marinaccio, M.; Bulletti, C.; Colafiglio, G. Detection of chronic endometritis at fluid hysteroscopy. J. Minim. Invasive Gynecol. 2005, 12, 514–518. [Google Scholar] [CrossRef]
  19. Cicinelli, E.; Matteo, M.; Trojano, G.; Mitola, P.C.; Tinelli, R.; Vitagliano, A.; Crupano, F.M.; Lepera, A.; Miragliotta, G.; Resta, L. Chronic endometritis in patients with unexplained infertility: Prevalence and effects of antibiotic treatment on spontaneous conception. Am. J. Reprod. Immunol. 2018, 79, e12782. [Google Scholar] [CrossRef]
  20. Kasius, J.C.; Fatemi, H.M.; Bourgain, C.; Sie-Go, D.M.; Eijkemans, R.J.; Fauser, B.C.; Devroey, P.; Broekmans, F.J. The impact of chronic endometritis on reproductive outcome. Fertil. Steril. 2011, 96, 1451–1456. [Google Scholar] [CrossRef]
  21. Liu, Y.; Chen, X.; Huang, J.; Wang, C.C.; Yu, M.Y.; Laird, S.; Li, T.C. Comparison of the prevalence of chronic endometritis as determined by means of different diagnostic methods in women with and without reproductive failure. Fertil. Steril. 2018, 109, 832–839. [Google Scholar] [CrossRef] [Green Version]
  22. Bartley, J.; Jülicher, A.; Hotz, B.; Mechsner, S.; Hotz, H. Epithelial to mesenchymal transition (EMT) seems to be regulated differently in endometriosis and the endometrium. Arch. Gynecol. Obstet. 2014, 289, 871–881. [Google Scholar] [CrossRef]
  23. Matsuzaki, S.; Darcha, C. Epithelial to mesenchymal transition-like and mesenchymal to epithelial transition-like processes might be involved in the pathogenesis of pelvic endometriosis. Hum. Reprod. 2012, 27, 712–721. [Google Scholar] [CrossRef]
  24. Furuya, M.; Masuda, H.; Hara, K.; Uchida, H.; Sato, K.; Sato, S.; Asada, H.; Maruyama, T.; Yoshimura, Y.; Katabuchi, H.; et al. ZEB1 expression is a potential indicator of invasive endometriosis. Acta Obstet. Gynecol. Scand. 2017, 96, 1128–1135. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  25. Holcomb, K.; Delatorre, R.; Pedemonte, B.; McLeod, C.; Anderson, L.; Chambers, J. E-cadherin expression in endometrioid, papillary serous, and clear cell carcinoma of the endometrium. Obstet. Gynecol. 2002, 100, 1290–1295. [Google Scholar] [CrossRef] [PubMed]
  26. Tanos, P.; Dimitriou, S.; Gullo, G.; Tanos, V. Biomolecular and Genetic Prognostic Factors That Can Facilitate Fertility-Sparing Treatment (FST) Decision Making in Early Stage Endometrial Cancer (ES-EC): A Systematic Review. Int. J. Mol. Sci. 2022, 23, 2653. [Google Scholar] [CrossRef]
  27. Giampaolino, P.; Cafasso, V.; Boccia, D.; Ascione, M.; Mercorio, A.; Viciglione, F.; Palumbo, M.; Serafino, P.; Buonfantino, C.; De Angelis, M.C.; et al. Fertility-Sparing Approach in Patients with Endometrioid Endometrial Cancer Grade 2 Stage IA (FIGO): A Qualitative Systematic Review. Biomed. Res. Int. 2022, 2022, 4070368. [Google Scholar] [CrossRef]
  28. Mutlu, L.; Manavella, D.D.; Gullo, G.; McNamara, B.; Santin, A.D.; Patrizio, P. Endometrial Cancer in Reproductive Age: Fertility-Sparing Approach and Reproductive Outcomes. Cancers 2022, 14, 5187. [Google Scholar] [CrossRef] [PubMed]
  29. Munksgaard, P.S.; Blaakaer, J. The association between endometriosis and ovarian cancer: A review of histological, genetic and molecular alterations. Gynecol. Oncol. 2012, 124, 164–169. [Google Scholar] [CrossRef]
  30. Terzic, M.; Aimagambetova, G.; Kunz, J.; Bapayeva, G.; Aitbayeva, B.; Terzic, S.; Laganà, A.S. Molecular Basis of Endometriosis and Endometrial Cancer: Current Knowledge and Future Perspectives. Int. J. Mol. Sci. 2021, 22, 9274. [Google Scholar] [CrossRef]
  31. Zundel, W.; Schindler, C.; Haas-Kogan, D.; Koong, A.; Kaper, F.; Chen, E.; Gottschalk, A.R.; Ryan, H.E.; Johnson, R.S.; Jefferson, A.B.; et al. Loss of PTEN facilitates HIF-1-mediated gene expression. Genes Dev. 2000, 14, 391–396. [Google Scholar] [CrossRef]
  32. Berg, A.; Fasmer, K.E.; Mauland, K.K.; Ytre-Hauge, S.; Hoivik, E.A.; Husby, J.A.; Tangen, I.L.; Trovik, J.; Halle, M.K.; Woie, K.; et al. Tissue and imaging biomarkers for hypoxia predict poor outcome in endometrial cancer. Oncotarget 2016, 7, 69844–69856. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  33. Xiong, Y.; Liu, Y.; Xiong, W.; Zhang, L.; Liu, H.; Du, Y.; Li, N. Hypoxia-inducible factor 1α-induced epithelial-mesenchymal transition of endometrial epithelial cells may contribute to the development of endometriosis. Hum. Reprod. 2016, 31, 1327–1338. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  34. Zhan, L.; Wang, W.; Zhang, Y.; Song, E.; Fan, Y.; Wei, B. Hypoxia-inducible factor-1alpha: A promising therapeutic target in endometriosis. Biochimie 2016, 123, 130–137. [Google Scholar] [CrossRef]
  35. Kyo, S.; Nakamura, M.; Kiyono, T.; Maida, Y.; Kanaya, T.; Tanaka, M.; Yatabe, N.; Inoue, M. Successful immortalization of endometrial glandular cells with normal structural and functional characteristics. Am. J. Pathol. 2003, 163, 2259–2269. [Google Scholar] [CrossRef] [Green Version]
  36. Yoshida, T.; Okumura, T.; Matsuo, Y.; Okuyama, T.; Michiura, T.; Kaibori, M.; Umezaki, N.; Bono, H.; Hirota, K.; Sekimoto, M. Activation of transcription factor HIF inhibits IL-1β-induced NO production in primary cultured rat hepatocytes. Nitric Oxide 2022, 124, 1–14. [Google Scholar] [CrossRef]
  37. Kida, N.; Matsuo, Y.; Hashimoto, Y.; Nishi, K.; Tsuzuki-Nakao, T.; Bono, H.; Maruyama, T.; Hirota, K.; Okada, H. Cigarette Smoke Extract Activates Hypoxia-Inducible Factors in a Reactive Oxygen Species-Dependent Manner in Stroma Cells from Human Endometrium. Antioxidants 2021, 10, 48. [Google Scholar] [CrossRef]
  38. Hiraoka, Y.; Yamada, K.; Kawasaki, Y.; Hirose, H.; Matsumoto, K.; Ishikawa, K.; Yasumizu, Y. ikra: RNAseq pipeline centered on Salmon. Zendo 2019. [Google Scholar] [CrossRef]
  39. Krueger, F. Trim Galore. Available online: https://www.bioinformatics.babraham.ac.uk/projects/trim_galore/ (accessed on 24 October 2022).
  40. Martin, M. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet J. 2011, 17, 10–12. [Google Scholar] [CrossRef]
  41. Patro, R.; Duggal, G.; Love, M.I.; Irizarry, R.A.; Kingsford, C. Salmon provides fast and bias-aware quantification of transcript expression. Nat. Methods 2017, 14, 417–419. [Google Scholar] [CrossRef]
  42. Ge, S.X.; Son, E.W.; Yao, R. iDEP: An integrated web application for differential expression and pathway analysis of RNA-Seq data. BMC Bioinform. 2018, 19, 534. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  43. Han, H.; Cho, J.W.; Lee, S.; Yun, A.; Kim, H.; Bae, D.; Yang, S.; Kim, C.Y.; Lee, M.; Kim, E.; et al. TRRUST v2: An expanded reference database of human and mouse transcriptional regulatory interactions. Nucleic Acids Res. 2018, 46, D380–D386. [Google Scholar] [CrossRef]
  44. Han, H.; Shim, H.; Shin, D.; Shim, J.E.; Ko, Y.; Shin, J.; Kim, H.; Cho, A.; Kim, E.; Lee, T.; et al. TRRUST: A reference database of human transcriptional regulatory interactions. Sci. Rep. 2015, 5, 11432. [Google Scholar] [CrossRef] [Green Version]
  45. Zhou, Y.; Zhou, B.; Pache, L.; Chang, M.; Khodabakhshi, A.H.; Tanaseichuk, O.; Benner, C.; Chanda, S.K. Metascape provides a biologist-oriented resource for the analysis of systems-level datasets. Nat. Commun. 2019, 10, 1523. [Google Scholar] [CrossRef]
  46. Sodhi, A.; Montaner, S.; Miyazaki, H.; Gutkind, J.S. MAPK and Akt act cooperatively but independently on hypoxia inducible factor-1alpha in rasV12 upregulation of VEGF. Biochem. Biophys. Res. Commun. 2001, 287, 292–300. [Google Scholar] [CrossRef]
  47. Li, Z.; Gou, J.; Jia, J.; Zhao, X. MicroRNA-429 functions as a regulator of epithelial-mesenchymal transition by targeting Pcdh8 during murine embryo implantation. Hum. Reprod. 2015, 30, 507–518. [Google Scholar] [CrossRef] [Green Version]
  48. Gassmann, M.; Fandrey, J.; Bichet, S.; Wartenberg, M.; Marti, H.H.; Bauer, C.; Wenger, R.H.; Acker, H. Oxygen supply and oxygen-dependent gene expression in differentiating embryonic stem cells. Proc. Natl. Acad. Sci. USA 1996, 93, 2867–2872. [Google Scholar] [CrossRef] [Green Version]
  49. Rodesch, F.; Simon, P.; Donner, C.; Jauniaux, E. Oxygen measurements in endometrial and trophoblastic tissues during early pregnancy. Obstet. Gynecol. 1992, 80, 283–285. [Google Scholar]
  50. Matsumoto, L.; Hirota, Y.; Saito-Fujita, T.; Takeda, N.; Tanaka, T.; Hiraoka, T.; Akaeda, S.; Fujita, H.; Shimizu-Hirota, R.; Igaue, S.; et al. HIF2α in the uterine stroma permits embryo invasion and luminal epithelium detachment. J. Clin. Investig. 2018, 128, 3186–3197. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  51. Wang, G.L.; Jiang, B.H.; Rue, E.A.; Semenza, G.L. Hypoxia-inducible factor 1 is a basic-helix-loop-helix-PAS heterodimer regulated by cellular O2 tension. Proc. Natl. Acad. Sci. USA 1995, 92, 5510–5514. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  52. Maxwell, P.H.; Wiesener, M.S.; Chang, G.W.; Clifford, S.C.; Vaux, E.C.; Cockman, M.E.; Wykoff, C.C.; Pugh, C.W.; Maher, E.R.; Ratcliffe, P.J. The tumour suppressor protein VHL targets hypoxia-inducible factors for oxygen-dependent proteolysis. Nature 1999, 399, 271–275. [Google Scholar] [CrossRef] [PubMed]
  53. Fukuda, R.; Kelly, B.; Semenza, G.L. Vascular endothelial growth factor gene expression in colon cancer cells exposed to prostaglandin E2 is mediated by hypoxia-inducible factor 1. Cancer Res. 2003, 63, 2330–2334. [Google Scholar] [PubMed]
  54. Hirota, K.; Fukuda, R.; Takabuchi, S.; Kizaka-Kondoh, S.; Adachi, T.; Fukuda, K.; Semenza, G.L. Induction of hypoxia-inducible factor 1 activity by muscarinic acetylcholine receptor signaling. J. Biol. Chem. 2004, 279, 41521–41528. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  55. Van Uden, P.; Kenneth, N.S.; Rocha, S. Regulation of hypoxia-inducible factor-1alpha by NF-kappaB. Biochem. J. 2008, 412, 477–484. [Google Scholar] [CrossRef] [Green Version]
  56. Görlach, A.; Bonello, S. The cross-talk between NF-kappaB and HIF-1: Further evidence for a significant liaison. Biochem. J. 2008, 412, e17–e19. [Google Scholar] [CrossRef]
  57. Frede, S.; Stockmann, C.; Freitag, P.; Fandrey, J. Bacterial lipopolysaccharide induces HIF-1 activation in human monocytes via p44/42 MAPK and NF-kappaB. Biochem. J. 2006, 396, 517–527. [Google Scholar] [CrossRef]
  58. Di Conza, G.; Trusso Cafarello, S.; Loroch, S.; Mennerich, D.; Deschoemaeker, S.; Di Matteo, M.; Ehling, M.; Gevaert, K.; Prenen, H.; Zahedi, R.P.; et al. The mTOR and PP2A Pathways Regulate PHD2 Phosphorylation to Fine-Tune HIF1α Levels and Colorectal Cancer Cell Survival under Hypoxia. Cell Rep. 2017, 18, 1699–1712. [Google Scholar] [CrossRef]
  59. Zhong, H.; Chiles, K.; Feldser, D.; Laughner, E.; Hanrahan, C.; Georgescu, M.M.; Simons, J.W.; Semenza, G.L. Modulation of hypoxia-inducible factor 1alpha expression by the epidermal growth factor/phosphatidylinositol 3-kinase/PTEN/AKT/FRAP pathway in human prostate cancer cells: Implications for tumor angiogenesis and therapeutics. Cancer Res. 2000, 60, 1541–1545. [Google Scholar]
Biomedicines 11 00210 g001 550
Figure 1. Under non-hypoxic situations, pro-inflammatory substances tend to cause the buildup of HIF-1 protein in endometrial epithelial cells. Immortalized endometrial epithelial cells EM-E6/E7/TERT were incubated with culture media (-), TNFα (500 ng/mL), IL-1β (100 ng/mL), and LPS (500 ng/mL) under 20% O2 conditions for 6 h before protein and total RNA were extracted. (A) Illustrations of immunoblots. Immunoblotting was performed on whole-cell lysates for HIF-1α, HIF-2α, HIF-1β, and β-actin. There were at least three such experiments carried out. (B) Densitometric analysis results that have been β-actin-normalized. (C) After normalizing the results to the total RNA levels of EF-1α, semi-quantitative RT-PCR was used to examine the total RNA for the presence of HIF1A, EPAS1, and ARNT. Data are presented as the mean (n = 3) and standard deviation (SD). * p < 0.05 in comparison to the control group (20% O2 circumstances without cytokine therapy).
Figure 1. Under non-hypoxic situations, pro-inflammatory substances tend to cause the buildup of HIF-1 protein in endometrial epithelial cells. Immortalized endometrial epithelial cells EM-E6/E7/TERT were incubated with culture media (-), TNFα (500 ng/mL), IL-1β (100 ng/mL), and LPS (500 ng/mL) under 20% O2 conditions for 6 h before protein and total RNA were extracted. (A) Illustrations of immunoblots. Immunoblotting was performed on whole-cell lysates for HIF-1α, HIF-2α, HIF-1β, and β-actin. There were at least three such experiments carried out. (B) Densitometric analysis results that have been β-actin-normalized. (C) After normalizing the results to the total RNA levels of EF-1α, semi-quantitative RT-PCR was used to examine the total RNA for the presence of HIF1A, EPAS1, and ARNT. Data are presented as the mean (n = 3) and standard deviation (SD). * p < 0.05 in comparison to the control group (20% O2 circumstances without cytokine therapy).
Biomedicines 11 00210 g001
Biomedicines 11 00210 g002 550
Figure 2. Inflammatory cytokines and hypoxia synergistically increase HIF-1α protein accumulation. (A,B) Representative immunoblots. EM-E6/E7/TERT cells were exposed to culture media (–), TNFα (500 ng/mL), and IL-1β (100 ng/mL) under 20% or 5% O2 conditions for 6 h. Whole-cell lysates were immunoblotted for HIF-1α, HIF-2α, HIF-1β, and β-actin following treatment. There were at least three such experiments carried out. (B) Densitometric analysis results that have been β-actin-normalized. The data are presented as mean SD (n = 3). * p < 0.05 in comparison to the control group (20% O2 circumstances without cytokine therapy).
Figure 2. Inflammatory cytokines and hypoxia synergistically increase HIF-1α protein accumulation. (A,B) Representative immunoblots. EM-E6/E7/TERT cells were exposed to culture media (–), TNFα (500 ng/mL), and IL-1β (100 ng/mL) under 20% or 5% O2 conditions for 6 h. Whole-cell lysates were immunoblotted for HIF-1α, HIF-2α, HIF-1β, and β-actin following treatment. There were at least three such experiments carried out. (B) Densitometric analysis results that have been β-actin-normalized. The data are presented as mean SD (n = 3). * p < 0.05 in comparison to the control group (20% O2 circumstances without cytokine therapy).
Biomedicines 11 00210 g002
Biomedicines 11 00210 g003 550
Figure 3. Involvement of PI3K and MAPK signaling pathways in cytokine-induced HIF-1 activation. (A) EM-E6/E7/TERT cells were exposed to TNFα (500 ng/mL) and IL-1β (100 ng/mL) with or without the indicated kinase inhibitors (25 µmol/L LY, 20 µmol/L PD, and 100 µmol/L SC) or 10 mM N-acetyl-L-cysteine (NAC) for 6 h under 20% O2 conditions, and whole-cell lysates were immunoblotted for HIF-1α and β-actin. LY—LY294002; PD—PD98059; SC—SC-514. (B,C) EM-E6/E7/TERT cells were exposed to culture media (–), TNFα (500 ng/mL), and IL-1β (100 ng/mL) under 20% or 5% O2 conditions for 6 h. After the treatment, whole-cell lysates were immunoblotted for phospho-ERK1/2, ERK1/2 (B), phospho-p38, p38 (C), and β-actin. (A–C) The densitometric analysis’ findings, normalized by -βactin, are displayed as the values above the immunoblots.
Figure 3. Involvement of PI3K and MAPK signaling pathways in cytokine-induced HIF-1 activation. (A) EM-E6/E7/TERT cells were exposed to TNFα (500 ng/mL) and IL-1β (100 ng/mL) with or without the indicated kinase inhibitors (25 µmol/L LY, 20 µmol/L PD, and 100 µmol/L SC) or 10 mM N-acetyl-L-cysteine (NAC) for 6 h under 20% O2 conditions, and whole-cell lysates were immunoblotted for HIF-1α and β-actin. LY—LY294002; PD—PD98059; SC—SC-514. (B,C) EM-E6/E7/TERT cells were exposed to culture media (–), TNFα (500 ng/mL), and IL-1β (100 ng/mL) under 20% or 5% O2 conditions for 6 h. After the treatment, whole-cell lysates were immunoblotted for phospho-ERK1/2, ERK1/2 (B), phospho-p38, p38 (C), and β-actin. (A–C) The densitometric analysis’ findings, normalized by -βactin, are displayed as the values above the immunoblots.
Biomedicines 11 00210 g003
Biomedicines 11 00210 g004 550
Figure 4. Global gene-expression analysis using RNA-Seq and next-generation sequencing (NGS). (A–E) EM-E6/E7/TERT cells were exposed to 1% O2 or pro-inflammatory cytokines (500 ng/mL TNFα and 100 ng/mL IL-1β) under 20% O2 conditions for 8 h, and total RNAs were analyzed by RNA-Seq. (A) Expression of genes regulated by HIF-1 and the expression of HIF1A, EPAS1, and ARNT. (B) GSEA, with the gene sets whose expression ratios were significantly altered under pro-inflammatory cytokine exposure separated according to the gene ontology (GO) term. (C) Genes with significantly altered expression. (D) GSEA, with the gene sets whose expression was commonly upregulated by pro-inflammatory cytokine treatment and hypoxia exposure separated according to GO term. (E) Analysis using the TRRUST database of pathways commonly enriched by pro-inflammatory cytokine treatment and hypoxia exposure.
Figure 4. Global gene-expression analysis using RNA-Seq and next-generation sequencing (NGS). (A–E) EM-E6/E7/TERT cells were exposed to 1% O2 or pro-inflammatory cytokines (500 ng/mL TNFα and 100 ng/mL IL-1β) under 20% O2 conditions for 8 h, and total RNAs were analyzed by RNA-Seq. (A) Expression of genes regulated by HIF-1 and the expression of HIF1A, EPAS1, and ARNT. (B) GSEA, with the gene sets whose expression ratios were significantly altered under pro-inflammatory cytokine exposure separated according to the gene ontology (GO) term. (C) Genes with significantly altered expression. (D) GSEA, with the gene sets whose expression was commonly upregulated by pro-inflammatory cytokine treatment and hypoxia exposure separated according to GO term. (E) Analysis using the TRRUST database of pathways commonly enriched by pro-inflammatory cytokine treatment and hypoxia exposure.
Biomedicines 11 00210 g004
Biomedicines 11 00210 g005 550
Figure 5. Representative genes of EMT induced by cytokines. Genes for transcription factors associated with (A) EMT, (B) MMP, (C) and cadherin, identified using the TRRUST database.
Figure 5. Representative genes of EMT induced by cytokines. Genes for transcription factors associated with (A) EMT, (B) MMP, (C) and cadherin, identified using the TRRUST database.
Biomedicines 11 00210 g005
Biomedicines 11 00210 g006 550
Figure 6. Effects of pro-inflammatory cytokines on cell morphology. EM-E6/E7/TERT cells were cultured with or without TNFα (500 ng/mL) and IL-1β (100 ng/mL) for 72 h. Original magnification ×100.
Figure 6. Effects of pro-inflammatory cytokines on cell morphology. EM-E6/E7/TERT cells were cultured with or without TNFα (500 ng/mL) and IL-1β (100 ng/mL) for 72 h. Original magnification ×100.
Biomedicines 11 00210 g006
Biomedicines 11 00210 g007 550
Figure 7. Cytokines facilitate wound healing. Confluent monolayers of EM-E6/E7/TERT cells were wounded with a uniform scratch, washed to remove cell debris, and cultured for 24 h under 1% or 20% O2 conditions in the absence or presence of TNFα (500 ng/mL) and IL-1β (100 ng/mL). (A) Phase contrast images of cell cultures after 0 h (upper 4 panels), 6 h (middle 4 panels), and 24 h (lower 4 panels) are presented. (B) Measurements of colonized areas. “Percentage wound closure” was defined as: (area at time 0—area at each time/area at time 0) × 100. Data represent the mean ± SD (n = 6). * p < 0.05 compared to the control.
Figure 7. Cytokines facilitate wound healing. Confluent monolayers of EM-E6/E7/TERT cells were wounded with a uniform scratch, washed to remove cell debris, and cultured for 24 h under 1% or 20% O2 conditions in the absence or presence of TNFα (500 ng/mL) and IL-1β (100 ng/mL). (A) Phase contrast images of cell cultures after 0 h (upper 4 panels), 6 h (middle 4 panels), and 24 h (lower 4 panels) are presented. (B) Measurements of colonized areas. “Percentage wound closure” was defined as: (area at time 0—area at each time/area at time 0) × 100. Data represent the mean ± SD (n = 6). * p < 0.05 compared to the control.
Biomedicines 11 00210 g007
Biomedicines 11 00210 g008 550
Figure 8. Effect of HIF-1 suppression by echinomycin on EMT-related genes. (A–C) EM-E6/E7/TERT cells were cultured under 20% O2 conditions for 8 h in medium containing either control or pro-inflammatory cytokines (500 ng/mL TNFα and 100 ng/mL IL-1β) and/or echinomycin (10 nmol/L). Total RNAs were analyzed by semi-quantitative RT-PCR and calculated after normalization to EF-1α total RNA levels. Data represent the mean ± SD (n = 3). * p < 0.05 compared to the control. # p < 0.05 for the indicated comparison.
Figure 8. Effect of HIF-1 suppression by echinomycin on EMT-related genes. (A–C) EM-E6/E7/TERT cells were cultured under 20% O2 conditions for 8 h in medium containing either control or pro-inflammatory cytokines (500 ng/mL TNFα and 100 ng/mL IL-1β) and/or echinomycin (10 nmol/L). Total RNAs were analyzed by semi-quantitative RT-PCR and calculated after normalization to EF-1α total RNA levels. Data represent the mean ± SD (n = 3). * p < 0.05 compared to the control. # p < 0.05 for the indicated comparison.
Biomedicines 11 00210 g008
Biomedicines 11 00210 g009 550
Figure 9. Overall scheme of the effects of pro-inflammatory agents in endometrial epithelial cells. Abbreviations: HIF-1—hypoxia-inducible factor-1; EMT—epithelial–mesenchymal transition.
Figure 9. Overall scheme of the effects of pro-inflammatory agents in endometrial epithelial cells. Abbreviations: HIF-1—hypoxia-inducible factor-1; EMT—epithelial–mesenchymal transition.
Biomedicines 11 00210 g009
Table
Table 1. Primers used for the real-time polymerase chain reaction (PCR).
Table 1. Primers used for the real-time polymerase chain reaction (PCR).
TargetGene SymbolForward Primer 5′–3′Reverse Primer 5′–3′
HIF-1a
HIF-2a
HIF-1b
GLUT1
VEGF
SNAI2
ZEB1
ZEB2
MMP1
MMP3
MMP9
Vimentin
EF1α		HIF-1A
EPAS1
ARNT
SLC2A1
VEGFA
SNAI2
ZEB1
ZEB2
MMP1
MMP3
MMP9
VIM
EEF1A1		ACACACAGAAATGGCCTTGTGA
ATGGGACTTACACAGGTGGAG
TGTTGGCTACCAGCCACAGGAACT
TCCACGAGCATCTTCGAGA
CGAAACCATGAACTTTCTGC
TGTGACAAGGAATATGTGAGCC
TTACACCTTTGCATACAGAACCC
CAAGAGGCGCAAACAAGCC
ACAAACCCCAAAAGCGTGTG
TTCGTTTTCTCCTGCCTGTG
ATGCCTGCAACGTGAACATC
GACGCCATCAACACCGAGTT
TCTGGTTGGAATGGTGACAACATGC		CCTGTGCAGTGCAATACCTTC
GCTCTGTGGACATGTCTTTGC
ACCGGAACCGGAACATGACAGA
ATACTGGAAGCACATGCCC
CCTCAGTGGGCACACACTCC
TGAGCCCTCAGATTTGACCTG
TTTACGATTACACCCAGACTGC
GGTTGGCAATACCGTCATCC
AGAAGGGATTTGTGCGCATG
AGCAGCAGCCCATTTGAATG
AGAATCGCCAGTACTTCCCATC
CTTTGTCGTTGGTTAGCTGGT
AGAGCTTCACTCAAAGCTTCATGG
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Hashimoto, Y.; Tsuzuki-Nakao, T.; Kida, N.; Matsuo, Y.; Maruyama, T.; Okada, H.; Hirota, K. Inflammatory Cytokine-Induced HIF-1 Activation Promotes Epithelial–Mesenchymal Transition in Endometrial Epithelial Cells. Biomedicines 2023, 11, 210. https://doi.org/10.3390/biomedicines11010210

AMA Style

Hashimoto Y, Tsuzuki-Nakao T, Kida N, Matsuo Y, Maruyama T, Okada H, Hirota K. Inflammatory Cytokine-Induced HIF-1 Activation Promotes Epithelial–Mesenchymal Transition in Endometrial Epithelial Cells. Biomedicines. 2023; 11(1):210. https://doi.org/10.3390/biomedicines11010210

Chicago/Turabian Style

Hashimoto, Yoshiko, Tomoko Tsuzuki-Nakao, Naoko Kida, Yoshiyuki Matsuo, Tetsuo Maruyama, Hidetaka Okada, and Kiichi Hirota. 2023. "Inflammatory Cytokine-Induced HIF-1 Activation Promotes Epithelial–Mesenchymal Transition in Endometrial Epithelial Cells" Biomedicines 11, no. 1: 210. https://doi.org/10.3390/biomedicines11010210

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop