Stress Hormone Corticosterone Controls Metabolic Mitochondrial Performance and Inflammatory Signaling of In Vitro Cultured Sertoli Cells
Abstract
:1. Introduction
2. Materials and Methods
2.1. Chemicals
2.2. Sertoli Cell Line
2.3. Experimental Groups and Sample Collection
2.4. Evaluation of Cellular Metabolic Performance by Proton Nuclear Magnetic Resonance Spectroscopy
2.5. Oxygen Consumption Rate Measurements in Intact Cells
2.6. Mitochondrial Membrane Potential (ΔΨm) Assay in Intact Cells
2.7. Isolation of Mitochondria
2.8. Mitochondrial Complexes I and II Activities
2.9. Quantitation of Glutathione’s Levels
2.10. Total Protein Extraction
2.11. Evaluation of Mitochondrial Complexes and Lactate Dehydrogenase Protein Levels
2.12. Reverse Transcriptase Polymerase Chain Reaction (RT-PCR)
2.13. Evaluation of mRNA Transcripts Levels of Glucocorticoid Receptor, Androgen Receptor and Interleukin-6 by Quantitative PCR (qPCR)
2.14. Statistical Analysis
3. Results
3.1. Corticosterone Did Not Cause an Alteration on Androgen Receptor and Glucocorticoids Receptor Transcript Levels in Sertoli Cells
3.2. Corticosterone Impacted the Metabolic Profiling of Sertoli Cells
3.3. Corticosterone Modulated Mitochondrial Complex II Activity in TM4 Sertoli Cells
3.4. Corticosterone Had No Impact on Redox Status of Sertoli Cells
3.5. Corticosterone Had a Strong Impact on Interleukin-6 Transcript Levels in Sertoli Cells
4. Discussion
5. Conclusions
Author Contributions
Funding
Ethical Approval
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Whirledge, S.; Cidlowski, J.A. Glucocorticoids, stress, and fertility. Minerva Endocrinol. 2010, 35, 109–125. [Google Scholar] [PubMed]
- Kosenow, W. Facial expression in Down syndrome in the newborn and premature infant. Kinderkrankenschwester 1991, 10, 126–127. [Google Scholar] [PubMed]
- Reeder, D.M.; Kramer, K.M. Stress in Free-Ranging Mammals: Integrating Physiology, Ecology, and Natural History. J. Mammal. 2005, 86, 225–235. [Google Scholar] [CrossRef]
- Collu, R.; Gibb, W.; Ducharme, J.R. Effects of stress on the gonadal function. J. Endocrinol. Investig. 1984, 7, 529–537. [Google Scholar] [CrossRef]
- Mruk, D.D.; Cheng, Y.C. Sertoli-Sertoli and Sertoli-germ cell interactions and their significance in germ cell movement in the seminiferous epithelium during spermatogenesis. Endocr. Rev. 2004, 25, 747–806. [Google Scholar] [CrossRef]
- Hazra, R.; Upton, D.; Jimenez, M.; Desai, R.; Handelsman, D.J.; Allan, C.M. In vivo actions of the Sertoli cell glucocorticoid receptor. Endocrinology 2014, 155, 1120–1130. [Google Scholar] [CrossRef]
- Rato, L.; Alves, M.G.; Socorro, S.; Carvalho, R.A.; Cavaco, J.E.; Oliveira, P.F. Metabolic Modulation Induced by Estradiol and DHT in Immature Rat Sertoli Cells cultured In Vitro. Biosci. Rep. 2012, 32, 61–69. [Google Scholar] [CrossRef]
- Oliveira, P.F.; Martins, A.D.; Moreira, A.C.; Cheng, C.Y.; Alves, M.G. The Warburg Effect Revisited—Lesson from the Sertoli Cell. Med. Res. Rev. 2015, 35, 126–151. [Google Scholar] [CrossRef]
- Jegou, B.; Cudicini, C.; Gomez, E.; Stephan, J. Interleukin-1, interleukin-6 and the germ cell-Sertoli cell cross-talk. Reprod. Fertil. Dev. 1995, 7, 723–730. [Google Scholar] [CrossRef]
- Hakovirta, H.; Syed, V.; Jégou, B.; Parvinen, M. Function of interleukin-6 as an inhibitor of meiotic DNA synthesis in the rat seminiferous epithelium. Mol. Cell. Endocrinol. 1995, 108, 193–198. [Google Scholar] [CrossRef]
- Zhang, H.; Yin, Y.; Wang, G.; Liu, Z.; Liu, L.; Sun, F. Interleukin-6 disrupts blood-testis barrier through inhibiting protein degradation or activating phosphorylated ERK in Sertoli cells. Sci. Rep. 2014, 3, 4260. [Google Scholar] [CrossRef] [PubMed]
- Feidantsis, K.; Georgoulis, I.; Zachariou, A.; Campaz, B.; Christoforou, M.; Pörtner, H.O.; Michaelidis, B. Energetic, antioxidant, inflammatory and cell death responses in the red muscle of thermally stressed Sparus aurata. J. Comp. Physiol. 2020, 190, 403–418. [Google Scholar] [CrossRef] [PubMed]
- Shanks, N.; Griffiths, J.; Zalcman, S.; Zacharko, R.M.; Anisman, H. Mouse strain differences in plasma corticosterone following uncontrollable footshock. Pharmacol. Biochem. Behav. 1990, 36, 515–519. [Google Scholar] [CrossRef]
- Kim, D.H.; Jung, J.S.; Suh, H.W.; Huh, S.O.; Min, S.-K.; Son, B.K.; Park, J.H.; Kim, N.D.; Kim, Y.H.; Song, D.K. Inhibition of stress-induced plasma corticosterone levels by ginsenosides in mice: Involvement of nitric oxide. Neuroreport 1998, 9, 2261–2264. [Google Scholar] [CrossRef] [PubMed]
- Wade, M.R.; Degroot, A.; Nomikos, G.G. Cannabinoid CB1 receptor antagonism modulates plasma corticosterone in rodents. Eur. J. Pharmacol. 2006, 551, 162–167. [Google Scholar] [CrossRef]
- Matfier, J.P. Establishment and characterization of two distinct mouse testicular epithelial cell line. Biol. Reprod. 1980, 23, 243–252. [Google Scholar] [CrossRef]
- Moreira, B.P.; Silva, A.M.; Martins, A.D.; Monteiro, M.P.; Sousa, M.; Oliveira, P.F.; Alves, M.G. Effect of Leptin in Human Sertoli Cells Mitochondrial Physiology. Reprod. Sci. 2021, 28, 920–931. [Google Scholar] [CrossRef]
- Silva, A.M.; Oliveira, P.J. Evaluation of respiration with clark type electrode in isolated mitochondria and permeabilized animal cells. In Mitochondrial Bioenergetics; Springer: Berlin/Heidelberg, Germany, 2012; pp. 7–24. [Google Scholar] [CrossRef]
- Monteiro-Cardoso, V.F.; Silva, A.M.; Oliveira, M.M.; Peixoto, F.; Videira, R.A. Membrane lipid profile alterations are associated with the metabolic adaptation of the Caco-2 cells to aglycemic nutritional condition. J. Bioenerg. Biomembr. 2014, 46, 45–57. [Google Scholar] [CrossRef]
- Crisóstomo, L.; Videira, R.A.; Jarak, I.; Starčević, K.; Mašek, T.; Rato, L.; Raposo, J.F.; Batterham, R.L.; Oliveira, P.F.; Alves, M.G. Diet during early life defines testicular lipid content and sperm quality in adulthood. Am. J. Physiol.-Endocrinol. Metab. 2020, 319, E1061–E1073. [Google Scholar] [CrossRef]
- Mendes, D.; Oliveira, M.M.; Moreira, P.I.; Coutinho, J.; Nunes, F.M.; Pereira, D.M.; Valentão, P.; Andrade, P.B.; Videira, R.A. Beneficial effects of white wine polyphenols-enriched diet on Alzheimer’s disease-like pathology. J. Nutr. Biochem. 2018, 55, 165–177. [Google Scholar] [CrossRef]
- Zhang, J.; Nuebel, E.; Wisidagama, D.R.; Setoguchi, K.; Hong, J.S.; Van Horn, C.M.; Imam, S.S.; Vergnes, L.; Malone, C.S.; Koehler, C.M. Measuring energy metabolism in cultured cells, including human pluripotent stem cells and differentiated cells. Nat. Protoc. 2012, 7, 1068–1085. [Google Scholar] [CrossRef] [PubMed]
- Luz, A.L.; Smith, L.L.; Rooney, J.P.; Meyer, J.N. Seahorse Xfe24 extracellular flux analyzer-based analysis of cellular respiration in Caenorhabditis elegans. Curr. Protoc. Toxicol. 2015, 66, 15–21. [Google Scholar] [CrossRef]
- Gravance, C.; Garner, D.; Baumber, J.; Ball, B. Assessment of equine sperm mitochondrial function using JC-1. Theriogenology 2000, 53, 1691–1703. [Google Scholar] [CrossRef]
- Sivandzade, F.; Bhalerao, A.; Cucullo, L. Analysis of the mitochondrial membrane potential using the cationic JC-1 dye as a sensitive fluorescent probe. Bio-Protocol 2019, 9, 3128. [Google Scholar] [CrossRef] [PubMed]
- Jewess, P.; Devonshire, A. Kinetic microplate-based assays for inhibitors of mitochondrial NADH: Ubiquinone oxidoreductase (complex I) and succinate: Cytochrome c oxidoreductase. Anal. Biochem. 1999, 272, 56–63. [Google Scholar] [CrossRef]
- Martins, A.; Sá, R.; Monteiro, M.; Barros, A.; Sousa, M.; Carvalho, R.; Silva, B.; Oliveira, P.; Alves, M. Ghrelin acts as energy status sensor of male reproduction by modulating Sertoli cells glycolytic metabolism and mitochondrial bioenergetics. Mol. Cell. Endocrinol. 2016, 434, 199–209. [Google Scholar] [CrossRef]
- Ye, J.; Coulouris, G.; Zaretskaya, I.; Cutcutache, I.; Rozen, S.; Madden, T.L. Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction. BMC Bioinform. 2012, 13, 134. [Google Scholar] [CrossRef]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29, 45. [Google Scholar] [CrossRef]
- Joëls, M.; Karst, H.; Sarabdjitsingh, R. The stressed brain of humans and rodents. Acta Physiol. 2018, 223, e13066. [Google Scholar] [CrossRef]
- Leenaars, C.H.; van der Mierden, S.; Durst, M.; Goerlich-Jansson, V.C.; Ripoli, F.L.; Keubler, L.M.; Talbot, S.R.; Boyle, E.; Habedank, A.; Jirkof, P. Measurement of corticosterone in mice: A protocol for a mapping review. Lab. Anim. 2020, 54, 26–32. [Google Scholar] [CrossRef]
- Ren, L.; Zhang, Y.; Xin, Y.; Chen, G.; Sun, X.; Chen, Y.; He, B. Dysfunction in Sertoli cells participates in glucocorticoid-induced impairment of spermatogenesis. Mol. Reprod. Dev. 2021, 88, 405–415. [Google Scholar] [CrossRef] [PubMed]
- Alves, M.G.; Rato, L.; Carvalho, R.A.; Moreira, P.I.; Socorro, S.; Oliveira, P.F. Hormonal control of Sertoli cell metabolism regulates spermatogenesis. Cell. Mol. Life Sci. 2013, 70, 777–793. [Google Scholar] [CrossRef] [PubMed]
- Reis, M.M.; Moreira, A.C.; Sousa, M.; Mathur, P.P.; Oliveira, P.F.; Alves, M.G. Sertoli cell as a model in male reproductive toxicology: Advantages and disadvantages. J. Appl. Toxicol. 2015, 35, 870–883. [Google Scholar] [CrossRef]
- Sathiyaa, R.; Vijayan, M.M. Autoregulation of glucocorticoid receptor by cortisol in rainbow trout hepatocytes. Am. J. Physiol.-Cell Physiol. 2003, 284, C1508–C1515. [Google Scholar] [CrossRef] [PubMed]
- Denton, R.; Eisen, L.P.; Elsasser, M.S.; Harmon, J.M. Differential autoregulation of glucocorticoid receptor expression in human T-and B-cell lines. Endocrinology 1993, 133, 248–256. [Google Scholar] [CrossRef]
- Rato, L.; Alves, M.G.; Socorro, S.; Duarte, A.I.; Cavaco, J.E.; Oliveira, P.F. Metabolic regulation is important for spermatogenesis. Nat. Rev. Urol. 2012, 9, 330–338. [Google Scholar] [CrossRef] [PubMed]
- Ribeiro, J.C.; Martins, A.D.; Jarak, I.; Carvalho, R.A.; Alves, M.G.; Oliveira, P.F. Exenatide and Dapagliflozin Combination Enhances Sertoli Cell Secretion of Key Metabolites for Spermatogenesis. Biomedicines 2022, 10, 1115. [Google Scholar] [CrossRef] [PubMed]
- Martins, A.D.; Monteiro, M.P.; Silva, B.M.; Barros, A.; Sousa, M.; Carvalho, R.A.; Oliveira, P.F.; Alves, M.G. Metabolic dynamics of human Sertoli cells are differentially modulated by physiological and pharmacological concentrations of GLP-1. Toxicol. Appl. Pharmacol. 2019, 362, 1–8. [Google Scholar] [CrossRef]
- Kuo, T.; McQueen, A.; Chen, T.-C.; Wang, J.-C. Regulation of glucose homeostasis by glucocorticoids. In Glucocorticoid Signaling; Springer: Berlin/Heidelberg, Germany, 2015; pp. 99–126. [Google Scholar] [CrossRef]
- Williamson, D.; Lund, P.; Krebs, H. The redox state of free nicotinamide-adenine dinucleotide in the cytoplasm and mitochondria of rat liver. Biochem. J. 1967, 103, 514–527. [Google Scholar] [CrossRef]
- Kailavasan, M.; Rehman, I.; Reynolds, S.; Bucur, A.; Tozer, G.; Paley, M. NMR-based evaluation of the metabolic profile and response to dichloroacetate of human prostate cancer cells. NMR Biomed. 2014, 27, 610–616. [Google Scholar] [CrossRef]
- Voituron, Y.; Josserand, R.; Le Galliard, J.-F.; Haussy, C.; Roussel, D.; Romestaing, C.; Meylan, S. Chronic stress, energy transduction, and free-radical production in a reptile. Oecologia 2017, 185, 195–203. [Google Scholar] [CrossRef] [PubMed]
- Aquilano, K.; Baldelli, S.; Ciriolo, M.R. Glutathione: New roles in redox signaling for an old antioxidant. Front. Pharmacol. 2014, 5, 196. [Google Scholar] [CrossRef]
- Syed, V.; Gérard, N.; Kaipia, A.; Bardin, C.W.; Parvinen, M.; Jégou, B. Identification, ontogeny, and regulation of an interleukin-6-like factor in the rat seminiferous tubule. Endocrinology 1993, 132, 293–299. [Google Scholar] [CrossRef] [PubMed]
- Cudicini, C.; Lejeune, H.; Gomez, E.; Bosmans, E.n.; Ballet, F.o.; Saez, J.; Jégou, B. Human Leydig cells and Sertoli cells are producers of interleukins-1 and-6. J. Clin. Endocrinol. Metab. 1997, 82, 1426–1433. [Google Scholar] [CrossRef] [PubMed]
- Siervo, G.E.; Ogo, F.M.; Staurengo-Ferrari, L.; Anselmo-Franci, J.A.; Cunha, F.Q.; Cecchini, R.; Guarnier, F.A.; Verri Jr, W.A.; Fernandes, G.S. Sleep restriction during peripuberty unbalances sexual hormones and testicular cytokines in rats. Biol. Reprod. 2019, 100, 112–122. [Google Scholar] [CrossRef] [PubMed]
- Johnson, M. Fetal Bovine Serum. Mater. Methods 2012, 2, 117. [Google Scholar] [CrossRef]
Target (Accession Number) | Sequence (5′-3′) | AT (°C) | Number of Cycles | Specie of Origin |
---|---|---|---|---|
Ar (NM_013476.4) | FWD: GCTCACCAAGCTCCTGGATT | 60 | 40 | Mus musculus |
RVS: TCAGGAAAGTCCACGCTCAC | ||||
B2m (NM_009735.3) | FWD: ACGTAACACAGTTCCACCCG | 58 | 35 | Mus musculus |
RVS: TCTCGATCCCAGTAGACGGT | ||||
Il-6v1 (NM_031168.2) | FWD: TGAGAAAAGAGTTGTGCAATGG | 60 | 40 | Mus musculus |
RVS: GGAGAGCATTGGAAATTGGGG | ||||
Nr3c1 (NM_008173.4) | FWD: GTGGAAGGACAGCACAATTACC | 60 | 40 | Mus musculus |
RVS: GAGACTCCTGCAGTGGCTTG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Silva, A.M.; Ribeiro, C.T.; Bernardino, R.L.; Jarak, I.; Carvalho, R.A.; Pereira-Sampaio, M.A.; de Souza, D.B.; Alves, M.G.; Oliveira, P.F. Stress Hormone Corticosterone Controls Metabolic Mitochondrial Performance and Inflammatory Signaling of In Vitro Cultured Sertoli Cells. Biomedicines 2022, 10, 2331. https://doi.org/10.3390/biomedicines10092331
Silva AM, Ribeiro CT, Bernardino RL, Jarak I, Carvalho RA, Pereira-Sampaio MA, de Souza DB, Alves MG, Oliveira PF. Stress Hormone Corticosterone Controls Metabolic Mitochondrial Performance and Inflammatory Signaling of In Vitro Cultured Sertoli Cells. Biomedicines. 2022; 10(9):2331. https://doi.org/10.3390/biomedicines10092331
Chicago/Turabian StyleSilva, Ana M., Carina T. Ribeiro, Raquel L. Bernardino, Ivana Jarak, Rui A. Carvalho, M. A. Pereira-Sampaio, Diogo B. de Souza, Marco G. Alves, and Pedro F. Oliveira. 2022. "Stress Hormone Corticosterone Controls Metabolic Mitochondrial Performance and Inflammatory Signaling of In Vitro Cultured Sertoli Cells" Biomedicines 10, no. 9: 2331. https://doi.org/10.3390/biomedicines10092331
APA StyleSilva, A. M., Ribeiro, C. T., Bernardino, R. L., Jarak, I., Carvalho, R. A., Pereira-Sampaio, M. A., de Souza, D. B., Alves, M. G., & Oliveira, P. F. (2022). Stress Hormone Corticosterone Controls Metabolic Mitochondrial Performance and Inflammatory Signaling of In Vitro Cultured Sertoli Cells. Biomedicines, 10(9), 2331. https://doi.org/10.3390/biomedicines10092331