Next Article in Journal
Long-Term Repeatable In Vivo Monitoring of Amyloid-β Plaques and Vessels in Alzheimer’s Disease Mouse Model with Combined TPEF/CARS Microscopy
Next Article in Special Issue
Effect of Oral Exercise on Trismus after Oral Cancer Radiotherapy: A Quasi-Experimental Study
Previous Article in Journal
Alteration of Gut Immunity and Microbiome in Mixed Granulocytic Asthma
Previous Article in Special Issue
Chromosome Translocations, Gene Fusions, and Their Molecular Consequences in Pleomorphic Salivary Gland Adenomas
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

PTC124 Rescues Nonsense Mutation of Two Tumor Suppressor Genes NOTCH1 and FAT1 to Repress HNSCC Cell Proliferation

1
School of Medicine, I-Shou University, No.8, Yida Rd., Jiaosu Village Yanchao District, Kaohsiung City 82445, Taiwan
2
Department of Medical Laboratory Science, I-Shou University, No.8, Yida Rd., Jiaosu Village Yanchao District, Kaohsiung City 82445, Taiwan
3
Department of Pathology, E-Da Hospital, No.1, Yida Rd., Jiaosu Village Yanchao District, Kaohsiung City 82445, Taiwan
4
College of Medicine, I-Shou University, No.8, Yida Rd., Jiaosu Village Yanchao District, Kaohsiung City 82445, Taiwan
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Biomedicines 2022, 10(11), 2948; https://doi.org/10.3390/biomedicines10112948
Submission received: 8 October 2022 / Revised: 12 November 2022 / Accepted: 13 November 2022 / Published: 16 November 2022
(This article belongs to the Special Issue Head and Neck Tumors 2.0)

Abstract

(1) Background: PTC124 (Ataluren) is an investigational drug for the treatment of nonsense mutation-mediated genetic diseases. With the exception of the TP53 tumor suppressor gene, there has been little research on cancers with nonsense mutation. By conducting a database search, we found that another two tumor suppressor genes, NOTCH1 and FAT1, have a high nonsense mutation rate in head and neck squamous cell carcinoma (HNSCC). PTC124 may re-express the functional NOTCH1 or FAT1 in nonsense mutation NOTCH1 or FAT1 in HSNCC (2) Methods: DOK (with NOTCH1 Y550X) or HO-1-u-1 (with FAT1 E378X) HNSCC cells were treated with PTC124, and the NOTCH1 or FAT1 expression, cell viability, and NOTCH1- or FAT1-related downstream gene profiles were assayed. (3) Results: PTC124 was able to induce NOTCH1 or FAT1 expression in DOK and HO-1-u-1 cells. PTC124 was able to upregulate NOTCH downstream genes HES5, AJUBA, and ADAM10 in DOK cells. PTC124 enhanced DDIT4, which is under the control of the FAT1–YAP1 pathway, in HO-1-u-1 cells. FLI-06 (a NOTCH signaling inhibitor) reversed PTC124-mediated cell growth inhibition in DOK cells. PTC124 could reverse TT-10 (a YAP signaling activator)-mediated HO-1-u-1 cell proliferation. (4) Conclusions: PTC124 can rescue nonsense mutation of NOTCH1 and FAT1 to repress HNSCC cell proliferation.

1. Introduction

Nonsense mutation is a point mutation within the coding region that introduces a pre-stop codon (TGA or TAG or TAA) that produces truncated proteins. Nonsense mutation(s) can produce premature termination codons (PTCs), which lead to nonsense-mediated mRNA decay (NMD) with almost no expression of full-length proteins and fairly rare expression of truncated proteins [1]. Aminoglycoside drugs, such as G418 and gentamicin, cannot only act as antibiotics to target the bacterial ribosome but can also inhibit NMD and promote PTC readthrough to rescue full-length proteins [2,3]. However, these aminoglycoside drugs have high toxicity, which limits their clinical use for nonsense mutation-mediated diseases [4]. Furthermore, aminoglycosides may generate free radicals that damage sensory cells and neurons within the inner ear and cause permanent hearing loss [5]. One non-aminoglycoside drug, PTC124 (Ataluren), has also been found to increase the readthrough ability of PTC without the ability to inhibit NMD [6]. PTC124 has low toxicity compared to gentamicin [7] and is also well-tolerated by patients [8,9,10]. PTC124 has been used in clinical phase II and III trials to treat genetic diseases characterized by specific nonsense mutations such as cystic fibrosis and Duchenne muscular dystrophy [11,12,13,14]. PTC124 has received conditional approval by the European Medicines Agency as an orally administered drug for the treatment of nonsense mutation-mediated Duchenne muscular dystrophy [15]; however, the United States Food and Drug Administration (FDA) has still not approved the drug for the treatment of this disease. PTC124 has been used in clinical phase I and II trials to treat metastatic deficient mismatch repair (dMMR) and mismatch repair proficient (pMMR) colorectal carcinoma or metastatic dMMR endometrial carcinoma to promote translation of additional out-of-frame code to enhance the effect of Pembrolizumab anti-PD1 therapy [16]. So, PTC124 should also have high value for clinical application for other cancer treatments of nonsense-mediated cancer formation.
TP53 is a well-known tumor suppressor gene with a high mutation rate in cancers [17,18,19]. TP53 has a 10.71% nonsense mutation rate among all the cancer mutation samples in the COSMIC database [20,21]. On the other hand, TP53 has a 11.4% nonsense mutation rate in head and neck squamous cell carcinoma (HNSCC) mutation samples in the COSMIC database (Figure 1A) [21]. PTC124 is able to promote readthrough of nonsense mutations in TP53 to produce functional full-length p53 [22]. In this study, we conducted a database search and found that two other tumor suppressor genes, NOTCH1 and FAT1, have a high nonsense mutation rate (NOTCH1: 19.62% and FAT1: 40.11%) in HNSCC mutation samples in the COSMIC database compared to other cancers (Figure 1B,C) [21]. Compared to p53, which only has 393 amino acid residues with a molecular weight of 53 kDa [23], NOTCH1 and FAT1 have 2555 and 4588 amino acid residues with molecular weights of 273 and 506 kDa, respectively [24,25].
NOTCH1 and FAT1 are both transmembrane proteins. The NOTCH1 ligands are Delta-like-1 and Jagged-1 [26]. Ligand binding can lead NOTCH1 to cleave and release the Notch intracellular domain (NICD) [27]. NICD can translocate to the nucleus and associate with CSL, MAML, and SKIP protein complex to active HES family and NOTCH target genes [27]. On the other head, dachsous (ds) is known to function as an FAT1 ligand in Drosophila [28], but no FAT1 ligand had been identified in mammals [25,28]. FAT1 was shown to regulate Hippo kinase components as a scaffold for Hippo kinases to enhance their kinase activation [29]. Loss of FAT1 leads to dismantling of the Hippo core complex and YAP dephosphorylation, causing YAP translocation to the nucleus [29]. High expression of NOTCH1 correlated with better overall and disease-free survival in HNSCC patients [30]. Young-onset head and neck cancer patients with FAT1 germline variants had a shorter overall survival [31]; therefore, restoration of the functional NOTCH1 or FAT1 expression in nonsense mutation NOTCH1 or FAT1 in HSNCC is a key issue in anticancer therapy. In this study, we treated two HNSCC cell lines with nonsense mutations of NOTCH1 and FAT1 with PTC124 and measured the change in the cell proliferation of these two tumor suppressor genes.

2. Materials and Methods

2.1. Cell Culture and Drug Treatment

The HNSCC cell lines SAS, DOK, and HO-1-u-1 were maintained at 37 °C in 5% CO2 in DMEM (for SAS and DOK) with 5 µg/mL hydrocortisone or DMEM/F12 (for HO-1-u-1) (Invitrogen, Carlsbad, CA, USA), supplemented with 10% FBS (Invitrogen), 100 U/mL penicillin, and 100 μg/mL streptomycin (both from Invitrogen). HNSCC cells were treated for 48 h with mock (DMSO only), 50 μM PTC124 (MedChemExpress, Monmouth Junction, NJ, USA), 10 μM FLI-06 (MedChemExpress, Monmouth Junction, NJ, USA), or 10 μM TT-10 (AOBIOUS, Gloucester, MA, USA).

2.2. Immunocytochemistry

The culture medium was first removed from each well and then washed twice with 1X PBS. Formaldehyde fixative solution (100 μL; 4% paraformaldehyde in 1X PBS) was added to each well and incubated for 20 min. Wash buffer (100 μL; 1% BSA in 1X PBS) was used to wash each well twice. Blocking buffer (100 μL; 1% BSA, 0.2% Triton X-100 in 1X PBS) was added and then the mixture was incubated for 30 min. After the blocking buffer was removed, the primary antibody p53 (1 μL; Santa Cruz; DO-7 sc-47698), NOTCH1 (1 μL; Elabscience; E-AB-12815) or FAT1 (1 μL; Elabscience; E-AB-13237) (1:100) was prepared in 100 µL blocking buffer to stain cells for 120 min. After staining, each well was washed three times with 100 µL wash buffer. Hoechst 33,342 stock solution (1 mg/mL) and secondary antibody PE-conjugated mouse IgG or PE-conjugated rabbit IgG (0.5 µL; 1:200) were added to 100 µL blocking buffer to stain each well for 30 min in the dark. The wells were washed three times with 100 µL wash buffer. Finally, the images were visualized and captured using an inverted fluorescence microscope (ECLIPSE. Ts2; Nikon, Tokyo, Japan). The Mean Gray Value was used to quantify the fluorescence intensity using ImageJ [32].

2.3. Real-Time RT-PCR

Total cellular RNA was extracted with TRIzol reagent (Invitrogen). Total RNA (1 μg) was converted to first-strand cDNA using the QuantiNova Reverse Transcription Kit (QIAGEN, Hilden, Germany). cDNA samples were mixed with 5X HOT FIREPol EvaGreen qPCR Mix Plus (Omics Bio, New Taipei City, Taiwan) and primers. The amplification of each qPCR reaction was monitored by the QuantStudio 3 Real-Time PCR System (Applied Biosystems). The relative expression of the transcript levels was calculated as 2−ΔΔCT. Each pair of forward (F) and reverse (R) primers was as follows: HES5, F: AAGCACAGCAAAGCCTTCGT and R: CTGCAGGCACCACGAGTAG; AJUBA, F: CGTTGCAAGGCTTTCTACAGT and R: ACAATGCATCGGAAACAGCC; ADAM10, F: ACGGAACACGAGAAGCTGTG and R: CGGAGAAGTCTGTGGTCTGG; DDIT4, F: TACCTGGATGGGGTGTCGTT and R: ACCAACTGGCTAGGCATCAG; CTGF, F: GTTTGGCCCAGACCCAACTA and R: GGCTCTGCTTCTCTAGCCTG; GAPDH, F: GTCTCCTCTGACTTCAACAGCG and R: ACCACCCTGTTGCTGTAGCCAA.

2.4. Reporter Constructs and Luciferase Assays

The 2X NOTCH1/HES consensus sequence or 2X YAP1/TEAD consensus sequence constructs containing two repeats of CGTGGGAA or ACATTCCA were cloned into the SmaI site of the pGL3 promoter as previously described [33]. We co-transfected 1 μg pGL3-2X NOTCH1/HES firefly luciferase plasmid or pGL3-2X YAP1/TEAD firefly luciferase plasmid and 10 ng pRL-pCMV Renilla luciferase plasmid (Promega, Madison, WI, USA) into cells using 3 μL TransIT-X2 transfection reagent (Mirus Bio, Madison, WI, USA) with 60% confluence in each well of a 12-well tissue culture dish. After 8 h of transfection, cells were treated with DMSO or 50 μM PTC124 for 2 days. The cells in each well were washed three times with 1 mL 1X PBS. Cells were harvested in 0.25 mL reporter lysis buffer and subjected to a dual luciferase assay (Promega, Madison, WI, USA) according to the manufacturer’s protocol. Firefly luciferase activity was normalized to Renilla luciferase activity, and the data are presented as the mean ± standard deviation from three independent experiments, each of which was performed in triplicate.

2.5. CCK8 Assay

CCK8 assay (Invitrogen) was used to assess the cell viability. CCK8 (10 μL) was added to each well of a 96-well plate, and the plate was placed in a 37 °C incubator with 5% CO2 for 1 h. After incubation, the OD 450 nm was read on a SpectraMax iD3 microplate reader (Molecular Devices, Silicon Valley, CA, USA). Mock was calculated as 100% to normalize for other drug treatment conditions. Medium without cells was used as the blank, and the percentage cell viability was calculated as follows: (Drug OD-Blank OD/Mock OD-Blank OD) × 100%.

2.6. Statistical Analysis

The statistical differences between the two groups were assessed by the Student’s t test (two-tailed). All results are presented as the mean ± SD. A P value of less than 0.05 was considered statistically significant (* p < 0.05, ** p < 0.01, *** p < 0.001).

3. Results

According to the gene mutation rate in HNSCC from the COSMIC database [21] (all data were retrieved on 1 October 2022), TP53 has a similar nonsense mutation rate in HNSCC as in other types of cancers (Figure 1A). Compared to the other types of cancers, NOTCH1 and FAT1 have a relatively high nonsense mutation rate in head and neck squamous cell carcinoma (HNSCC) (Figure 1B,C). In this study, we searched the COSMIC Cell Lines Project to find the suitable cells with TP53 or NOTCH1 or FAT1 nonsense mutation cells (Table 1) [21]. An HNSCC cell line, SAS, contains TAG-type nonsense mutation in the coding region of TP53 (Table 1). We also used two HNSCC cell lines, DOK and HO-1-u-1 cells, which both contain TAA-type nonsense mutation in the coding region of NOTCH1 and FAT1, respectively (Table 1).
PTC124 can induce p53 expression in SAS cells (Figure 2A). We found that PTC124 can induce NOTCH1 expression in DOK cells (Figure 2B), and PTC124 can induce FAT1 expression in HO-1-u-1 cells (Figure 2C). Three NOTCH1 downstream genes, HES5, AJUBA, and ADAM10, could be induced by PTC124 in DOK cells (Figure 3A). AJUBA and ADAM10 also act as tumor suppressor genes in HNSCC [34]. FAT1 can repress the YAP1 signal [35], and DDIT4 is a negative YAP1 target gene [36]. DDIT4 could be induced by PTC124 in HO-1-u-1 cells (Figure 3B). CTGF is a YAP1 downstream gene [37]; PTC124 can repress CTGF expression in HO-1-u-1 cells (Figure 3B).
To assay whether PTC124 can modulate the transactivation function of HES and YAP, we cloned the 2X NOTCH1/HES consensus sequence firefly luciferase reporter, which contains the repeat CGTGGGAA, and the 2X YAP1/TEAD consensus sequence firefly luciferase reporter, which contains a ACATTCCA repeat. PTC124 can stabilize firefly luciferase directly [38], but washing the cells three times before adding the reporter assay lysis buffer can remove the residual PTC124 to influence firefly luciferase [39]. So, we followed the same washing protocol to perform the reporter assay. PTC124 can activate 2X NOTCH1/HES consensus sequence reporter assay in DOK cells (Figure 4A). PTC124 can repress 2X YAP1/TEAD consensus sequence reporter assay in HO-1-u-1 cells (Figure 4B).
One NOTCH signaling inhibitor, FLI-06, was able to reverse PTC124-mediated cell growth inhibition in DOK cells (Figure 5A). A YAP signaling activator, TT-10, was able to promote HO-1-u-1 cell growth (Figure 5B). PTC124 was able to reverse TT-10-mediated HO-1-u-1 cell proliferation (Figure 5B). Therefore, PTC124 was able to rescue nonsense mutation of NOTCH1 and FAT1 to repress HNSCC cell proliferation (Figure 6).

4. Discussion

PTC124 is considered a relatively safe drug for nonsense mutation treatment compared with aminoglycosides G418 and gentamicin [7], but PTC124 generated fewer readthrough products than the aminoglycosides [40]. One study used a low dosage of G418 or gentamicin and PTC124 co-treatment to stimulate readthrough efficiency [41]. Several other drugs have also been tested together with a low dosage of G418 to try to generate more full-length PTC readthrough products, such as CDX5-1, mefloquine, SMG1i, Y-320, CC885, CC-90009, SRI-37240, and SRI-41315 [42,43,44,45,46,47,48]. SMG1i showed no response in enhancing PTC124 PTC readthrough [44], but CDX5-1, mefloquine, Y-320, CC885, CC-90009, SRI-37240, and SRI-41315 have not been tested with PTC124 as nonsense mutation treatment [42,43,45,46,47,48]. Whether there are any non-aminoglycoside drug(s) that can promote PTC124 PTC readthrough is an important consideration in the quest to improve the clinical use of PTC124 for nonsense mutation-mediated genetic diseases and cancers. Of note, one interesting study found that caffeine can attenuate the NMD activity and combine with PTC124 to enhance the readthrough and enrich the generation of full-length proteins [49]. Many small compounds have been screened and identified to have PTC readthrough activity through cell-based luciferase assays with a premature nonsense mutation in a firefly luciferase gene [2,47,50]. However, PTC124 can stabilize firefly luciferase directly [38], so this may restrict the identification of small compound(s) to enhance the PTC124 PTC readthrough. PTC124 has an influence on Renilla reniformis luciferase [51]. This novel type of reporter assay system is also a powerful tool for screening potential small compound(s) to enhance the PTC124 PTC readthrough.
In addition, one PTC124 analogue, NV848, was also found to be able to promote K62X SBDS gene nonsense mutation readthrough [52]. NV848 has also been tested with low toxicity in zebrafish [52]. The authors also mentioned that NV848 is more hydrophilic and should provide much easier delivery than PTC124 [52]. NV848 may also be very useful to rescue nonsense mutation of key tumor suppressor genes such as TP53, NOTCH1, and FAT1. Caffeine can enhance PTC124 readthrough [39], so NV848 may also have a good response with caffeine to rescue nonsense mutation of key tumor suppressor genes. Another two PTC124 analogs, NV914 and NV930, can also restore a much greater amount of CFTR W1282X protein than NV848 and PTC124 [53]. These two PTC124 analogs may also have a good response to rescue the nonsense mutation of key tumor suppressor genes.
The rates of pathological nonsense mutations occurring as three types of stop codons are TGA (38.5%), TAG (40.4%), and TAA (21.1%) [54]. Sixty-one codon triplets encode the twenty different types of amino acids, but only eighteen triplets encoding ten different types of amino acids can be converted to a stop codon through a single-base pair substitution mutation. These eighteen triplets are CGA or AGA (encode Arg), TGT or TGC (encode Cys), CAG or CAA (encode Gln), GAG or GAA (encode Glu), GGA (encode Gly), TTG or TTA (encode Leu), AAG or AAA (encode Lys), TCG or TCA (encode Ser), TGG (encode Trp), and TAT or TAC (encode Tyr). The most frequent types of mutation of nucleotide substitutions that become nonsense mutations are CGA to TGA (21%) and CAG to TAG (19%) [54]. The efficiency of aminoglycosides and PTC124 for PTC readthrough of DNA pre-stop codons is TGA > TAG > TAA [6,55]. 2,6-Diaminopurine (DAP) has a PTC readthrough effect, but DAP is only effective for TGA but not TAA or TAG [56]. The nucleoside analog, clitocine, has PTC readthrough efficiency TAA > TGA > TAG [57]. DOK (with NOTCH1 Y550X; single-base pair substitution mutation from TAC to TAA) or HO-1-u-1 (with FAT1 E378X; single-base pair substitution mutation from GAA to TAA), which were used in this study, are both TAA-type nonsense mutations (Table 1). Therefore, clitocine may be a powerful drug to induce more NOTCH1 or FAT1 expression in our cell system.
According to our results, PTC124 can restore NOTCH1 expression to enhance the HES transactivation function in DOK cells (Figure 2C and Figure 4A). PTC124-mediated cell growth repression was reversed by FLI-06 (a NOTCH signaling inhibitor) in DOK cells (Figure 5A). Overexpression of wild-type NOTCH1 in NOTCH1 mutant HNSCC cell lines can rapidly decrease cell viability and proliferation [58]; therefore, re-expressing functional NOTCH1 in both nonsense and missense mutations of NOTCH1 is a good anticancer strategy in HNSCC. PTC124 can restore FAT1 expression to block the YAP1 transactivation function in HO-1-u-1 cells (Figure 2E and Figure 4B), and PTC124 can upregulate the expression of the key tumor suppressor gene DDIT4 (Figure 3B). Cisplatin can induce several tumor suppressor genes such as p53, p73, p21, and DDIT4 but can also repress YAP1 in HNSCC [42]. Recently, DDIT4 has also been reported to be indirectly activated by p53 through RFX7 regulatory factor X 7 (RFX7) [43]. The combination treatment of PTC124 and chemotherapy drugs such as Cisplatin may be a good method of tumor therapy in YAP1 nonsense mutation HNSCC. This study demonstrated that PTC124 has an anticancer effect in several key tumor suppressor genes with nonsense mutation in HNSCC. The limitation of potential usage of this strategy may be the frequency of nonsense mutation of each key tumor suppressor gene in different types of cancers. Further experiments are needed to further investigate the pre-clinical and clinical usage of PTC124 for anticancer purposes in nonsense-mediated cancer formation.

5. Conclusions

Two tumor suppressor genes NOTCH1 and FAT1 both have a high nonsense mutation rate in HNSCC. PTC124 can rescue nonsense mutation of NOTCH1 and FAT1 to repress cell proliferation in HNSCC. PTC124 and other PTC124 analogues may also be effective on other tumor suppressor genes with high nonsense mutation rates in other types of cancers.

Author Contributions

M.-H.W., R.-Y.L. (Rui-Yu Lu), S.-J.Y. and B.-H.C. designed experiments. M.-H.W., R.-Y.L., S.-J.Y., Y.-Z.T., Y.-C.L. and B.-H.C. performed experiments. Z.-Y.B. and R.-Y.L. (Ruo-Yu Liao) searched the database and drew the tables. M.-H.W. and B.-H.C. drew the figures. B.-H.C. wrote the manuscript. Y.-C.H., C.-C.C. and B.-H.C. conducted review and editing. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by the Ministry of Science and Technology, Taiwan [MOST 111-2813-C-214-032-B to M.-H.W. and B.-H.C.] and the Medical Student Research and Development Scholarship Program [EDAHS110001 to M.-H.W., C.-C.C., and B.-H.C.].

Institutional Review Board Statement

This study was approved by the Ethics Committee of the Institutional Review Board of the E-DA Hospital. IRB Protocol Number: EMRP17110N. Approval Dated: 8 May 2021. Study Approval Expires: 8 April 2023.

Data Availability Statement

Data can be provided by the corresponding author upon reasonable request. Data were obtained from the COSMIC database, which is freely available for non-commercial users.

Acknowledgments

We would like to acknowledge the technical support given by the Basic Medical Core Laboratory, I-Shou University College of Medicine. We thank the p53 family lab in Taiwan new members (https://p53familylabtw.weebly.com (accessed on 5 October 2022) Yun-Chien Hsu, Fang-Yu Yeh, Yu-Rou Lin (School of Medicine, I-Shou University) and Ko-Fang Liu (Department of Medical Laboratory Science, I-Shou University) for technical help. We give special thanks to Reiji Kannagi (Institute of Biomedical Sciences, Academia Sinica) and Jang-Yi Chen (Department of Biology and Anatomy, National Defense Medical Center) for material and mechanical support. We greatly appreciate Dar-Bin Shieh (School of Dentistry and Institute of Oral Medicine, National Cheng Kung University) for providing DOK and HO-1-u-1 cell lines.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Hug, N.; Longman, D.; Cáceres, J.F. Mechanism and regulation of the nonsense-mediated decay pathway. Nucleic Acids Res. 2016, 44, 1483–1495. [Google Scholar] [CrossRef] [PubMed]
  2. Floquet, C.; Deforges, J.; Rousset, J.P.; Bidou, L. Rescue of non-sense mutated p53 tumor suppressor gene by aminoglycosides. Nucleic Acids Res. 2011, 39, 3350–3362. [Google Scholar] [CrossRef] [PubMed]
  3. Zhang, M.; Heldin, A.; Palomar-Siles, M.; Öhlin, S.; Bykov, V.J.N.; Wiman, K.G. Synergistic Rescue of Nonsense Mutant Tumor Suppressor p53 by Combination Treatment with Aminoglycosides and Mdm2 Inhibitors. Front. Oncol. 2017, 7, 323. [Google Scholar] [CrossRef]
  4. Kandasamy, J.; Atia-Glikin, D.; Shulman, E.; Shapira, K.; Shavit, M.; Belakhov, V.; Baasov, T. Increased selectivity toward cytoplasmic versus mitochondrial ribosome confers improved efficiency of synthetic aminoglycosides in fixing damaged genes: A strategy for treatment of genetic diseases caused by nonsense mutations. J. Med. Chem. 2012, 55, 10630–10643. [Google Scholar] [CrossRef] [PubMed]
  5. Rybak, L.P.; Kelly, T. Ototoxicity: Bioprotective mechanisms. Curr. Opin. Otolaryngol. Head Neck Surg. 2003, 11, 328–333. [Google Scholar] [CrossRef] [PubMed]
  6. Welch, E.M.; Barton, E.R.; Zhuo, J.; Tomizawa, Y.; Friesen, W.J.; Trifillis, P.; Paushkin, S.; Patel, M.; Trotta, C.R.; Hwang, S.; et al. PTC124 targets genetic disorders caused by nonsense mutations. Nature 2007, 447, 87–91. [Google Scholar] [CrossRef]
  7. Goldmann, T.; Overlack, N.; Möller, F.; Belakhov, V.; van Wyk, M.; Baasov, T.; Wolfrum, U.; Nagel-Wolfrum, K. A comparative evaluation of NB30, NB54 and PTC124 in translational read-through efficacy for treatment of an USH1C nonsense mutation. EMBO Mol. Med. 2012, 4, 1186–1199. [Google Scholar] [CrossRef]
  8. Hirawat, S.; Welch, E.M.; Elfring, G.L.; Northcutt, V.J.; Paushkin, S.; Hwang, S.; Leonard, E.M.; Almstead, N.G.; Ju, W.; Peltz, S.W.; et al. Safety, tolerability, and pharmacokinetics of PTC124, a nonaminoglycoside nonsense mutation suppressor, following single- and multiple-dose administration to healthy male and female adult volunteers. J. Clin. Pharmacol. 2007, 47, 430–444. [Google Scholar] [CrossRef]
  9. Wilschanski, M.; Miller, L.L.; Shoseyov, D.; Blau, H.; Rivlin, J.; Aviram, M.; Cohen, M.; Armoni, S.; Yaakov, Y.; Pugatsch, T.; et al. Chronic ataluren (PTC124) treatment of nonsense mutation cystic fibrosis. Eur. Respir. J. 2011, 38, 59–69. [Google Scholar] [CrossRef]
  10. Mercuri, E.; Muntoni, F.; Osorio, A.N.; Tulinius, M.; Buccella, F.; Morgenroth, L.P.; Gordish-Dressman, H.; Jiang, J.; Trifillis, P.; Zhu, J.; et al. Safety and effectiveness of ataluren: Comparison of results from the STRIDE Registry and CINRG DMD Natural History Study. J. Comp. Eff. Res. 2020, 9, 341–360. [Google Scholar] [CrossRef]
  11. Kerem, E.; Hirawat, S.; Armoni, S.; Yaakov, Y.; Shoseyov, D.; Cohen, M.; Nissim-Rafinia, M.; Blau, H.; Rivlin, J.; Aviram, M.; et al. Effectiveness of PTC124 treatment of cystic fibrosis caused by nonsense mutations: A prospective phase II trial. Lancet 2008, 372, 719–727. [Google Scholar] [CrossRef]
  12. Kerem, E.; Konstan, M.W.; De Boeck, K.; Accurso, F.J.; Sermet-Gaudelus, I.; Wilschanski, M.; Elborn, J.S.; Melotti, P.; Bronsveld, I.; Fajac, I.; et al. Ataluren for the treatment of nonsense-mutation cystic fibrosis: A randomised, double-blind, placebo-controlled phase 3 trial. Lancet Respir. Med. 2014, 2, 539–547. [Google Scholar] [CrossRef]
  13. Finkel, R.S.; Flanigan, K.M.; Wong, B.; Bönnemann, C.; Sampson, J.; Sweeney, H.L.; Reha, A.; Northcutt, V.J.; Elfring, G.; Barth, J.; et al. Phase 2a study of ataluren-mediated dystrophin production in patients with nonsense mutation Duchenne muscular dystrophy. PLoS ONE 2013, 8, e81302. [Google Scholar] [CrossRef]
  14. McDonald, C.M.; Campbell, C.; Torricelli, R.E.; Finkel, R.S.; Flanigan, K.M.; Goemans, N.; Heydemann, P.; Kaminska, A.; Kirschner, J.; Muntoni, F.; et al. Ataluren in patients with nonsense mutation Duchenne muscular dystrophy (ACT DMD): A multicentre, randomised, double-blind, placebo-controlled, phase 3 trial. Lancet 2017, 390, 1489–1498. [Google Scholar] [CrossRef]
  15. Ryan, N.J. Ataluren: First global approval. Drugs 2014, 74, 1709–1714. [Google Scholar] [CrossRef]
  16. Lizardo, D.Y.; Kuang, C.; Hao, S.; Yu, J.; Huang, Y.; Zhang, L. Immunotherapy efficacy on mismatch repair-deficient colorectal cancer: From bench to bedside. Biochim. Biophys. Acta Rev. Cancer 2020, 1874, 188447. [Google Scholar] [CrossRef]
  17. Nigro, J.M.; Baker, S.J.; Preisinger, A.C.; Jessup, J.M.; Hostetter, R.; Cleary, K.; Bigner, S.H.; Davidson, N.; Baylin, S.; Devilee, P. Mutations in the p53 gene occur in diverse human tumour types. Nature 1989, 342, 705–708. [Google Scholar] [CrossRef]
  18. Hollstein, M.; Sidransky, D.; Vogelstein, B.; Harris, C.C. p53 mutations in human cancers. Science 1991, 253, 49–53. [Google Scholar] [CrossRef]
  19. Olivier, M.; Hollstein, M.; Hainaut, P. TP53 mutations in human cancers: Origins, consequences, and clinical use. Cold Spring Harb. Perspect. Biol. 2010, 2, a001008. [Google Scholar] [CrossRef]
  20. Cai, B.H.; Hsu, Y.C.; Yeh, F.Y.; Lin, Y.R.; Lu, R.Y.; Yu, S.J.; Shaw, J.F.; Wu, M.H.; Tsai, Y.Z.; Lin, Y.C.; et al. P63 and P73 Activation in Cancers with p53 Mutation. Biomedicines 2022, 10, 1490. [Google Scholar] [CrossRef]
  21. Tate, J.G.; Bamford, S.; Jubb, H.C.; Sondka, Z.; Beare, D.M.; Bindal, N.; Boutselakis, H.; Cole, C.G.; Creatore, C.; Dawson, E.; et al. COSMIC: The Catalogue Of Somatic Mutations In Cancer. Nucleic Acids Res. 2019, 47, D941–D947. [Google Scholar] [CrossRef] [PubMed]
  22. Roy, B.; Friesen, W.J.; Tomizawa, Y.; Leszyk, J.D.; Zhuo, J.; Johnson, B.; Dakka, J.; Trotta, C.R.; Xue, X.; Mutyam, V.; et al. Ataluren stimulates ribosomal selection of near-cognate tRNAs to promote nonsense suppression. Proc. Natl. Acad. Sci. USA 2016, 113, 12508–12513. [Google Scholar] [CrossRef]
  23. Cai, B.H.; Chao, C.F.; Huang, H.C.; Lee, H.Y.; Kannagi, R.; Chen, J.Y. Roles of p53 Family Structure and Function in Non-Canonical Response Element Binding and Activation. Int. J. Mol. Sci. 2019, 20, 3681. [Google Scholar] [CrossRef] [PubMed]
  24. Platonova, N.; Manzo, T.; Mirandola, L.; Colombo, M.; Calzavara, E.; Vigolo, E.; Cermisoni, G.C.; De Simone, D.; Garavelli, S.; Cecchinato, V.; et al. PI3K/AKT signaling inhibits NOTCH1 lysosome-mediated degradation. Genes Chromosomes Cancer 2015, 54, 516–526. [Google Scholar] [CrossRef] [PubMed]
  25. Meng, P.; Zhang, Y.F.; Zhang, W.; Chen, X.; Xu, T.; Hu, S.; Liang, X.; Feng, M.; Yang, X.; Ho, M. Identification of the atypical cadherin FAT1 as a novel glypican-3 interacting protein in liver cancer cells. Sci. Rep. 2021, 11, 40. [Google Scholar] [CrossRef] [PubMed]
  26. Purow, B.W.; Haque, R.M.; Noel, M.W.; Su, Q.; Burdick, M.J.; Lee, J.; Sundaresan, T.; Pastorino, S.; Park, J.K.; Mikolaenko, I.; et al. Expression of Notch-1 and its ligands, Delta-like-1 and Jagged-1, is critical for glioma cell survival and proliferation. Cancer Res. 2005, 65, 2353–2363. [Google Scholar] [CrossRef]
  27. Kopan, R. Notch signaling. Cold Spring Harb. Perspect. Biol. 2012, 4, a011213. [Google Scholar] [CrossRef]
  28. Irshad, K.; Malik, N.; Arora, M.; Gupta, Y.; Sinha, S.; Chosdol, K. The quest for ligands and binding partners of atypical cadherin FAT1. Transl. Oncol. 2021, 14, 101097. [Google Scholar] [CrossRef]
  29. Santos-de-Frutos, K.; Segrelles, C.; Lorz, C. Hippo Pathway and YAP Signaling Alterations in Squamous Cancer of the Head and Neck. J. Clin. Med. 2019, 8, 2131. [Google Scholar] [CrossRef]
  30. Wirth, M.; Jira, D.; Ott, A.; Piontek, G.; Pickhard, A. High NOTCH1 mRNA Expression Is Associated with Better Survival in HNSCC. Int. J. Mol. Sci. 2018, 19, 830. [Google Scholar] [CrossRef]
  31. Cury, S.S.; Miranda, P.M.; Marchi, F.A.; Canto, L.M.D.; Chulam, T.C.; Petersen, A.H.; Aagaard, M.M.; Pinto, C.A.L.; Kowalski, L.P.; Rogatto, S.R. Germline variants in DNA repair genes are associated with young-onset head and neck cancer. Oral Oncol. 2021, 122, 105545. [Google Scholar] [CrossRef] [PubMed]
  32. Rueden, C.T.; Schindelin, J.; Hiner, M.C.; DeZonia, B.E.; Walter, A.E.; Arena, E.T.; Eliceiri, K.W. ImageJ2: ImageJ for the next generation of scientific image data. BMC Bioinform. 2017, 18, 529. [Google Scholar] [CrossRef] [PubMed]
  33. Cai, B.H.; Chen, J.Y.; Lu, M.H.; Chang, L.T.; Lin, H.C.; Chang, Y.M.; Chao, C.F. Functional four-base A/T gap core sequence CATTAG of P53 response elements specifically bound tetrameric P53 differently than two-base A/T gap core sequence CATG bound both dimeric and tetrameric P53. Nucleic Acids Res. 2009, 37, 1984–1990. [Google Scholar] [CrossRef]
  34. Loganathan, S.K.; Schleicher, K.; Malik, A.; Quevedo, R.; Langille, E.; Teng, K.; Oh, R.H.; Rathod, B.; Tsai, R.; Samavarchi-Tehrani, P.; et al. Rare driver mutations in head and neck squamous cell carcinomas converge on NOTCH signaling. Science 2020, 367, 1264–1269. [Google Scholar] [CrossRef] [PubMed]
  35. Martin, D.; Degese, M.S.; Vitale-Cross, L.; Iglesias-Bartolome, R.; Valera, J.L.C.; Wang, Z.; Feng, X.; Yeerna, H.; Vadmal, V.; Moroishi, T.; et al. Assembly and activation of the Hippo signalome by FAT1 tumor suppressor. Nat. Commun. 2018, 9, 2372. [Google Scholar] [CrossRef] [PubMed]
  36. Kim, M.; Kim, T.; Johnson, R.L.; Lim, D.S. Transcriptional co-repressor function of the hippo pathway transducers YAP and TAZ. Cell Rep. 2015, 11, 270–282. [Google Scholar] [CrossRef] [PubMed]
  37. Zhao, B.; Ye, X.; Yu, J.; Li, L.; Li, W.; Li, S.; Lin, J.D.; Wang, C.Y.; Chinnaiyan, A.M.; Lai, Z.C.; et al. TEAD mediates YAP-dependent gene induction and growth control. Genes Dev. 2008, 22, 1962–1971. [Google Scholar] [CrossRef]
  38. Auld, D.S.; Lovell, S.; Thorne, N.; Lea, W.A.; Maloney, D.J.; Shen, M.; Rai, G.; Battaile, K.P.; Thomas, C.J.; Simeonov, A.; et al. Molecular basis for the high-affinity binding and stabilization of firefly luciferase by PTC124. Proc Natl. Acad. Sci. USA 2010, 107, 4878–4883. [Google Scholar] [CrossRef]
  39. McElroy, S.P.; Nomura, T.; Torrie, L.S.; Warbrick, E.; Gartner, U.; Wood, G.; McLean, W.H. A lack of premature termination codon read-through efficacy of PTC124 (Ataluren) in a diverse array of reporter assays. PLoS Biol. 2013, 11, e1001593. [Google Scholar] [CrossRef]
  40. Yu, H.; Liu, X.; Huang, J.; Zhang, Y.; Hu, R.; Pu, J. Comparison of read-through effects of aminoglycosides and PTC124 on rescuing nonsense mutations of HERG gene associated with long QT syndrome. Int. J. Mol. Med. 2014, 33, 729–735. [Google Scholar] [CrossRef]
  41. Ng, M.Y.; Li, H.; Ghelfi, M.D.; Goldman, Y.E.; Cooperman, B.S. Ataluren and aminoglycosides stimulate read-through of nonsense codons by orthogonal mechanisms. Proc. Natl. Acad. Sci. USA 2021, 118, e2020599118. [Google Scholar] [CrossRef]
  42. Baradaran-Heravi, A.; Balgi, A.D.; Zimmerman, C.; Choi, K.; Shidmoossavee, F.S.; Tan, J.S.; Bergeaud, C.; Krause, A.; Flibotte, S.; Shimizu, Y.; et al. Novel small molecules potentiate premature termination codon readthrough by aminoglycosides. Nucleic Acids Res. 2016, 44, 6583–6598. [Google Scholar] [CrossRef] [PubMed]
  43. Ferguson, M.W.; Gerak, C.A.N.; Chow, C.C.T.; Rastelli, E.J.; Elmore, K.E.; Stahl, F.; Hosseini-Farahabadi, S.; Baradaran-Heravi, A.; Coltart, D.M.; Roberge, M. The antimalarial drug mefloquine enhances TP53 premature termination codon readthrough by aminoglycoside G418. PLoS ONE 2019, 14, e0216423. [Google Scholar] [CrossRef] [PubMed]
  44. McHugh, D.R.; Cotton, C.U.; Hodges, C.A. Synergy between Readthrough and Nonsense Mediated Decay Inhibition in a Murine Model of Cystic Fibrosis Nonsense Mutations. Int. J. Mol. Sci. 2020, 22, 344. [Google Scholar] [CrossRef] [PubMed]
  45. Hosseini-Farahabadi, S.; Baradaran-Heravi, A.; Zimmerman, C.; Choi, K.; Flibotte, S.; Roberge, M. Small molecule Y-320 stimulates ribosome biogenesis, protein synthesis, and aminoglycoside-induced premature termination codon readthrough. PLoS Biol. 2021, 19, e3001221. [Google Scholar] [CrossRef]
  46. Baradaran-Heravi, A.; Balgi, A.D.; Hosseini-Farahabadi, S.; Choi, K.; Has, C.; Roberge, M. Effect of small molecule eRF3 degraders on premature termination codon readthrough. Nucleic Acids Res. 2021, 49, 3692–3708. [Google Scholar] [CrossRef]
  47. Sharma, J.; Du, M.; Wong, E.; Mutyam, V.; Li, Y.; Chen, J.; Wangen, J.; Thrasher, K.; Fu, L.; Peng, N.; et al. A small molecule that induces translational readthrough of CFTR nonsense mutations by eRF1 depletion. Nat. Commun. 2021, 12, 4358. [Google Scholar] [CrossRef]
  48. Lee, R.E.; Lewis, C.A.; He, L.; Bulik-Sullivan, E.C.; Gallant, S.C.; Mascenik, T.M.; Dang, H.; Cholon, D.M.; Gentzsch, M.; Morton, L.C.; et al. Small-molecule eRF3a degraders rescue CFTR nonsense mutations by promoting premature termination codon readthrough. J. Clin. Investig. 2022, 132, e154571. [Google Scholar] [CrossRef]
  49. Lentini, L.; Melfi, R.; Cancemi, P.; Pibiri, I.; Di Leonardo, A. Caffeine boosts Ataluren’s readthrough activity. Heliyon 2019, 5, e01963. [Google Scholar] [CrossRef]
  50. Omachi, K.; Kai, H.; Roberge, M.; Miner, J.H. NanoLuc reporters identify COL4A5 nonsense mutations susceptible to drug-induced stop codon readthrough. Iscience 2022, 25, 103891. [Google Scholar] [CrossRef]
  51. Auld, D.S.; Thorne, N.; Maguire, W.F.; Inglese, J. Mechanism of PTC124 activity in cell-based luciferase assays of nonsense codon suppression. Proc Natl. Acad. Sci. USA 2009, 106, 3585–3590. [Google Scholar] [CrossRef] [PubMed]
  52. Bezzerri, V.; Lentini, L.; Api, M.; Busilacchi, E.M.; Cavalieri, V.; Pomilio, A.; Diomede, F.; Pegoraro, A.; Cesaro, S.; Poloni, A.; et al. Novel Translational Read-through-Inducing Drugs as a Therapeutic Option for Shwachman-Diamond Syndrome. Biomedicines 2022, 10, 886. [Google Scholar] [CrossRef] [PubMed]
  53. Pibiri, I.; Melfi, R.; Tutone, M.; Di Leonardo, A.; Pace, A.; Lentini, L. Targeting Nonsense: Optimization of 1,2,4-Oxadiazole TRIDs to Rescue CFTR Expression and Functionality in Cystic Fibrosis Cell Model Systems. Int. J. Mol. Sci. 2020, 21, 6420. [Google Scholar] [CrossRef] [PubMed]
  54. Mort, M.; Ivanov, D.; Cooper, D.N.; Chuzhanova, N.A. A meta-analysis of nonsense mutations causing human genetic disease. Hum. Mutat. 2008, 29, 1037–1047. [Google Scholar] [CrossRef]
  55. Azimov, R.; Abuladze, N.; Sassani, P.; Newman, D.; Kao, L.; Liu, W.; Orozco, N.; Ruchala, P.; Pushkin, A.; Kurtz, I. G418-mediated ribosomal read-through of a nonsense mutation causing autosomal recessive proximal renal tubular acidosis. Am. J. Physiol. Renal. Physiol. 2008, 295, F633–F641. [Google Scholar] [CrossRef]
  56. Trzaska, C.; Amand, S.; Bailly, C.; Leroy, C.; Marchand, V.; Duvernois-Berthet, E.; Saliou, J.M.; Benhabiles, H.; Werkmeister, E.; Chassat, T.; et al. 2,6-Diaminopurine as a highly potent corrector of UGA nonsense mutations. Nat. Commun. 2020, 11, 1509. [Google Scholar] [CrossRef]
  57. Friesen, W.J.; Trotta, C.R.; Tomizawa, Y.; Zhuo, J.; Johnson, B.; Sierra, J.; Roy, B.; Weetall, M.; Hedrick, J.; Sheedy, J.; et al. The nucleoside analog clitocine is a potent and efficacious readthrough agent. RNA 2017, 23, 567–577. [Google Scholar] [CrossRef]
  58. Pickering, C.R.; Zhang, J.; Yoo, S.Y.; Bengtsson, L.; Moorthy, S.; Neskey, D.M.; Zhao, M.; Ortega Alves, M.V.; Chang, K.; Drummond, J.; et al. Integrative genomic characterization of oral squamous cell carcinoma identifies frequent somatic drivers. Cancer Discov. 2013, 3, 770–781. [Google Scholar] [CrossRef]
Figure 1. NOTCH1 and FAT1 have a high nonsense mutation rate in HNSCC. (A) TP53 has a 10.71% nonsense mutation rate in all the cancer mutation samples and a 11.4% nonsense mutation rate in HNSCC with TP53 mutation in the COSMIC database (https://cancer.sanger.ac.uk/cosmic (accessed on 1 October 2022)) [21]. (B) NOTCH1 only has an 8.53% nonsense mutation rate across all the cancer mutation samples but a 19.62% nonsense mutation rate in HNSCC with NOTCH1 mutation in the COSMIC database [21]. (C) FAT1 only has a 13.08% nonsense mutation rate across all the cancer mutation samples but a 40.11% nonsense mutation rate in HNSCC with FAT1 mutation in the COSMIC database [21].
Figure 1. NOTCH1 and FAT1 have a high nonsense mutation rate in HNSCC. (A) TP53 has a 10.71% nonsense mutation rate in all the cancer mutation samples and a 11.4% nonsense mutation rate in HNSCC with TP53 mutation in the COSMIC database (https://cancer.sanger.ac.uk/cosmic (accessed on 1 October 2022)) [21]. (B) NOTCH1 only has an 8.53% nonsense mutation rate across all the cancer mutation samples but a 19.62% nonsense mutation rate in HNSCC with NOTCH1 mutation in the COSMIC database [21]. (C) FAT1 only has a 13.08% nonsense mutation rate across all the cancer mutation samples but a 40.11% nonsense mutation rate in HNSCC with FAT1 mutation in the COSMIC database [21].
Biomedicines 10 02948 g001
Figure 2. PTC124 can induce NOTCH1 and FAT1 expression in DOK and HO-1-u-1 cells, respectively. (A) PTC124 (50 μM) can induce p53 in SAS cells. (B) p53 fluorescence intensity is dramatically inducted by PTC124 (*** p < 0.001). Results are displayed as mean ± SD, n = 3. (C) PTC124 (50 μM) can induce NOTCH1 in DOK cells. (D) NOTCH1 fluorescence intensity is dramatically induced by PTC124 (*** p < 0.001). Results are displayed as mean ± SD, n = 3. (E) PTC124 (50 μM) can induce FAT1 in HO-1-u-1 cells. (F) FAT1 fluorescence intensity is dramatically induced by PTC124 (*** p < 0.001). Results are displayed as mean ± SD, n = 3.
Figure 2. PTC124 can induce NOTCH1 and FAT1 expression in DOK and HO-1-u-1 cells, respectively. (A) PTC124 (50 μM) can induce p53 in SAS cells. (B) p53 fluorescence intensity is dramatically inducted by PTC124 (*** p < 0.001). Results are displayed as mean ± SD, n = 3. (C) PTC124 (50 μM) can induce NOTCH1 in DOK cells. (D) NOTCH1 fluorescence intensity is dramatically induced by PTC124 (*** p < 0.001). Results are displayed as mean ± SD, n = 3. (E) PTC124 (50 μM) can induce FAT1 in HO-1-u-1 cells. (F) FAT1 fluorescence intensity is dramatically induced by PTC124 (*** p < 0.001). Results are displayed as mean ± SD, n = 3.
Biomedicines 10 02948 g002
Figure 3. PTC124 can induce NOTCH1 downstream genes and DDIT4 in DOK and HO-1-u-1 cells, respectively. (A) PTC124 (50 μM) can induce HES5, AJUBA, and ADAM10 expression in DOK cells (*** p < 0.001). DMSO only was calculated as 1 to normalize for the other conditions. Results are displayed as mean ± SD, n = 3. (B) PTC124 (50 μM) can induce DDIT4 and repress CFGF expression in HO-1-u-1 cells (** p < 0.01, *** p < 0.001). DMSO only was calculated as 1 to normalize for the other conditions. Results are displayed as mean ± SD, n = 3.
Figure 3. PTC124 can induce NOTCH1 downstream genes and DDIT4 in DOK and HO-1-u-1 cells, respectively. (A) PTC124 (50 μM) can induce HES5, AJUBA, and ADAM10 expression in DOK cells (*** p < 0.001). DMSO only was calculated as 1 to normalize for the other conditions. Results are displayed as mean ± SD, n = 3. (B) PTC124 (50 μM) can induce DDIT4 and repress CFGF expression in HO-1-u-1 cells (** p < 0.01, *** p < 0.001). DMSO only was calculated as 1 to normalize for the other conditions. Results are displayed as mean ± SD, n = 3.
Biomedicines 10 02948 g003
Figure 4. PTC124 can moderate HES and TEAD transactivation function. (A) PTC124 (50 μM) can upregulate 2X NOTCH1/HES consensus sequence reporter assay in DOK cells (*** p < 0.001). DMSO only was calculated as 1 to normalize for the other conditions. The results are displayed as mean ± SD, n = 3. (B) PTC124 (50 μM) can downregulate 2X YAP1/TEAD consensus sequence reporter assay in HO-1-u-1 cells (** p < 0.01). DMSO only was calculated as 1 to normalize for the other conditions. Results are displayed as mean ± SD, n = 3.
Figure 4. PTC124 can moderate HES and TEAD transactivation function. (A) PTC124 (50 μM) can upregulate 2X NOTCH1/HES consensus sequence reporter assay in DOK cells (*** p < 0.001). DMSO only was calculated as 1 to normalize for the other conditions. The results are displayed as mean ± SD, n = 3. (B) PTC124 (50 μM) can downregulate 2X YAP1/TEAD consensus sequence reporter assay in HO-1-u-1 cells (** p < 0.01). DMSO only was calculated as 1 to normalize for the other conditions. Results are displayed as mean ± SD, n = 3.
Biomedicines 10 02948 g004
Figure 5. PTC124 can control HNSCC cell growth in DOK and HO-1-u-1 cells. (A) FLI-06 (10 μM) was able to reverse PTC124-mediated repression of DOK cell growth (** p < 0.01). DMSO/MOCK was calculated as 1 to normalize for the other conditions. Results are displayed as mean ± SD, n = 3. (B) PTC124 could repress HO-1-u-1 cell growth (* p < 0.05). PTC124 could reverse TT-10 (10 μM)-mediated HO-1-u-1 cell proliferation (** p < 0.01). DMSO/MOCK was calculated as 1 to normalize for the other conditions. Results are displayed as mean ± SD, n = 3.
Figure 5. PTC124 can control HNSCC cell growth in DOK and HO-1-u-1 cells. (A) FLI-06 (10 μM) was able to reverse PTC124-mediated repression of DOK cell growth (** p < 0.01). DMSO/MOCK was calculated as 1 to normalize for the other conditions. Results are displayed as mean ± SD, n = 3. (B) PTC124 could repress HO-1-u-1 cell growth (* p < 0.05). PTC124 could reverse TT-10 (10 μM)-mediated HO-1-u-1 cell proliferation (** p < 0.01). DMSO/MOCK was calculated as 1 to normalize for the other conditions. Results are displayed as mean ± SD, n = 3.
Biomedicines 10 02948 g005
Figure 6. PTC124 can rescue nonsense mutation of two tumor suppressor genes NOTCH1 and FAT1 to repress HNSCC cell proliferation. PTC124 can induce the expression of NOTCH1 (left blue arrow) and NOTCH1 downstream genes (HES5, AJUBA, and ADAM10) in DOK cells (with NOTCH1 Y550X). FLI-06 is a NOTCH signaling inhibitor. FLI-06 can reverse PTC124-mediated cell growth inhibition in DOK cells. PTC124 can induce FAT1 (right blue arrow) and DDIT4 (dash line arrow) expression in HO-1-u-1 cells (with FAT1 E378X). TT-10 is a YAP signaling activator. PTC124 can reverse TT-10-mediated HO-1-u-1 cell proliferation.
Figure 6. PTC124 can rescue nonsense mutation of two tumor suppressor genes NOTCH1 and FAT1 to repress HNSCC cell proliferation. PTC124 can induce the expression of NOTCH1 (left blue arrow) and NOTCH1 downstream genes (HES5, AJUBA, and ADAM10) in DOK cells (with NOTCH1 Y550X). FLI-06 is a NOTCH signaling inhibitor. FLI-06 can reverse PTC124-mediated cell growth inhibition in DOK cells. PTC124 can induce FAT1 (right blue arrow) and DDIT4 (dash line arrow) expression in HO-1-u-1 cells (with FAT1 E378X). TT-10 is a YAP signaling activator. PTC124 can reverse TT-10-mediated HO-1-u-1 cell proliferation.
Biomedicines 10 02948 g006
Table 1. Information about the cell lines used in this study.
Table 1. Information about the cell lines used in this study.
Cell Line NameNonsense Mutation GeneProtein
Mutation
Site *
DNA
Mutation
Site *
Original
Codon
Mutated
Pre-Stop
Codon
SASTP53p.E336Xc.1006G > TGAGTAG
DOKNOTCH1p.Y550Xc.1650C > ATACTAA
HO-1-u-1FAT1p.E378Xc.1132G > TGAATAA
* The protein mutation site and DNA mutation site of each mutation in the cell line are available from the COSMIC Cell Lines Project (https://cancer.sanger.ac.uk/cell_lines (accessed on 1 October 2022) [21].
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Wu, M.-H.; Lu, R.-Y.; Yu, S.-J.; Tsai, Y.-Z.; Lin, Y.-C.; Bai, Z.-Y.; Liao, R.-Y.; Hsu, Y.-C.; Chen, C.-C.; Cai, B.-H. PTC124 Rescues Nonsense Mutation of Two Tumor Suppressor Genes NOTCH1 and FAT1 to Repress HNSCC Cell Proliferation. Biomedicines 2022, 10, 2948. https://doi.org/10.3390/biomedicines10112948

AMA Style

Wu M-H, Lu R-Y, Yu S-J, Tsai Y-Z, Lin Y-C, Bai Z-Y, Liao R-Y, Hsu Y-C, Chen C-C, Cai B-H. PTC124 Rescues Nonsense Mutation of Two Tumor Suppressor Genes NOTCH1 and FAT1 to Repress HNSCC Cell Proliferation. Biomedicines. 2022; 10(11):2948. https://doi.org/10.3390/biomedicines10112948

Chicago/Turabian Style

Wu, Ming-Han, Rui-Yu Lu, Si-Jie Yu, Yi-Zhen Tsai, Ying-Chen Lin, Zhi-Yu Bai, Ruo-Yu Liao, Yi-Chiang Hsu, Chia-Chi Chen, and Bi-He Cai. 2022. "PTC124 Rescues Nonsense Mutation of Two Tumor Suppressor Genes NOTCH1 and FAT1 to Repress HNSCC Cell Proliferation" Biomedicines 10, no. 11: 2948. https://doi.org/10.3390/biomedicines10112948

APA Style

Wu, M.-H., Lu, R.-Y., Yu, S.-J., Tsai, Y.-Z., Lin, Y.-C., Bai, Z.-Y., Liao, R.-Y., Hsu, Y.-C., Chen, C.-C., & Cai, B.-H. (2022). PTC124 Rescues Nonsense Mutation of Two Tumor Suppressor Genes NOTCH1 and FAT1 to Repress HNSCC Cell Proliferation. Biomedicines, 10(11), 2948. https://doi.org/10.3390/biomedicines10112948

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop