Adenocarcinomas of the Lung and Neurotrophin System: A Review
Abstract
1. Introduction
2. Neurotrophins and Neurotrophin Receptors in the Lung
3. Neurotrophins and Their Receptors in Cancer
Low Affinity NT p75 Receptor in ADK of the Lung
4. Neurotrophins and Their Cognate High Affinity TRK Receptors in ADK of the Lungs
4.1. NGF/TrkA Receptor Signalling
4.2. BDNF/TrkB Receptor Signalling
4.3. NT3/TRKC
5. Therapy in NTRK Positive Solid Tumors
6. Conclusions and Perspectives
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Siegel, R.L.; Miller, K.D.; Jemal, A. Cancer Statistics, 2020. CA Cancer J. Clin. 2020, 70, 7–30. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.-J.; Lei, K.-F.; Han, F. Tumor Microenvironment: Recent Advances in Various Cancer Treatments. Eur. Rev. Med. Pharmacol. Sci. 2018, 22, 3855–3864. [Google Scholar] [CrossRef] [PubMed]
- Li, T.; Kang, G.; Wang, T.; Huang, H. Tumor Angiogenesis and Anti-Angiogenic Gene Therapy for Cancer. Oncol. Lett. 2018, 16, 687–702. [Google Scholar] [CrossRef] [PubMed]
- Lugano, R.; Ramachandran, M.; Dimberg, A. Tumor Angiogenesis: Causes, Consequences, Challenges and Opportunities. Cell. Mol. Life Sci. 2020, 77, 1745–1770. [Google Scholar] [CrossRef]
- Bremnes, R.M.; Camps, C.; Sirera, R. Angiogenesis in Non-Small Cell Lung Cancer: The Prognostic Impact of Neoangiogenesis and the Cytokines VEGF and BFGF in Tumours and Blood. Lung Cancer 2006, 51, 143–158. [Google Scholar] [CrossRef]
- Stacker, S.A.; Williams, S.P.; Karnezis, T.; Shayan, R.; Fox, S.B.; Achen, M.G. Lymphangiogenesis and Lymphatic Vessel Remodelling in Cancer. Nat. Rev. Cancer 2014, 14, 159–172. [Google Scholar] [CrossRef]
- Wang, C.-A.; Tsai, S.-J. Regulation of Lymphangiogenesis by Extracellular Vesicles in Cancer Metastasis. Exp. Biol. Med. 2021, 246, 2048–2056. [Google Scholar] [CrossRef]
- Rankin, E.B.; Giaccia, A.J. The Role of Hypoxia-Inducible Factors in Tumorigenesis. Cell Death Differ. 2008, 15, 678–685. [Google Scholar] [CrossRef]
- Gao, Y.; Jing, M.; Ge, R.; Lang, L. Induction of Hypoxia-Inducible Factor-1α by BDNF Protects Retinoblastoma Cells against Chemotherapy-Induced Apoptosis. Mol. Cell. Biochem. 2016, 414, 77–84. [Google Scholar] [CrossRef]
- Martens, L.K.; Kirschner, K.M.; Warnecke, C.; Scholz, H. Hypoxia-Inducible Factor-1 (HIF-1) Is a Transcriptional Activator of the TrkB Neurotrophin Receptor Gene. J. Biol. Chem. 2007, 282, 14379–14388. [Google Scholar] [CrossRef]
- Tong, B.; Pantazopoulou, V.; Johansson, E.; Pietras, A. The P75 Neurotrophin Receptor Enhances HIF-Dependent Signaling in Glioma. Exp. Cell Res. 2018, 371, 122–129. [Google Scholar] [CrossRef] [PubMed]
- Mancino, M.; Ametller, E.; Gascón, P.; Almendro, V. The Neuronal Influence on Tumor Progression. Biochim. Biophys. Acta 2011, 1816, 105–118. [Google Scholar] [CrossRef] [PubMed]
- Erin, N.; Shurin, G.V.; Baraldi, J.H.; Shurin, M.R. Regulation of Carcinogenesis by Sensory Neurons and Neuromediators. Cancers 2022, 14, 2333. [Google Scholar] [CrossRef]
- Godbout, J.P.; Glaser, R. Stress-Induced Immune Dysregulation: Implications for Wound Healing, Infectious Disease and Cancer. J. Neuroimmun. Pharmacol. 2006, 1, 421–427. [Google Scholar] [CrossRef] [PubMed]
- Cherubini, E.; Di Napoli, A.; Noto, A.; Osman, G.A.; Esposito, M.C.; Mariotta, S.; Sellitri, R.; Ruco, L.; Cardillo, G.; Ciliberto, G.; et al. Genetic and Functional Analysis of Polymorphisms in the Human Dopamine Receptor and Transporter Genes in Small Cell Lung Cancer. J. Cell. Physiol. 2016, 231, 345–356. [Google Scholar] [CrossRef] [PubMed]
- Entschladen, F.; Drell, T.L.; Lang, K.; Joseph, J.; Zaenker, K.S. Tumour-Cell Migration, Invasion, and Metastasis: Navigation by Neurotransmitters. Lancet Oncol. 2004, 5, 254–258. [Google Scholar] [CrossRef]
- Scuteri, A.; Miloso, M.; Foudah, D.; Orciani, M.; Cavaletti, G.; Tredici, G. Mesenchymal Stem Cells Neuronal Differentiation Ability: A Real Perspective for Nervous System Repair? Curr. Stem Cell Res. Ther. 2011, 6, 82–92. [Google Scholar] [CrossRef]
- Park, H.T.; Wu, J.; Rao, Y. Molecular Control of Neuronal Migration. Bioessays 2002, 24, 821–827. [Google Scholar] [CrossRef]
- Ricci, A.; Greco, S.; Mariotta, S.; Felici, L.; Bronzetti, E.; Cavazzana, A.; Cardillo, G.; Amenta, F.; Bisetti, A.; Barbolini, G. Neurotrophins and Neurotrophin Receptors in Human Lung Cancer. Am. J. Respir. Cell Mol. Biol. 2001, 25, 439–446. [Google Scholar] [CrossRef]
- Meng, L.; Liu, B.; Ji, R.; Jiang, X.; Yan, X.; Xin, Y. Targeting the BDNF/TrkB Pathway for the Treatment of Tumors. Oncol. Lett. 2019, 17, 2031–2039. [Google Scholar] [CrossRef]
- Chao, M.V. Neurotrophins and Their Receptors: A Convergence Point for Many Signalling Pathways. Nat. Rev. Neurosci. 2003, 4, 299–309. [Google Scholar] [CrossRef] [PubMed]
- Ozono, K.; Ohishi, Y.; Onishi, H.; Nakamura, K.; Motoshita, J.; Kato, M.; Nakanishi, R.; Nakamura, M.; Oda, Y. Brain-Derived Neurotrophic Factor/Tropomyosin-Related Kinase B Signaling Pathway Contributes to the Aggressive Behavior of Lung Squamous Cell Carcinoma. Lab. Investig. 2017, 97, 1332–1342. [Google Scholar] [CrossRef] [PubMed]
- Bradshaw, R.A.; Murray-Rust, J.; Ibáñez, C.F.; McDonald, N.Q.; Lapatto, R.; Blundell, T.L. Nerve Growth Factor: Structure/Function Relationships. Protein Sci. 1994, 3, 1901–1913. [Google Scholar] [CrossRef] [PubMed]
- Wiesmann, C.; de Vos, A.M. Nerve Growth Factor: Structure and Function. Cell. Mol. Life Sci. 2001, 58, 748–759. [Google Scholar] [CrossRef] [PubMed]
- Halban, P.A.; Irminger, J.C. Sorting and Processing of Secretory Proteins. Biochem. J. 1994, 299, 1–18. [Google Scholar] [CrossRef] [PubMed]
- Kojima, M.; Ishii, C.; Sano, Y.; Mizui, T.; Furuichi, T. Journey of Brain-Derived Neurotrophic Factor: From Intracellular Trafficking to Secretion. Cell Tissue Res. 2020, 382, 125–134. [Google Scholar] [CrossRef]
- Chakraborty, S.; Castranova, V.; Perez, M.K.; Piedimonte, G. Nanoparticles Increase Human Bronchial Epithelial Cell Susceptibility to Respiratory Syncytial Virus Infection via Nerve Growth Factor-Induced Autophagy. Physiol. Rep. 2017, 5, e13344. [Google Scholar] [CrossRef]
- Prakash, Y.; Thompson, M.A.; Meuchel, L.; Pabelick, C.M.; Mantilla, C.B.; Zaidi, S.; Martin, R.J. Neurotrophins in Lung Health and Disease. Expert Rev. Respir. Med. 2010, 4, 395–411. [Google Scholar] [CrossRef]
- Descamps, B.; Saif, J.; Benest, A.V.; Biglino, G.; Bates, D.O.; Chamorro-Jorganes, A.; Emanueli, C. BDNF (Brain-Derived Neurotrophic Factor) Promotes Embryonic Stem Cells Differentiation to Endothelial Cells Via a Molecular Pathway, Including MicroRNA-214, EZH2 (Enhancer of Zeste Homolog 2), and ENOS (Endothelial Nitric Oxide Synthase). Arterioscler. Thromb. Vasc. Biol. 2018, 38, 2117–2125. [Google Scholar] [CrossRef]
- Griffin, N.; Faulkner, S.; Jobling, P.; Hondermarck, H. Targeting Neurotrophin Signaling in Cancer: The Renaissance. Pharmacol. Res. 2018, 135, 12–17. [Google Scholar] [CrossRef]
- Comprehensive Molecular Profiling of Lung Adenocarcinoma. Nature 2014, 511, 543–550. [CrossRef] [PubMed]
- Okugawa, Y.; Tanaka, K.; Inoue, Y.; Kawamura, M.; Kawamoto, A.; Hiro, J.; Saigusa, S.; Toiyama, Y.; Ohi, M.; Uchida, K.; et al. Brain-Derived Neurotrophic Factor/Tropomyosin-Related Kinase B Pathway in Gastric Cancer. Br. J. Cancer 2013, 108, 121–130. [Google Scholar] [CrossRef] [PubMed]
- Tanaka, K.; Okugawa, Y.; Toiyama, Y.; Inoue, Y.; Saigusa, S.; Kawamura, M.; Araki, T.; Uchida, K.; Mohri, Y.; Kusunoki, M. Brain-Derived Neurotrophic Factor (BDNF)-Induced Tropomyosin-Related Kinase B (Trk B) Signaling Is a Potential Therapeutic Target for Peritoneal Carcinomatosis Arising from Colorectal Cancer. PLoS ONE 2014, 9, e96410. [Google Scholar] [CrossRef] [PubMed]
- Brierley, G.V.; Priebe, I.K.; Purins, L.; Fung, K.Y.C.; Tabor, B.; Lockett, T.; Nice, E.; Gibbs, P.; Tie, J.; McMurrick, P.; et al. Serum Concentrations of Brain-Derived Neurotrophic Factor (BDNF) Are Decreased in Colorectal Cancer Patients. Cancer Biomark. 2013, 13, 67–73. [Google Scholar] [CrossRef]
- Sarabi, M.; Perraud, A.; Mazouffre, C.; Nouaille, M.; Jauberteau, M.-O.; Mathonnet, M. Psychoactive Drugs Influence Brain-Derived Neurotrophic Factor and Neurotrophin 4/5 Levels in the Serum of Colorectal Cancer Patients. Biomed. Rep. 2017, 6, 89–94. [Google Scholar] [CrossRef]
- Pundavela, J.; Demont, Y.; Jobling, P.; Lincz, L.F.; Roselli, S.; Thorne, R.F.; Bond, D.; Bradshaw, R.A.; Walker, M.M.; Hondermarck, H. ProNGF Correlates with Gleason Score and Is a Potential Driver of Nerve Infiltration in Prostate Cancer. Am. J. Pathol. 2014, 184, 3156–3162. [Google Scholar] [CrossRef]
- Yu, X.; Liu, Z.; Hou, R.; Nie, Y.; Chen, R. Nerve Growth Factor and Its Receptors on Onset and Diagnosis of Ovarian Cancer. Oncol. Lett. 2017, 14, 2864–2868. [Google Scholar] [CrossRef]
- Faulkner, S.; Roselli, S.; Demont, Y.; Pundavela, J.; Choquet, G.; Leissner, P.; Oldmeadow, C.; Attia, J.; Walker, M.M.; Hondermarck, H. ProNGF Is a Potential Diagnostic Biomarker for Thyroid Cancer. Oncotarget 2016, 7, 28488. [Google Scholar] [CrossRef]
- Faulkner, S.; Jobling, P.; Rowe, C.W.; Oliveira, S.M.R.; Roselli, S.; Thorne, R.F.; Oldmeadow, C.; Attia, J.; Jiang, C.C.; Zhang, X.D.; et al. Neurotrophin Receptors TrkA, P75NTR, and Sortilin Are Increased and Targetable in Thyroid Cancer. Am. J. Pathol. 2018, 188, 229–241. [Google Scholar] [CrossRef]
- Gao, F.; Griffin, N.; Faulkner, S.; Rowe, C.W.; Williams, L.; Roselli, S.; Thorne, R.F.; Ferdoushi, A.; Jobling, P.; Walker, M.M.; et al. The Neurotrophic Tyrosine Kinase Receptor TrkA and Its Ligand NGF Are Increased in Squamous Cell Carcinomas of the Lung. Sci. Rep. 2018, 8, 8135. [Google Scholar] [CrossRef]
- Vaishnavi, A.; Capelletti, M.; Le, A.T.; Kako, S.; Butaney, M.; Ercan, D.; Mahale, S.; Davies, K.D.; Aisner, D.L.; Pilling, A.B.; et al. Oncogenic and Drug-Sensitive NTRK1 Rearrangements in Lung Cancer. Nat. Med. 2013, 19, 1469–1472. [Google Scholar] [CrossRef] [PubMed]
- Cocco, E.; Scaltriti, M.; Drilon, A. NTRK Fusion-Positive Cancers and TRK Inhibitor Therapy. Nat. Rev. Clin. Oncol. 2018, 15, 731–747. [Google Scholar] [CrossRef] [PubMed]
- Bailey, J.J.; Schirrmacher, R.; Farrell, K.; Bernard-Gauthier, V. Tropomyosin Receptor Kinase Inhibitors: An Updated Patent Review for 2010–2016—Part II. Expert Opin. Ther. Pat. 2017, 27, 831–849. [Google Scholar] [CrossRef] [PubMed]
- Bailey, J.J.; Jaworski, C.; Tung, D.; Wängler, C.; Wängler, B.; Schirrmacher, R. Tropomyosin Receptor Kinase Inhibitors: An Updated Patent Review for 2016–2019. Expert. Opin. Ther. Pat. 2020, 30, 325–339. [Google Scholar] [CrossRef]
- Jiang, Q.; Li, M.; Li, H.; Chen, L. Entrectinib, a New Multi-Target Inhibitor for Cancer Therapy. Biomed. Pharmacother. 2022, 150, 112974. [Google Scholar] [CrossRef]
- Manea, C.A.; Badiu, D.C.; Ploscaru, I.C.; Zgura, A.; Bacinschi, X.; Smarandache, C.G.; Serban, D.; Popescu, C.G.; Grigorean, V.T.; Botnarciuc, V. A Review of NTRK Fusions in Cancer. Ann. Med. Surg. 2022, 79, 103893. [Google Scholar] [CrossRef] [PubMed]
- Skaper, S.D. Neurotrophic Factors: An Overview. Methods Mol. Biol. 2018, 1727, 1–17. [Google Scholar] [CrossRef]
- Gentry, J.J.; Barker, P.A.; Carter, B.D. The P75 Neurotrophin Receptor: Multiple Interactors and Numerous Functions. Prog. Brain Res. 2004, 146, 25–39. [Google Scholar] [CrossRef]
- Malik, S.C.; Sozmen, E.G.; Baeza-Raja, B.; Le Moan, N.; Akassoglou, K.; Schachtrup, C. In Vivo Functions of P75NTR: Challenges and Opportunities for an Emerging Therapeutic Target. Trends Pharmacol. Sci. 2021, 42, 772–788. [Google Scholar] [CrossRef]
- Roux, P.P.; Barker, P.A. Neurotrophin Signaling through the P75 Neurotrophin Receptor. Prog. Neurobiol. 2002, 67, 203–233. [Google Scholar] [CrossRef]
- Goncharuk, S.A.; Artemieva, L.E.; Nadezhdin, K.D.; Arseniev, A.S.; Mineev, K.S. Revising the Mechanism of P75NTR Activation: Intrinsically Monomeric State of Death Domains Invokes the “Helper” Hypothesis. Sci. Rep. 2020, 10, 13686. [Google Scholar] [CrossRef] [PubMed]
- De la Cruz-Morcillo, M.A.; Berger, J.; Sánchez-Prieto, R.; Saada, S.; Naves, T.; Guillaudeau, A.; Perraud, A.; Sindou, P.; Lacroix, A.; Descazeaud, A.; et al. P75 Neurotrophin Receptor and Pro-BDNF Promote Cell Survival and Migration in Clear Cell Renal Cell Carcinoma. Oncotarget 2016, 7, 34480–34497. [Google Scholar] [CrossRef] [PubMed]
- Jin, H.; Pan, Y.; He, L.; Zhai, H.; Li, X.; Zhao, L.; Sun, L.; Liu, J.; Hong, L.; Song, J.; et al. P75 Neurotrophin Receptor Inhibits Invasion and Metastasis of Gastric Cancer. Mol. Cancer Res. 2007, 5, 423–433. [Google Scholar] [CrossRef] [PubMed]
- Franco, M.L.; Nadezhdin, K.D.; Light, T.P.; Goncharuk, S.A.; Soler-Lopez, A.; Ahmed, F.; Mineev, K.S.; Hristova, K.; Arseniev, A.S.; Vilar, M. Interaction between the Transmembrane Domains of Neurotrophin Receptors P75 and TrkA Mediates Their Reciprocal Activation. J. Biol. Chem. 2021, 297, 100926. [Google Scholar] [CrossRef] [PubMed]
- Schramm, A.; Schulte, J.H.; Astrahantseff, K.; Apostolov, O.; van Limpt, V.; Sieverts, H.; Kuhfittig-Kulle, S.; Pfeiffer, P.; Versteeg, R.; Eggert, A. Biological Effects of TrkA and TrkB Receptor Signaling in Neuroblastoma. Cancer Lett. 2005, 228, 143–153. [Google Scholar] [CrossRef] [PubMed]
- Perez-Pinera, P.; Hernandez, T.; García-Suárez, O.; de Carlos, F.; Germana, A.; Del Valle, M.; Astudillo, A.; Vega, J.A. The Trk Tyrosine Kinase Inhibitor K252a Regulates Growth of Lung Adenocarcinomas. Mol. Cell. Biochem. 2007, 295, 19–26. [Google Scholar] [CrossRef] [PubMed]
- Sinkevicius, K.W.; Kriegel, C.; Bellaria, K.J.; Lee, J.; Lau, A.N.; Leeman, K.T.; Zhou, P.; Beede, A.M.; Fillmore, C.M.; Caswell, D.; et al. Neurotrophin Receptor TrkB Promotes Lung Adenocarcinoma Metastasis. Proc. Natl. Acad. Sci. USA 2014, 111, 10299–10304. [Google Scholar] [CrossRef]
- Zhang, Z.X.; Yong, Y.; Tan, W.C.; Shen, L.; Ng, H.S.; Fong, K.Y. Prognostic Factors for Mortality Due to Pneumonia among Adults from Different Age Groups in Singapore and Mortality Predictions Based on PSI and CURB-65. Singap. Med. J. 2018, 59, 190–198. [Google Scholar] [CrossRef]
- Qiu, L.; Zhou, C.; Sun, Y.; Di, W.; Scheffler, E.; Healey, S.; Kouttab, N.; Chu, W.; Wan, Y. Crosstalk between EGFR and TrkB Enhances Ovarian Cancer Cell Migration and Proliferation. Int. J. Oncol. 2006, 29, 1003–1011. [Google Scholar] [CrossRef][Green Version]
- Ricci, A.; De Vitis, C.; Noto, A.; Fattore, L.; Mariotta, S.; Cherubini, E.; Roscilli, G.; Liguori, G.; Scognamiglio, G.; Rocco, G.; et al. TrkB Is Responsible for EMT Transition in Malignant Pleural Effusions Derived Cultures from Adenocarcinoma of the Lung. Cell Cycle 2013, 12, 1696–1703. [Google Scholar] [CrossRef][Green Version]
- Tessarollo, L.; Yanpallewar, S. TrkB Truncated Isoform Receptors as Transducers and Determinants of BDNF Functions. Front. Neurosci. 2022, 16, 847572. [Google Scholar] [CrossRef] [PubMed]
- Li, Z.; Chang, Z.; Chiao, L.J.; Kang, Y.; Xia, Q.; Zhu, C.; Fleming, J.B.; Evans, D.B.; Chiao, P.J. TrkBT1 Induces Liver Metastasis of Pancreatic Cancer Cells by Sequestering Rho GDP Dissociation Inhibitor and Promoting RhoA Activation. Cancer Res. 2009, 69, 7851–7859. [Google Scholar] [CrossRef] [PubMed]
- Lombardi, M.; D’Ascanio, M.; Scarpino, S.; Scozzi, D.; Giordano, M.; Costarelli, L.; Raj, E.R.; Mancini, R.; Cardillo, G.; Cardaci, V.; et al. Full-Length TrkB Variant in NSCLC Is Associated with Brain Metastasis. BioMed Res. Int. 2020, 2020, 4193541. [Google Scholar] [CrossRef]
- Wang, X.; Xu, Z.; Chen, X.; Ren, X.; Wei, J.; Zhou, S.; Yang, X.; Zeng, S.; Qian, L.; Wu, G.; et al. A Tropomyosin Receptor Kinase Family Protein, NTRK2 Is a Potential Predictive Biomarker for Lung Adenocarcinoma. PeerJ 2019, 7, e7125. [Google Scholar] [CrossRef] [PubMed]
- NTF3 Neurotrophin 3 [Homo Sapiens (Human)]—Gene—NCBI. Available online: https://www.ncbi.nlm.nih.gov/gene?Db=gene&Cmd=ShowDetailView&TermToSearch=4908 (accessed on 19 September 2022).
- Seo, E.; Kim, J.-S.; Ma, Y.E.; Cho, H.W.; Ju, H.Y.; Lee, S.H.; Lee, J.W.; Yoo, K.H.; Sung, K.W.; Koo, H.H. Differential Clinical Significance of Neurotrophin-3 Expression According to MYCN Amplification and TrkC Expression in Neuroblastoma. J. Korean Med. Sci. 2019, 34, e254. [Google Scholar] [CrossRef] [PubMed]
- Soda, M.; Choi, Y.L.; Enomoto, M.; Takada, S.; Yamashita, Y.; Ishikawa, S.; Fujiwara, S.; Watanabe, H.; Kurashina, K.; Hatanaka, H.; et al. Identification of the Transforming EML4-ALK Fusion Gene in Non-Small-Cell Lung Cancer. Nature 2007, 448, 561–566. [Google Scholar] [CrossRef]
- Niu, Y.; Lin, A.; Luo, P.; Zhu, W.; Wei, T.; Tang, R.; Guo, L.; Zhang, J. Prognosis of Lung Adenocarcinoma Patients With NTRK3 Mutations to Immune Checkpoint Inhibitors. Front. Pharmacol. 2020, 11, 1213. [Google Scholar] [CrossRef]
- Delgado, J.; Pean, E.; Melchiorri, D.; Migali, C.; Josephson, F.; Enzmann, H.; Pignatti, F. The European Medicines Agency Review of Entrectinib for the Treatment of Adult or Paediatric Patients with Solid Tumours Who Have a Neurotrophic Tyrosine Receptor Kinase Gene Fusions and Adult Patients with Non-Small-Cell Lung Cancer Harbouring ROS1 Rearrangements. ESMO Open 2021, 6, 100087. [Google Scholar] [CrossRef]
- Doebele, R.C.; Drilon, A.; Paz-Ares, L.; Siena, S.; Shaw, A.T.; Farago, A.F.; Blakely, C.M.; Seto, T.; Cho, B.C.; Tosi, D.; et al. Entrectinib in Patients with Advanced or Metastatic NTRK Fusion-Positive Solid Tumours: Integrated Analysis of Three Phase 1–2 Trials. Lancet Oncol. 2020, 21, 271–282. [Google Scholar] [CrossRef]
- Frampton, J.E. Entrectinib: A Review in NTRK + Solid Tumours and ROS1 + NSCLC. Drugs 2021, 81, 697–708. [Google Scholar] [CrossRef]
- Drilon, A.; Laetsch, T.W.; Kummar, S.; DuBois, S.G.; Lassen, U.N.; Demetri, G.D.; Nathenson, M.; Doebele, R.C.; Farago, A.F.; Pappo, A.S.; et al. Efficacy of Larotrectinib in TRK Fusion—Positive Cancers in Adults and Children. N. Engl. J. Med. 2018, 378, 731–739. [Google Scholar] [CrossRef] [PubMed]
- Hong, D.S.; DuBois, S.G.; Kummar, S.; Farago, A.F.; Albert, C.M.; Rohrberg, K.S.; van Tilburg, C.M.; Nagasubramanian, R.; Berlin, J.D.; Federman, N.; et al. Larotrectinib in Patients with TRK Fusion-Positive Solid Tumours: A Pooled Analysis of Three Phase 1/2 Clinical Trials. Lancet Oncol. 2020, 21, 531–540. [Google Scholar] [CrossRef]
- Desai, A.; Menon, S.P.; Dy, G.K. Alterations in Genes Other than EGFR/ALK/ROS1 in Non-Small Cell Lung Cancer: Trials and Treatment Options. Cancer Biol. Med. 2016, 13, 77–86. [Google Scholar] [CrossRef] [PubMed]
- Gentles, A.J.; Hui, A.B.-Y.; Feng, W.; Azizi, A.; Nair, R.V.; Bouchard, G.; Knowles, D.A.; Yu, A.; Jeong, Y.; Bejnood, A.; et al. A Human Lung Tumor Microenvironment Interactome Identifies Clinically Relevant Cell-Type Cross-Talk. Genome Biol. 2020, 21, 107. [Google Scholar] [CrossRef] [PubMed]
- Feng, Q.; Song, D.; Wang, X. Pan-Cancer Analysis Reveals That Neurotrophin Signaling Correlates Positively with Anti-Tumor Immunity, Clinical Outcomes, and Response to Targeted Therapies and Immunotherapies in Cancer. Life Sci. 2021, 282, 119848. [Google Scholar] [CrossRef]
- Triaca, V.; Carito, V.; Fico, E.; Rosso, P.; Fiore, M.; Ralli, M.; Lambiase, A.; Greco, A.; Tirassa, P. Cancer Stem Cells-Driven Tumor Growth and Immune Escape: The Janus Face of Neurotrophins. Aging 2019, 11, 11770–11792. [Google Scholar] [CrossRef]
- Zhu, Y.; Zhang, C.; Zhao, D.; Li, W.; Zhao, Z.; Yao, S.; Zhao, D. BDNF Acts as a Prognostic Factor Associated with Tumor-Infiltrating Th2 Cells in Pancreatic Adenocarcinoma. Dis. Mark. 2021, 2021, 7842035. [Google Scholar] [CrossRef]
- Amatu, A.; Sartore-Bianchi, A.; Siena, S. NTRK Gene Fusions as Novel Targets of Cancer Therapy across Multiple Tumour Types. ESMO Open 2016, 1, e000023. [Google Scholar] [CrossRef]
- Harada, G.; Gongora, A.B.L.; da Costa, C.M.; Santini, F.C. TRK Inhibitors in Non-Small Cell Lung Cancer. Curr. Treat. Options Oncol. 2020, 21, 39. [Google Scholar] [CrossRef]
- Liu, F.; Wei, Y.; Zhang, H.; Jiang, J.; Zhang, P.; Chu, Q. NTRK Fusion in Non-Small Cell Lung Cancer: Diagnosis, Therapy, and TRK Inhibitor Resistance. Front. Oncol. 2022, 12, 864666. [Google Scholar] [CrossRef]
| ((genomic OR gene) AND (profiling OR fusion OR rearrangement)) AND Lung AND cancer NOT (review[ptyp]) |
| NGF or BDNF or NT-3 AND Lung AND cancer |
| TrkA or TrkB or TrkC or p75 AND Lung AND cancer |
| ((genomic OR gene) AND (profiling OR fusion OR rearrangement)) AND (“lung cancer” OR “lung adenocarcinoma”) NOT (review[ptyp]) |
| ((genomic OR gene) AND (profiling OR fusion OR rearrangement)) AND cancer NOT (review[ptyp]) |
| (TRK or NTRK or NTRK1 or NTRK2 or NTRK3 or tropomyosin) AND (fusion or rearrangement) NOT (review[ptyp])) |
| RT-PCR | Primers |
|---|---|
| NGF | 5′CGCTCATCC-ATCCCATCCCATCTTC, 3′CTTGACAAGGTGTGAGTCGTGGT |
| BDNF | 5′AGGGTTCCGGCGCCACTCCTGACCCT, 3′CTTCAGTTGGCCTTTGTGATACCAGG |
| NT-3 | 5′CGAAACGCGTATCGCAGGAGCATAAG, 3′GTTTTTGACTCGGCCTGGCTTCTCTT |
| TrkA | 5′TCTTCACTGAGTTCCTGGAG, 3′TTCTCCACCGGGTCTCCAGA |
| TrkB-FL | 5′TCTTCACTGAGTTCCTGGAG, 3′TTCTCCACCGGGTCTCCAGA |
| TrkB. [TR-] | 5′TAAAACCGGTCGGGAACATC, 3′ACCCATCCAGTGGGATCTTA |
| TrkC | 5′CATCCATGTGGAATACTACC, 3′TGGGTCACAGTGATAGGAGG |
| p75 | 5′AGCCCAC-CAGACCGTGTGTG, 3′TTGCAGCTGTTCCACCTCTT |
| Immunohistochemistry | Antibodies | Company |
|---|---|---|
| NGF | rabbit anti-NGF polyclonal antibody | c-548; Santa Cruz Biotechnology, Santa Cruz, CA, USA |
| BDNF | rabbit polyclonal antibody anti-BDNF | sc-546; Santa Cruz Biotechnology, Santa Cruz, CA, USA |
| NT-3 | rabbit polyclonal antibody anti NT-3 | c-547; SantaCruz Biotechnology, Santa Cruz, CA, USA |
| TrkA | rabbit polyclonal TrkA immunoglobulin | sc-118; Santa Cruz Biotechnology, Santa Cruz, CA, USA |
| TrkB-FL | rabbit polyclonal TrkB immunoglobulin | sc-012; Santa Cruz Biotechnology, Santa Cruz, CA, USA |
| TrkB. [TR-] | rabbit polyclonal TrkB [TK-] immunoglobulin | sc-119; Santa Cruz Biotechnology, Santa Cruz, CA, USA |
| TrkC | rabbit polyclonal TrkC immunoglobulin | c-117; Santa Cruz, Biotechnology, Santa Cruz, CA, USA |
| p75 | goat polyclonal antibody to human p75 NT receptor | sc-6188; Santa Cruz Biotechnology, Santa Cruz, CA, USA |
| Study Name | Phase | Inhibitors | Population with NTRK-Fusion Positive Solid Tumors | Enrollment (n) |
|---|---|---|---|---|
| NAVIGATE (NCT02576431) | II | Larotrectinib | Adults and children | 320 patients |
| STARTRK-2 (NCT02568267) | II | Entrectinib | NTRK-, ROS1- and ALK-fusion positive | 300 patients |
| NCT01639508 | I | Cabozantinib | NTRK fusion, or MET or AXL overexpression, amplification, or mutation | 68 patients |
| NCT03215511 | I/II | Selitrectinib | Adult and pediatric | 93 patients |
| TRIDENT-1 (NCT03093116) | I/II | Repotrectinib | NTRK-, ROS1- and ALK-fusion positive | 450 patients |
| NCT02675491 | I | DS-6051b | NTRK- or ROS1-fusion positive s | 15 patients |
| NCT01804530 | I | PLX7486 | NTRK-fusion positive | 59 patients-discontinued |
| NCT02920996 | II | Merestinib | NTRK-fusion positive or MET-mutation NSCLC | 25 patients |
| NCT03556228 | I | VMD-928 | NTRK1 alterations, including fusions, positive | 54 patients |
| NCT02219711 | I | Sitravatinib | NTRK-fusion positive NSCLC | 260 patients |
| Study | Histopathology | Frequency | NTRK | Fusion Partner(s) | Detection |
|---|---|---|---|---|---|
| Farago, 2018 [53] | NSCLC | 0.23% | NTRK1, NTRK3 | SQSTM1,TPR, IRF2BP2, TM3, MPRIP, ETV6 | DNA NGS, RNA NGS or FISH |
| Vaishnavi, 2013 [50] | ADK without oncogenic drivers | 3.3% | NTRK1 | MPRIP, CD74 | DNA NGS or FISH |
| Stranniki, 2014 [54] | ADK | 0.19% | NTRK2 | TRIM24 | RNA sequencing |
| Miyamoto, 2019 [36] | Non-SqCC NSCLC | 0.05% | NTRK3 | Not reported | RT-PCR and NGS |
| Gatalica, 2018 [55] | ADK | 0.1% | NTRK1-3 | TPM3, SQSTM1, ETV6 | DNA and RNA NGS & IHC |
| Ou, 2019 [56] | NSCLC | 0.1% | NTRK1-3 | IRF2BP2, TPM3, and others | DNA NGS |
| Xia, 2019 [57] | NSCLC | 0.056% | NTRK1 | CD74, IRF2BP2, LMNA, PHF20, SQSTM1, TPM3, TRP | DNA NGS |
| Histology | DNA Rearrangement | RNA Fusion |
|---|---|---|
| ADK | C14orf2-NTRK1 (intergenic: intron 11) | KIF5B-RET (exon 15–exon 12) |
| RRNAD1-NTRK1 (UTR3-exon 15) | TPM3-NTRK1(exon 8–exon 10) | |
| NTRK1-NBPF25P (intron 8-intergenic) | TPM3-NTRK1(exon 8–exon 10) | |
| NTRK1-ARHGEF11 (exon 17: intron 1) | SQSTM1-NTRK2 (exon 4–exon 15) | |
| NTRK1-FMN2 (intron 11: intron 16) | KIF5B-NTRK2 (exon 24–exon 15) | |
| TPM3-NTRK1 (intron 8: exon 9) | ||
| TPM3-NTRK1 (intron 8: intron 9) | ||
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ricci, A.; Salvucci, C.; Castelli, S.; Carraturo, A.; de Vitis, C.; D’Ascanio, M. Adenocarcinomas of the Lung and Neurotrophin System: A Review. Biomedicines 2022, 10, 2531. https://doi.org/10.3390/biomedicines10102531
Ricci A, Salvucci C, Castelli S, Carraturo A, de Vitis C, D’Ascanio M. Adenocarcinomas of the Lung and Neurotrophin System: A Review. Biomedicines. 2022; 10(10):2531. https://doi.org/10.3390/biomedicines10102531
Chicago/Turabian StyleRicci, Alberto, Claudia Salvucci, Silvia Castelli, Antonella Carraturo, Claudia de Vitis, and Michela D’Ascanio. 2022. "Adenocarcinomas of the Lung and Neurotrophin System: A Review" Biomedicines 10, no. 10: 2531. https://doi.org/10.3390/biomedicines10102531
APA StyleRicci, A., Salvucci, C., Castelli, S., Carraturo, A., de Vitis, C., & D’Ascanio, M. (2022). Adenocarcinomas of the Lung and Neurotrophin System: A Review. Biomedicines, 10(10), 2531. https://doi.org/10.3390/biomedicines10102531

