Thrips as the Transmission Bottleneck for Mixed Infection of Two Orthotospoviruses
Abstract
1. Introduction
2. Results
2.1. Frankliniella occidentalis Oviposits Preferentially on INSV and TSWV Mixed-Infected Leaves
2.2. INSV Is Preferentially Acquired and Transmitted from Singly and Mixed-Infected Plants
3. Discussion
4. Materials and Methods
4.1. Thrips Maintenance
4.2. Orthotospoviruses and Their Maintenance
4.3. Dual Choice Tests
4.4. Thrips Egg Staining
4.5. Volatile Collection and Analyses
4.6. Virus Acquisition and Retention Assay
4.7. Transmission Assay
4.8. Data Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Pappu, H.R.; Jones, R.A.C.; Jain, R.K. Global status of tospovirus epidemics in diverse cropping systems: Successes achieved and challenges ahead. Virus Res. 2009, 141, 219–236. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Law, M.D.; Moyer, J.W. A tomato spotted wilt-like virus with a serologically distinct N protein. J. Gen. Virol. 1990, 71, 933–938. [Google Scholar] [CrossRef] [Scilit]
- De Avila, A.C.; De Haan, P.; Kitajima, E.W.; Kormelink, R.; Resende, R.D.O.; Goldbach, R.W.; Peters, D. Characterization of a distinct isolate of Tomato spotted wilt virus (TSWV) from Impatiens sp. in the Netherlands. J. Phytopathol. 1992, 134, 133–151. [Google Scholar] [CrossRef] [Scilit]
- Mound, L.A. So many thrips-so few tospoviruses. In Thrips and tospoviruses: Proceedings of the 7th International Symposium on Thysanoptera; Australian National Insect Collection: Canberra, Australia, 2002; pp. 15–18. [Google Scholar]
- Rotenberg, D.; Jacobson, A.L.; Schneweis, D.J.; Whitfield, A.E. Thrips transmission of tospoviruses. Curr. Opin. Virol. 2015, 15, 80–89. [Google Scholar] [CrossRef] [Scilit]
- Ohnishi, J.; Katsuzaki, H.; Tsuda, S.; Sakurai, T.; Akutsu, K.; Murai, T. Frankliniella cephalica, a new vector for Tomato spotted wilt virus. Plant Dis. 2006, 90, 685. [Google Scholar] [CrossRef] [Scilit]
- Avila, Y.; Stavisky, J.; Hague, S.; Funderburk, J.; Reitz, S.; Momol, T. Evaluation of Frankliniella bispinosa (Thysanoptera: Thripidae) as a vector of the Tomato spotted wilt virus in pepper. Fla. Entomol. 2006, 89, 204–207. [Google Scholar] [CrossRef] [Scilit]
- Ullman, D.E.; Sherwood, J.L.; German, T.L. Thrips as Vectors of Plant Pathogens; CAB International: Wallingford, UK, 1997; pp. 539–565. [Google Scholar]
- Naidu, R.A.; Deom, C.M.; Sherwood, J.L. First report of Frankliniella fusca as a vector of Impatiens necrotic spot tospovirus. Plant Dis. 2001, 85, 1211. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hogenhout, S.A.; Ammar, E.D.; Whitfield, A.E.; Redinbaugh, M.G. Insect vector interactions with persistently transmitted viruses. Annu. Rev. Phytopathol. 2008, 46, 327–359. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vance, V.B. Replication of potato virus X RNA is altered in coinfections with potato virus Y. Virology 1991, 182, 486–494. [Google Scholar]
- Syller, J.; Grupa, A. Antagonistic within-host interactions between plant viruses: Molecular basis and impact on viral and host fitness. Mol. Plant Pathol. 2016, 17, 769–782. [Google Scholar] [CrossRef] [Scilit]
- Sialer, M.F.; Gallitelli, D. The occurrence of Impatiens necrotic spot virus and Tomato spotted wilt virus in mixed infection in tomato. J. Plant Pathol. 2000, 82, 244. [Google Scholar]
- Martinez-Ochoa, N.; Csinos, A.S.; Whitty, E.B.; Johnson, A.W.; Parrish, M.J. First Report on the Incidence of Mixed Infections of Impatiens necrotic spot virus (INSV) and Tomato spotted wilt virus (TSWV) in Tobacco Grown in Georgia, South Carolina, and Virginia. Plant Health Prog. 2003, 4, 40. [Google Scholar] [CrossRef] [Scilit]
- Eigenbrode, S.D.; Ding, H.; Shiel, P.; Berger, P.H. Volatiles from potato plants infected with Potato leafroll virus attract and arrest the virus vector, Myzus persicae (Homoptera, Aphididae). Proc. R. Soc. Lond. Ser. B 2002, 269, 455–460. [Google Scholar] [CrossRef] [Scilit]
- Hurd, H. Manipulation of medically important insect vectors by their parasites. Ann. Rev. Entomol. 2003, 48, 141–161. [Google Scholar] [CrossRef] [Scilit]
- Belliure, B.; Janssen, A.; Maris, P.C.; Peters, D.; Sabelis, M.W. Herbivore arthropods benefit from vectoring plant viruses. Ecol. Lett. 2005, 8, 70–79. [Google Scholar] [CrossRef] [Scilit]
- Abe, H.; Ohnishi, J.; Narusaka, M.; Seo, S.; Narusaka, Y.; Tsuda, S.; Kobayashi, M. Function of jasmonate in response and tolerance of Arabidopsis to thrip feeding. Plant Cell Physiol. 2008, 49, 68–80. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Abe, H.; Shimoda, T.; Ohnishi, J.; Kugimiya, S.; Narusaka, M.; Seo, S.; Kobayashi, M. Jasmonate-dependent plant defense restricts thrips performance and preference. BMC Plant Biol. 2009, 9, 97. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Abe, H.; Tomitaka, Y.; Shimoda, T.; Seo, S.; Sakurai, T.; Kugimiya, S.; Kobayashi, M. Antagonistic plant defense system regulated by phytohormones assists interactions among vector insect, thrips and a tospovirus. Plant Cell Physiol. 2011, 53, 204–212. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, X.; Xu, S.; Zhao, P.; Zhang, X.; Yao, X.; Sun, Y.; Ye, J. The Orthotospovirus nonstructural protein NSs suppresses plant MYC-regulated jasmonate signaling leading to enhanced vector attraction and performance. PLoS Pathog. 2019, 15, e1007897. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kazan, K.; Manners, J.M. MYC2: The master in action. Mol. Plant 2013, 6, 686–703. [Google Scholar] [CrossRef] [Scilit]
- Wasternack, C.; Hause, B. Jasmonates: Biosynthesis, perception, signal transduction and action in plant stress response, growth and development. An update to the 2007 review in Annals of Botany. Ann. Bot. 2013, 111, 1021–1058. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Maris, P.C.; Joosten, N.N.; Goldbach, R.W.; Peters, D. Tomato spotted wilt virus infection improves host suitability for its vector Frankliniella occidentalis. Phytopathology 2004, 94, 706–711. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bautista, R.C.; Mau, R.F.; Cho, J.J.; Custer, D.M. Potential of tomato spotted wilt tospovirus plant hosts in Hawaii as virus reservoirs for transmission by Frankliniella occidentalis (Thysanoptera: Thripidae). Development 1995, 15, 32. [Google Scholar]
- Stafford, C.A.; Walker, G.P.; Ullman, D.E. Infection with a plant virus modifies vector feeding behavior. Proc. Natl. Acad. Sci. USA 2011, 108, 9350–9355. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Moreno-Delafuente, A.; Garzo, E.; Moreno, A.; Fereres, A. A plant virus manipulates the behavior of its whitefly vector to enhance its transmission efficiency and spread. PLoS ONE 2013, 8, e61543. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wargo, A.R.; Kurath, G. Viral fitness: Definitions, measurement, and current insights. Curr. Opin. Virol. 2012, 2, 538–545. [Google Scholar] [CrossRef] [Scilit]
- Forrester, N.L.; Guerbois, M.; Seymour, R.L.; Spratt, H.; Weaver, S.C. Vector-borne transmission imposes a severe bottleneck on an RNA virus population. PLoS Pathog. 2012, 8, e1002897. [Google Scholar] [CrossRef] [Scilit]
- Briese, T.; Calisher, C.H.; Higgs, S. Viruses of the family Bunyaviridae: Are all available isolates reassortants? Virology 2013, 446, 207–216. [Google Scholar] [CrossRef] [Scilit]
- Qiu, W.; Moyer, J.W. Tomato spotted wilt tospovirus adapts to the TSWV N gene-derived resistance by genome reassortment. Phytopathology 1999, 89, 575–582. [Google Scholar] [CrossRef] [Scilit]
- Rodriguez, L.L.; Owens, J.H.; Peters, C.J.; Nichol, S.T. Genetic reassortment among viruses causing hantavirus pulmonary syndrome. Virology 1998, 242, 99–106. [Google Scholar] [CrossRef] [Scilit]
- McElroy, A.K.; Smith, J.M.; Hooper, J.W.; Schmaljohn, C.S. Andes virus M genome segment is not sufficient to confer the virulence associated with Andes virus in Syrian hamsters. Virology 2004, 326, 130–139. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Webster, C.G.; Reitz, S.R.; Perry, K.L.; Adkins, S. A natural M RNA reassortant arising from two species of plant-and insect-infecting bunyaviruses and comparison of its sequence and biological properties to parental species. Virology 2011, 413, 216–225. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Webster, C.G.; Frantz, G.; Reitz, S.R.; Funderburk, J.E.; Mellinger, H.C.; McAvoy, E.; Daughtrey, M.L. Emergence of Groundnut ringspot virus and Tomato chlorotic spot virus in vegetables in Florida and the southeastern United States. Phytopathology 2015, 105, 388–398. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Adegbola, R.O.; Marshall, S.H.; Batuman, O.; Ullman, D.E.; Gilbertson, R.L.; Adkins, S.; Naidu, R.A. Sequence analysis of the medium and small RNAs of impatiens necrotic spot virus reveals segment reassortment but not recombination. Arch. Virol. 2019, 164, 2829–2836. [Google Scholar] [CrossRef] [Scilit]
- Pfeiffer, J.K.; Kirkegaard, K. Bottleneck-mediated quasispecies restriction during spread of an RNA virus from inoculation site to brain. Proc. Natl. Acad. Sci. USA 2006, 103, 5520–5525. [Google Scholar] [CrossRef] [Scilit]
- Gutiérrez, S.; Michalakis, Y.; Blanc, S. Virus population bottlenecks during within-host progression and host-to-host transmission. Curr. Opin. Virol. 2012, 2, 546–555. [Google Scholar] [CrossRef] [Scilit]
- Salvaudon, L.; De Moraes, C.M.; Mescher, M.C. Outcomes of co-infection by two potyviruses: Implications for the evolution of manipulative strategies. Proc. R. Soc. B Biol. Sci. 2013, 280, 20122959. [Google Scholar] [CrossRef] [Scilit]
- McCrone, J.T.; Lauring, A.S. Genetic bottlenecks in intraspecies virus transmission. Curr. Opin. Virol. 2018, 28, 20–25. [Google Scholar] [CrossRef] [Scilit]
- Ozawa, R.; Shiojiri, K.; Matsui, K.; Takabayashi, J. Intermittent exposure to traces of green leaf volatiles triggers the production of (Z)-3-hexen-1-yl acetate and (Z)-3-hexen-1-ol in exposed plants. Plant Signal. Behav. 2013, 8, e27013. [Google Scholar] [CrossRef] [Scilit]
- Mann, R.S.; Qureshi, J.A.; Stansly, P.A.; Stelinski, L.L. Behavioral response of Tamarixia radiata (Waterston) (Hymenoptera: Eulophidae) to volatiles emanating from Diaphorina citri Kuwayama (Hemiptera: Psyllidae) and citrus. J. Insect Behav. 2010, 23, 447–458. [Google Scholar] [CrossRef] [Scilit]
- Lin, Y.; Lin, S.; Akutse, K.S.; Hussain, M.; Wang, L. Diaphorina citri Induces Huanglongbing-Infected Citrus Plant Volatiles to Repel and Reduce the Performance of Propylaea japonica. Front. Plant Sci. 2016, 7, 1969. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hijaz, F.; Nehela, Y.; Killiny, N. Possible role of plant volatiles in tolerance against huanglongbing in citrus. Plant Signal. Behav. 2016, 11, e1138193. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhu, J.; Park, K.C. Methyl salicylate, a soybean aphid-induced plant volatile attractive to the predator Coccinella septempunctata. J. Chem. Ecol. 2005, 31, 1733–1746. [Google Scholar] [CrossRef] [Scilit]
- James, D.G. Field evaluation of herbivore-induced plant volatiles as attractants for beneficial insects: Methyl salicylate and the green lacewing, Chrysopa nigricornis. J. Chem. Ecol. 2003, 29, 1601–1609. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bilder, C.R.; Zhang, B.; Schaarschmidt, F.; Tebbs, J.M. binGroup: A package for group testing. R J. 2010, 2, 56. [Google Scholar] [CrossRef] [Scilit]
- Mainali, B.P.; Lim, U.T. Behavioral response of western flower thrips to visual and olfactory cues. J. Insect Behav. 2011, 24, 436–446. [Google Scholar] [CrossRef] [Scilit]
- Alonso, A.; Vázquez-Araújo, L.; García-Martínez, S.; Ruiz, J.J.; Carbonell-Barrachina, Á.A. Volatile compounds of traditional and virus-resistant breeding lines of Muchamiel tomatoes. Eur. Food Res. Technol. 2009, 230, 315–323. [Google Scholar] [CrossRef] [Scilit]
- Rodríguez-Burruezo, A.; Kollmannsberger, H.; González-Mas, M.C.; Nitz, S.; Fernando, N. HS-SPME comparative analysis of genotypic diversity in the volatile fraction and aroma-contributing compounds of Capsicum fruits from the Annuum−Chinense−Frutescens complex. J. Agric. Food Chem. 2010, 58, 4388–4400. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wilson, C.R.; Davies, N.W.; Corkrey, R.; Wilson, A.J.; Mathews, A.M.; Westmore, G.C. Receiver Operating Characteristic curve analysis determines association of individual potato foliage volatiles with onion thrips preference, cultivar and plant age. PLoS ONE 2017, 12, e0181831. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wijkamp, I.; Peters, D. Determination of the median latentperiod of two tospoviruses in Frankliniella occidentalis, using a novelleaf disk assay. Phytopathology 1993, 83, 986–991. [Google Scholar] [CrossRef] [Scilit]
- Wijkamp, J.; Goldbach, R.; Peters, D. Differential susceptibilities between leaf disks and plants in the transmission of Tomato spotted wilt virus by Frankliniella occidentalis to TSWV hosts and transgenic plants. J. Phytopathol. 1996, 144, 355–362. [Google Scholar] [CrossRef] [Scilit]
- Jan de Kogel, W.; van der Hoek, M.; Mollema, C. Oviposition preference of western flower thrips for cucumber leaves from different positions along the plant stem. Entomol. Exp. Appl. 1997, 82, 283–288. [Google Scholar] [CrossRef] [Scilit]
- Thoen, M.P.; Kloth, K.J.; Wiegers, G.L.; Krips, O.E.; Noldus, L.P.; Dicke, M.; Jongsma, M.A. Automated video tracking of thrips behavior to assess host-plant resistance in multiple parallel two-choice setups. Plant Methods 2016, 12, 1. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shalileh, S.; Ogada, P.A.; Moualeu, D.P.; Poehling, H.M. Manipulation of Frankliniella occidentalis (Thysanoptera: Thripidae) by Tomato Spotted Wilt Virus (Tospovirus) via the host plant nutrients to enhance its transmission and spread. Environ. Entomol. 2016, 45, 1235–1242. [Google Scholar] [CrossRef] [Scilit]
- Ben-Mahmoud, S.; Anderson, T.; Chappell, T.M.; Smeda, J.R.; Mutschler, M.A.; Kennedy, G.G.; Ullman, D.E. A thrips vector of tomato spotted wilt virus responds to tomato acylsugar chemical diversity with reduced oviposition and virus inoculation. Sci. Rep. 2019, 9, 17157. [Google Scholar] [CrossRef] [Scilit]
- Chen, Y.; Dessau, M.; Rotenberg, D.; Rasmussen, D.A.; Whitfield, A.E. Entry of bunyaviruses into plants and vectors. Adv. Virus Res. 2019, 104, 65–96. [Google Scholar]
- Kormelink, R.; Garcia, M.L.; Goodin, M.; Sasaya, T.; Haenni, A.L. Negative-strand RNA viruses: The plant-infecting counterparts. Virus Res. 2011, 162, 184–202. [Google Scholar] [CrossRef] [Scilit]
- Montero-Astúa, M.; Ullman, D.E.; Whitfield, A.E. Salivary gland morphology, tissue tropism and the progression of tospovirus infection in Frankliniella occidentalis. Virology 2016, 493, 39–51. [Google Scholar] [CrossRef] [Scilit]
- Whitfield, A.E.; Ullman, D.E.; German, T.L. Expression and characterization of a soluble form of tomato spotted wilt virus glycoprotein GN. J. Virol. 2004, 78, 13197–13206. [Google Scholar] [CrossRef] [Scilit]
- Whitfield, A.E.; Kumar, N.K.K.; Rotenberg, D.; Ullman, D.E.; Wyman, E.A.; Zietlow, C.; German, T.L. A soluble form of the Tomato spotted wilt virus (TSWV) glycoprotein GN (GN-S) inhibits transmission of TSWV by Frankliniella occidentalis. Phytopathology 2008, 98, 45–50. [Google Scholar] [CrossRef] [Scilit]
- Montero-Astúa, M.; Rotenberg, D.; Leach-Kieffaber, A.; Schneweis, B.A.; Park, S.; Park, J.K.; Whitfield, A.E. Disruption of vector transmission by a plant-expressed viral glycoprotein. Mol. Plant-Microbe Interact. 2014, 27, 296–304. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ullman, D.E.; Cho, J.J.; Mau, R.F.L.; Westcot, D.M.; Custer, D.M. A midgut barrier to Tomato spotted wilt virus acquisition by adult western flower thrips. Phytopathology 1992, 82, 1333–1342. [Google Scholar] [CrossRef] [Scilit]
- Margaria, P.; Rosa, C. First complete genome sequence of a tomato spotted wilt virus isolate from the United States and its relationship to other TSWV isolates of different geographic origin. Arch. Virol. 2015, 160, 2915–2920. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhao, K.; Margaria, P.; Rosa, C. Characterization of the first complete genome sequence of an Impatiens necrotic spot orthotospovirus isolate from the United States and worldwide phylogenetic analyses of INSV isolates. BMC Res. Notes 2018, 11, 288. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Outchkourov, N.S.; De Kogel, W.J.; Schuurman-de Bruin, A.; Abrahamson, M.; Jongsma, M.A. Specific cysteine protease inhibitors act as deterrents of western flower thrips, Frankliniella occidentalis (Pergande), in transgenic potato. Plant Biotechnol. J. 2004, 2, 439–448. [Google Scholar] [CrossRef] [Scilit]
- Backus, E.A.; Hunter, W.B.; Arne, C.N. Technique for staining leafhopper (Homoptera: Cicadellidae) salivary sheaths and eggs within unsectioned plant tissue. J. Econ. Entomol. 1988, 81, 1819–1823. [Google Scholar] [CrossRef] [Scilit]
- Richards, J.; Carr-Markell, M.; Hefetz, A.; Grozinger, C.M.; Mattila, H.R. Queen-produced volatiles change dynamically during reproductive swarming and are associated with changes in honey bee (Apis mellifera) worker behavior. Apidologie 2015, 46, 679–690. [Google Scholar] [CrossRef] [Scilit]
- Team, R.C. R: A Language and Environment for Statistical Computing; R Development Core Team: Vienna, Austria, 2013. [Google Scholar]
- Wijkamp, I.; van Lent, J.; Kormelink, R.; Goldbach, R.; Peters, D. Multiplication of tomato spotted wilt virus in its insect vector, Frankliniella occidentalis. J. Gen. Virol. 1993, 74, 341–349. [Google Scholar] [CrossRef] [Scilit]
- Iroegbu, C.U.; Pringle, C.R. Genetic interactions among viruses of the Bunyamwera complex. J. Virol. 1981, 37, 383–394. [Google Scholar] [CrossRef] [Scilit]



| Primer | Sequence (5′–3′) |
|---|---|
| TSWV-L-Forward | TCTCCACCTCGCTTCTTTGT |
| TSWV-L-Reverse | AAACAAAGGGATGGCAACTG |
| INSV-L-Forward | AGAGAGGACCACCCTTGGAT |
| INSV-L-Reverse | ATGTTCGGTGAGCTGGTTTC |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhao, K.; Rosa, C. Thrips as the Transmission Bottleneck for Mixed Infection of Two Orthotospoviruses. Plants 2020, 9, 509. https://doi.org/10.3390/plants9040509
Zhao K, Rosa C. Thrips as the Transmission Bottleneck for Mixed Infection of Two Orthotospoviruses. Plants. 2020; 9(4):509. https://doi.org/10.3390/plants9040509
Chicago/Turabian StyleZhao, Kaixi, and Cristina Rosa. 2020. "Thrips as the Transmission Bottleneck for Mixed Infection of Two Orthotospoviruses" Plants 9, no. 4: 509. https://doi.org/10.3390/plants9040509
APA StyleZhao, K., & Rosa, C. (2020). Thrips as the Transmission Bottleneck for Mixed Infection of Two Orthotospoviruses. Plants, 9(4), 509. https://doi.org/10.3390/plants9040509

