Characterization of Organic Acid Metabolism and Expression of Related Genes During Fruit Development of Actinidia eriantha ‘Ganmi 6’
Abstract
1. Introduction
2. Results
2.1. Quinic Acid and Citric Acid Were the Main Organic Acids in the Fruit of ‘Ganmi 6’
2.2. Analysis of Activities of Quinic Acid and Citric Acid-Related Enzyme
2.3. Quantitative Real-Time PCR Analysis of Quinic Acid and Citric Acid Metabolism Enzyme Gene
2.4. Correlation Analysis of Major Organic Acids Content, Related Enzyme Activities and Gene Expression
3. Discussion
4. Materials and Methods
4.1. Plant Materials
4.2. Extraction and Determination of Organic Acids
4.3. Determination of Enzyme Activity
4.4. Total RNA Extraction and Quantitative Real-Time PCR Analysis
4.5. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Huang, H.W.; Ferguson, A.R. Actinidia in China: Natural diversity, phylogeographical evolution, interspecific gene flow and kiwifruit cultivar improvement. Acta Hortic. 2007, 753, 31–40. [Google Scholar] [CrossRef] [Scilit]
- Du, G.R.; Li, M.J.; Ma, F.W.; Liang, D. Antioxidant capacity and the relationship with polyphenol and Vitamin C in Actinidia fruits. Food Chem. 2009, 113, 557–562. [Google Scholar] [CrossRef] [Scilit]
- Li, J.Q.; Li, X.W.; Soejarto, D.D. A revision of the genus Actinidia from China. Acta Hortic. 2007, 753, 41–44. [Google Scholar] [CrossRef] [Scilit]
- Zhong, C.H.; Zhang, P.; Jiang, Z.W.; Wang, S.M.; Han, F.; Xu, L.Y.; Huang, H.W. Dynamic changes of carbohydrate and Vitamin C in fruits of Actinidia chinensis and A. eriantha during growing season. Plant Sci. J. 2011, 29, 370–376. [Google Scholar]
- Xu, X.B.; Huang, C.H.; Qu, X.Y.; Chen, M.; Zhong, M.; Lang, B.B.; Chen, C.J.; Xie, M.; Zhang, W.B. A new easy peeling Actinidia eriantha cultivar ‘Ganmi 6’. Acta Hortic. Sin. 2015, 42, 2539–2540. [Google Scholar] [CrossRef]
- Priecina, L.; Karklina, D. Composition of major organic acids in vegetables and spices. In Proceedings of the CBU International Conference Proceedings, Prague, Czech Republic, 25–27 March 2015; Volume 3, pp. 447–454. [Google Scholar] [CrossRef] [Scilit]
- Wu, B.H.; Zhao, J.B.; Chen, J.; Xi, H.F.; Jiang, Q.; Li, S.H. Maternal inheritance of sugars and acids in peach (P. persica (L.) Batsch) fruit. Euphytica 2012, 188, 333–345. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.Z.; Li, P.M.; Cheng, L.L. Developmental changes of carbohydrates, organic acids, amino acids, and phenolic compounds in ‘Honeycrisp’ apple flesh. Food Chem. 2010, 123, 1013–1018. [Google Scholar] [CrossRef] [Scilit]
- Ma, B.Q.; Yuan, Y.Y.; Gao, M.; Li, C.Y.; Ogutu, C.; Li, M.J.; Ma, F.W. Determination of predominant organic acid components in Malus species: Correlation with apple domestication. Metabolites 2018, 8, 74. [Google Scholar] [CrossRef] [Scilit]
- Shi, C.Y.; Hussain, S.B.; Yang, H.; Bai, Y.X.; Khan, M.A.; Liu, Y.Z. CsPH8, a P-type proton pump gene, plays a key role in the diversity of citric acid accumulation in Citrus fruits. Plant Sci. 2019, 289, 110288. [Google Scholar] [CrossRef] [Scilit]
- Cholet, C.; Claverol, S.; Claisse, O.; Rabot, A.; Osowsky, A.; Dumot, V.; Ferrari, G.; Gény, L. Tartaric acid pathways in Vitis vinifera L. (cv. Ugni blanc): A comparative study of two vintages with contrasted climatic conditions. BMC Plant Biol. 2016, 16, 144. [Google Scholar] [CrossRef] [Scilit]
- Sanz, M.L.; Villamiel, M.; Martinezcastro, I. Inositols and carbohydrates in different fresh fruit juices. Food Chem. 2004, 87, 325–328. [Google Scholar] [CrossRef] [Scilit]
- Ichiro, N.; Tetsuo, F.; Atsuko, S.; Tadachika, O. Sugar and organic acid composition in the fruit juice of different Actinidia varieties. Food Sci. Technol. Res. 2008, 14, 67–73. [Google Scholar] [CrossRef] [Scilit]
- Zhou, Y.; Fu, H.F. Determination of organic acids in kiwifruit by reversed-phase HPLC method. Food Res. Dev. 2013, 34, 85–87. [Google Scholar] [CrossRef]
- Okuse, A.; Okuse, I.; Ryugo, K. Effects of certain processing methods, substrate level, and polyphenoloxi- dase on the stability of ascorbic acid in kiwifruit. Hortscience 1981, 16, 164–165. [Google Scholar]
- Marsh, K.B.; Boldingh, H.L.; Shilton, R.S.; Laing, W.A. Changes in quinic acid metabolism during fruit development in three kiwifruit species. Funct. Plant Biol. 2009, 36, 463–470. [Google Scholar] [CrossRef] [Scilit]
- Macrae, E.A.; Bowen, J.H.; Stec, M.G. Maturation of kiwifruit (Actinidia deliciosa cv. Hayward) from two orchards: Differences in composition of the tissue zones. J. Sci. Food Agric. 2010, 47, 401–416. [Google Scholar] [CrossRef] [Scilit]
- Marsh, K.; Attanayake, S.; Walker, S.; Gunson, A.; Boldingh, H.; Macrae, E. Acidity and taste in kiwifruit. Postharvest Biol. Technol. 2004, 32, 159–168. [Google Scholar] [CrossRef] [Scilit]
- Ni, W.; Gai, R.; Yu, W.Z.; Mao, Y.F.; Liu, Q.; Mao, Z.Q.; Chen, X.S.; Shen, X. Effects of different pollination combinations on ASA content, activity of antioxidant coordinating enzymes and dynamic changes of sugars and organic acid compositions in apple fruits. J. Fruit Sci. 2017, 34, 670–681. [Google Scholar] [CrossRef]
- Luo, A.C.; Yang, X.H.; Deng, Y.Y.; Li, C.F.; Xiang, K.S.; Li, D.G. Organic acid concentrations and the relative enzymatic changes during the development of Citrus fruits. Agric. Sci. China 2003, 36, 941–944. [Google Scholar]
- Sha, S.F.; Li, J.C.; Wu, J.; Zhang, S.L. Changes in the organic acid content and related metabolic enzyme activities in developing ‘Xinping’ pear fruit. Afr. J. Agric. Res. 2011, 6, 3560–3567. [Google Scholar] [CrossRef] [Scilit]
- Chen, M.X.; Zhao, C.K.; Chen, X.S.; Hao, H.J.; Zhang, X.S. Relationship between accumulation of organic acid and organic acid metabolizing enzymes during apricot fruit development. J. Fruit Sci. 2009, 26, 471–474. [Google Scholar] [CrossRef]
- Ma, Q.Q. Study on the changes of main organic acid content and acid-metabolism during the development of jujube fruits. Master’s Thesis, Tarim University, Alar, China, June 2017. [Google Scholar]
- Wang, X.H.; Chen, H.; Dong, X.Q. Changes in organic acids content during ‘Fengtang’ plum (Prunus salicina) fruit development in relation to malic acid metabolism related enzymes. J. Fruit Sci. 2018, 35, 293–300. [Google Scholar] [CrossRef]
- Singh, S.A.; Christendat, D. Structure of arabidopsis dehydroquinate dehydratase-shikimate dehydro- genase and implications for metabolic channeling in the shikimate pathway. Biochemistry 2006, 45, 7787–7796. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sadka, A.; Dahan, E.; Cohen, L.; Marsh, K.B. Aconitase activity and expression during the development of lemon fruit. Physiol. Plantarum. 2010, 108, 255–262. [Google Scholar] [CrossRef] [Scilit]
- Mu, X.P.; Wang, P.F.; Du, J.J.; Gao, Y.G.; Zhang, J.C. Comparison of fruit organic acids and metabolism- related gene expression between Cerasus humilis (Bge.) Sok and Cerasus glandulosa (Thunb.) Lois. PLoS ONE 2018, 13, e0196537. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lindner, H.A.; Nadenu, G.; Matte, A.; Michel, G.; Ménard, R.; Cygler, M. Site-directed mutagenesis of the active site region in the quinate/shikimate 5-dehydrogenase YdiB of Escherichia coli. J. Biol. Chem. 2005, 280, 7162–7169. [Google Scholar] [CrossRef] [Scilit]
- Hussain, S.B.; Shi, C.Y.; Guo, L.X.; Kamran, H.M.; Sadka, A.; Liu, Y.Z. Recent advances in the regulation of citric acid metabolism in Citrus fruit. Crit. Rev. Plant Sci. 2017, 36, 1–16. [Google Scholar] [CrossRef] [Scilit]
- Etienne, A.; Genard, M.; Lobit, P.; Mbeguie, A.M.D.; Bugaud, C. What controls fleshy fruit acidity? A review of malate and citrate accumulation in fruit cells. J. Exp. Bot. 2013, 64, 1451–1469. [Google Scholar] [CrossRef] [Scilit]
- Sadka, A.; Artzi, B.; Cohen, L.; Dahan, E.; Hasdai, D.; Tagari, E.; Erner, Y. Arsenite reduces acid content in Citrus fruit, inhibits activity of citrate synthase but induces its gene expression. J. Am. Soc. Hortic. Sci. 2000, 125, 288–293. [Google Scholar] [CrossRef] [Scilit]
- Chen, M.; Xie, X.L.; Lin, Q.; Chen, J.Y.; Grierson, D.; Yin, X.R.; Sun, C.D.; Chen, K.S. Differential expression of organic acid degradation-related genes during fruit development of navel oranges (Citrus sinensis) in two habitats. Plant Mol. Biol. Rep. 2013, 31, 1131–1140. [Google Scholar] [CrossRef] [Scilit]
- Chen, M.X.; Chen, X.S.; Ci, Z.J.; Shi, Z.A. Changes of sugar and acid constituents in apricot during fruit development. Acta Hortic. Sin. 2006, 33, 805–808. [Google Scholar] [CrossRef]
- Liu, Y.L.; Jin, Z.F.; Chen, H. Changes of the organic acid concentrations and the relative metabolic enzyme activities during the development of Prunus mume fruit. Acta Bot. Boreal. Occident. Sin. 2017, 37, 130–137. [Google Scholar] [CrossRef]
- Yun, Z.; Jin, S.; Ding, Y.D.; Wang, Z.; Gao, H.J.; Pan, Z.Y.; Xu, J.; Cheng, Y.J.; Deng, X.X. Comparative transcriptomics and proteomics analysis of Citrus fruit, to improve understanding of the effect of low temperature on maintaining fruit quality during lengthy post-harvest storage. J. Exp. Bot. 2012, 63, 2873–2893. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Canel, C.; Bailey-Serres, J.N.; Roose, M.L. Molecular characterization of the mitochondrial citrate synthase gene of an acidless pummelo (Citrus maxima). Plant Mol. Biol. 1996, 31, 143–147. [Google Scholar] [CrossRef] [Scilit]
- Notton, B.A.; Blanke, M.M. Phosphoenolpyruvate carboxylase in avocado fruit: Purification and properties. Phytochemistry 1993, 33, 1333–1337. [Google Scholar] [CrossRef] [Scilit]
- Blanke, M.M.; Lenz, F. Fruit photosynthesis. Plant Cell Environ. 1989, 12, 31–46. [Google Scholar] [CrossRef] [Scilit]
- Guo, R.Z.; Guo, W.R.; Li, X.Y.; Kou, X.H. Changes of organic acid contents and relative enzyme activities during the development of Huangguan pear fruit. Jiangsu J. Agric. Sci. 2013, 29, 157–161. [Google Scholar] [CrossRef]
- Zhang, G.F.; Lu, X.P.; Xie, S.X. Influence of water stress in different development stage on the citric acid metabolism-related genes expression in the ‘ponkan’ fruits. J. Fruit Sci. 2015, 32, 525–535. [Google Scholar] [CrossRef]
- Chen, L.S.; Tang, N.; Jiang, H.X.; Yang, L.T.; Li, Q.; Smith, B.R. Changes in organic acid metabolism differ between roots and leaves of Citrus grandis in response to phosphorus and aluminum interactions. J. Plant Physiol. 2009, 166, 2023–2034. [Google Scholar] [CrossRef] [Scilit]
- Cercós, M.; Soler, G.; Iglesias, D.J.; Gadea, J.; Forment, J.; Talón, M. Global analysis of gene expression during development and ripening of Citrus fruit flesh. A proposed mechanism for citric acid utilization. Plant Mol. Biol. 2006, 62, 513–527. [Google Scholar] [CrossRef] [Scilit]
- Terol, J.; Soler, G.; Talon, M.; Cercos, M. The aconitate hydratase family from Citrus. BMC Plant Biol. 2010, 10, 222. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Roongruangsri, W.; Rattanapanone, N.; Leksawasdi, N.; Boonyakiat, D. Changes in organic acid contents and related metabolic enzyme activities at different stages of growth of two tangerine cultivars. J. Agric. Sci. 2012, 4, 276–284. [Google Scholar] [CrossRef] [Scilit]
- Wang, X.Y.; Wang, P.; Qi, Y.P.; Zhou, C.P.; Yang, L.T.; Liao, X.Y.; Wang, L.Q.; Zhu, D.H.; Chen, L.S. Effects of granulation on organic acid metabolism and its relation to mineral elements in Citrus grandis juice sacs. Food Chem. 2014, 145, 984–990. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ossipov, V.; Bonner, C.; Ossipova, S.; Jensen, R. Broad-specificity quinate (shikimate) dehydrogenasefrom Pinus taeda needles. Plant Physiol. Biochem. 2000, 38, 923–928. [Google Scholar] [CrossRef] [Scilit]
- Hirai, M.; Ueno, I. Development of Citrus fruits: Fruit development and enzymatic changes in juice vesicle tissue. Plant Cell Physiol. 1977, 18, 791–799. [Google Scholar] [CrossRef] [Scilit]
- Liao, G.L.; He, Y.Q.; Li, X.S.; Zhong, M.; Huang, C.H.; Yi, S.Y.; Liu, Q.; Xu, X.B. Effects of bagging on fruit flavor quality and related gene expression of AsA synthesis in Actinidia eriantha. Sci. Hortic. 2019, 256, 108511. [Google Scholar] [CrossRef] [Scilit]
- Ampomah, D.C.; Mcghie, T.; Wibisono, R.; Montefiori, M.; Hellens, R.P.; Allan, A.C. The kiwifruit lycopene beta-cyclase plays a significant role in carotenoid accumulation in fruit. J. Exp. Bot. 2009, 60, 3765–3779. [Google Scholar] [CrossRef] [Scilit]
- Vandesompele, J.; Preter, K.D.; Pattyn, F.; Poppe, B.; Roy, N.V.; Paepe, A.D.; Speleman, F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002, 3, 34. [Google Scholar] [CrossRef] [Scilit]






| Quinic | Citric | Total | QDH | SDH | CS | IDH | Mit-Aco | Cyt-Aco | PEPC | eSDH | eDQS | eCS | eAco | eIDH | |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Quinic | 1.000 | ||||||||||||||
| Citric | 0.295 | 1.000 | |||||||||||||
| Total | 0.792 ** | 0.805 ** | 1.000 | ||||||||||||
| QDH | 0.107 | −0.755 ** | −0.376 | 1.000 | |||||||||||
| SDH | −0.019 | −0.729 * | −0.411 | 0.863 ** | 1.000 | ||||||||||
| CS | 0.432 | 0.601 | 0.602 | −0.582 | −0.493 | 1.000 | |||||||||
| IDH | −0.355 | 0.473 | 0.096 | −0.674 * | −0.319 | 0.265 | 1.000 | ||||||||
| Mit-Aco | 0.550 | −0.303 | 0.133 | 0.614 * | 0.204 | −0.151 | −0.771 ** | 1.000 | |||||||
| Cyt-Aco | 0.711 * | 0.089 | 0.498 | 0.254 | 0.021 | −0.005 | −0.443 | 0.603 * | 1.000 | ||||||
| PEPC | −0.206 | 0.553 | 0.193 | −0.580 | −0.416 | 0.312 | 0.347 | −0.682 * | −0.367 | 1.000 | |||||
| eSDH | −0.266 | −0.698 * | −0.558 | 0.809 ** | 0.922 ** | −0.521 | −0.258 | 0.068 | −0.121 | −0.254 | 1.000 | ||||
| eDQS | −0.465 | −0.220 | −0.374 | 0.155 | 0.392 | 0.045 | 0.280 | −0.347 | −0.277 | −0.052 | 0.559 | 1.000 | |||
| eCS | 0.334 | −0.436 | −0.040 | 0.701 * | 0.447 | −0.407 | −0.896 ** | 0.627 * | 0.469 | −0.377 | 0.356 | −0.175 | 1.000 | ||
| eAco | 0.295 | −0.411 | −0.087 | 0.590 | 0.387 | −0.005 | −0.420 | 0.756 ** | 0.149 | −0.647 * | 0.274 | 0.000 | 0.190 | 1.000 | |
| eIDH | −0.202 | 0.565 | 0.226 | −0.681 * | −0.314 | 0.602 | 0.807 ** | −0.824 ** | −0.446 | 0.640 * | −0.185 | 0.410 | −0.752 ** | −0.501 | 1.000 |
| Gene | Accession No. | Forward primer (5’-3’) | Reverse primer (5’-3’) |
|---|---|---|---|
| CS | Achn032171 | AGGTTGAGATGGGAGGATG | GAAGGTAGCGGTATCATCG |
| Aco | Achn079831 | CGCTCAGTATTAGGGCTCA | GTTCATAGCATCCCGCATA |
| IDH | Achn019991 | GAGCGATACGAAGTCCACG | TCTTGGGTGGTGCTGTCTC |
| SDH | Achn219731 | GAAGGTGGTCAATACGA | TCACCCATAGTTACCTCA |
| DQS | Achn075801 | GAAGGTGGTCAATACGA | TGTTGAAGGCTATGTAAAG |
| β-actin | Achn107181 | GCTTACAGAGGCACCACTCAACC | CCGGAATCCAGCACCAATACCAG |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jiang, Z.; Huang, Q.; Jia, D.; Zhong, M.; Tao, J.; Liao, G.; Huang, C.; Xu, X. Characterization of Organic Acid Metabolism and Expression of Related Genes During Fruit Development of Actinidia eriantha ‘Ganmi 6’. Plants 2020, 9, 332. https://doi.org/10.3390/plants9030332
Jiang Z, Huang Q, Jia D, Zhong M, Tao J, Liao G, Huang C, Xu X. Characterization of Organic Acid Metabolism and Expression of Related Genes During Fruit Development of Actinidia eriantha ‘Ganmi 6’. Plants. 2020; 9(3):332. https://doi.org/10.3390/plants9030332
Chicago/Turabian StyleJiang, Zhiqiang, Qing Huang, Dongfeng Jia, Min Zhong, Junjie Tao, Guanglian Liao, Chunhui Huang, and Xiaobiao Xu. 2020. "Characterization of Organic Acid Metabolism and Expression of Related Genes During Fruit Development of Actinidia eriantha ‘Ganmi 6’" Plants 9, no. 3: 332. https://doi.org/10.3390/plants9030332
APA StyleJiang, Z., Huang, Q., Jia, D., Zhong, M., Tao, J., Liao, G., Huang, C., & Xu, X. (2020). Characterization of Organic Acid Metabolism and Expression of Related Genes During Fruit Development of Actinidia eriantha ‘Ganmi 6’. Plants, 9(3), 332. https://doi.org/10.3390/plants9030332

